La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

A.A. 2008-2009 CORSO DI BIOINFORMATICA per il CLT in Biotecnologie Sanitarie Università di Padova Docente: Dr. STEFANIA BORTOLUZZI.

Presentazioni simili


Presentazione sul tema: "A.A. 2008-2009 CORSO DI BIOINFORMATICA per il CLT in Biotecnologie Sanitarie Università di Padova Docente: Dr. STEFANIA BORTOLUZZI."— Transcript della presentazione:

1 A.A CORSO DI BIOINFORMATICA per il CLT in Biotecnologie Sanitarie Università di Padova Docente: Dr. STEFANIA BORTOLUZZI

2 THE BIG DATA ERA Researchers need to be obliged to document and manage their data with as much professionalism as they devote to their experiments. Nature journal Issue of 4 September 2008 Importance of data: Retrieval Integration Analysis An at least basic knowledge of bioinformatic methods in unavoidable also for experimental researchers Bioinformatics from basic methods for managing biosequences to systems biology models

3 DATABASES AND DATA RETRIEVAL Biosequences and Gene-related info

4 WORKING WITH BIOSEQUENCES Alignments and similarity search

5 gene details Annotation Tracks official sequence comparisons SNPs NAVIGATING GENOMES By Genome Browsers

6 Introduction to more advanced bioinformatics Gene expression data analysis Search for patterns and functional motifs Prediction of protein structure

7 Svolgimento del corso e modalità desame Al II semestre del II anno. Durata: 32 ore, comprendenti lezioni teoriche frontali ed esercitazioni al computer. Valutazione finale: in base allesito delle esercitazioni svolte in piccoli gruppi e di una verifica scritta individuale.

8 WEB SITE DEDICATO AL CORSO 2009/Bioinformatica_BTS/Bioinfo_BTS.php

9 I LEZIONE Database primari e Database secondari Database di sequenze nucleotidiche e proteiche GenBank, short seqs. archives SWISSPROT, Uniprot ENTREZ Information retrieval system – Pubmed – Bookshelf

10 INTRODUZIONE ALLUTILIZZO DI DATABASE Struttura e organizzazione di database I database sono insiemi di dati memorizzati su un computer con diversi livelli di astrazione al di sopra di essi; ogni livello di astrazione consente di organizzare i dati contenuti e di accedervi. Database diversi organizzano i dati in modi differenti database Flat-File il tipo piu semplice di database database relazionali (Oracle, mySQl) permettono la composizione di interrogazioni o query che collegano piu' tabelle, stabilendo delle "relazioni" tra i contenuti delle singole tabelle. database Object Oriented, le informazioni sono gestite come "oggetti" con varie "proprietà", invece che records con campi. Tutti i sistemi di database impiegano delle interfacce (API, Application Programming Interface) per accedere ai dati e modificarli

11 INTRODUZIONE ALLUTILIZZO DI DATABASE Database flat-file Il tipo piu' semplice di database e' il database flat-file, formato da files di testo ASCII in formato standard che il programa esamina per cercare informazioni. Il formato e' di solito costituito da un insieme di campi, contenenti ciascuno una specifica categoria di informazioni, delimitati attraverso caratteri speciali o con lunghezza fissa assegnata. Il pregio principale dei database flat-file e' la semplicita' di gestione, controbilanciata pero' dallincapacita' di gestire accesso concorrente e dalla mancanza di indicizzazione dei dati, che non consentono interrogazioni sequenziali.

12 LEVELS OF PROTEIN SEQUENCE AND STRUCTURAL ORGANISATION PRIMARY sequence primary database SECONDARY motif secondary database TERTIARY domain module secondary database DATABASE PRIMARI E DATABASE SECONDARI ORGANIZZANO RISPETTIVAMENTE DATI ORIGINALI E CONOSCENZA GENERATA A PARTIRE DA ANALISI DI DATI O INTEGRAZIONE DI DATI DIVERSI

13 Using a database How to get information out of a database: –Summaries: how many entries, average or extreme values; rates of change, most recent entries, etc. –Browsing: getting a sense of the kind and quality of information available, e.g. checking familiar records –Search: looking for specific, predefined information Key to searching a database: –Must identify the element(s) of the database that are of interest somehow: Gene name, symbol, location or other identifying information. Sequences of genes, mRNAs, proteins, etc. A crossreference from another database or database generated id.

14 DATABASE PRIMARI DATABASE DI SEQUENZE NUCLEOTIDICHE Collezioni di singoli record, ognuno dei quali contiene un tratto di DNA o RNA con delle annotazioni. Ogni record viene anche chiamato ENTRY, e ha un codice che lo identifica univocamente (ACCESSION NUMBER). Le tre principali banche dati primarie di sequenze nucleotidiche sono: EMBL nucleotide database, ora gestita dallEBI (1980) EMBL = European Molecular Biology Laboratory (Heidelberg) EBI = European Bioinformatics Institute (Hinxton, UK) GenBank = banca dell NIH gestita dal NCBI (1982) NIH = National Institutes of Health (Stuttura USA) NCBI = National Center for Biotechnology Information, Bethesda, Maryland DDBJ = banca DNA giapponese (1986) DDBJ = DNA DataBase of Japan SCAMBIO DI DATI Nel 1988, i gruppi responsabili dei 3 database si sono organizzati nellInternational Collaboration of DNA Sequence Databases per utilizzare un formato comune e scambiarsi giornalmente le sequenze.

15 SUBMISSION DIRETTA La gran parte delle sequenze finisce in uno dei tre database perché lautore (il laboratorio dove tale sequenza é stata ottenuta) la invia direttamente. La sequenza viene quindi inserita e il record corrispondente resta di proprietà solo di quel database, lunico con il diritto di modificarlo. Il database che riceve la sequenza la invia poi agli altri due. Circa il 98% delle sequenze in un database sono presenti anche negli altri due. ANNOTAZIONE Ci sono poi anche degli annotatori che prendono le sequenze dalle riviste scientifiche e le trasferiscono nel database. Problema della ridondanza There are specialized, streamlined procedures for batch submissions of sequences, such as EST, STS, and HTG sequences (High-throughput sequencing).ESTSTSHTG DATABASE DI SEQUENZE NUCLEOTIDICHE – GenBank

16 NAR Database Issue Year Base Pairs Sequences ,008,761,784 2,837, ,116,431,94298,868,465

17 GenBank contiene diverse sezioni in passato divise per gruppi tassonomici e strategie di sequenziamento ora tre grandi sezioni : CoreNucleotide (the main collection), dbEST (Expressed Sequence Tags), and dbGSS (Genome Survey Sequences). dbEST database pubblico di "Expressed Sequence Tags" (sequenze espresse contrassegnate), contiene tutte le sequenze ottenute dal sequenziamento parziale o totale di cloni di cDNA, molto utili per: Identificare nuovi geni Studiare la struttura esoni/introni di geni Studiare lespressione genica Come e fatta unentry di GenBank ?

18

19

20 Pyrosequencing o sequencing by syntesis: si basa sulla rilevazione del pirofosfato rilasciato dallincorporazione di un nucleotide durante la sintesi del DNA, effettuata in nanoreattori in emulsione. Per ciascuna cella, la sequenza nucleotidica è determinata dai picchi del pirogramma, mentre il filamento di DNA complementare viene sintetizzato Accumulo ancora più rapido e massivo di moltissime sequenze brevi: short reads: 35 for Illumina and solid, for Roche 454 Un singolo run puo produrre di sequenze (reads) 450 Megabasi in 10 ore Servono nuovi database/repository di dati! Nuove metodologie di sequenziamento di terza generazione

21 Nuovi database/repository di dati grezzi: NCBI SRA Short Reads Archive ENA european nucleotide archive Assemblies disponibili in genbank Struttura tipo di unentry: metadati su study, sample ed experiment dati, sequenze vere e proprie in formato FHKWVLO02GHWT8 length=141 TTTCTTTGACCACGTCTTGGTTTTGCACCAGAAGTCCACCA ACTACACCTGTGTATTCTGCTTCCACTTCACTGGCCTCTTG AGCATCAAATGGTAAGGCAAGGATACGCAAGTTTTTCTTTT GTTGGTTCGAAAATAGGC +SRR FHKWVLO02GHWT8 length=141 AA??111AAAAAAAAAAAEBAAAAABBAAABAA????BAA? /..0

22

23 DATABASE PRIMARI DATABASE DI SEQUENZE PROTEICHE SWISS-PROT Database di sequenze proteiche annotate, scarsamente ridondanti e cross-referenced Contiene TrEMBL, supplemento a SWISS-PROT costituito dalle sequenze annotate al computer, come traduzione di tutte le sequenze codificanti presenti allEMBL TrEMBL contiene due sezioni: SP-TrEMBL, sequenze da incorporare in SWISSPROT, con AC. REM-TrEMBL, remaining (immunoglobuline, proteine sintetiche,...), senza AC. TrEMBLnew, generato ogni settimana.

24 DATABASE SECONDARI UniProt (Universal Protein Resource) Il piu grande catalogo di informazioni sulle proteine. Contiene informazioni sulla sequenza e sulla funzione di proteine ed e ottenuto dallinsieme delle informazioni contenute in Swiss- Prot, TrEMBL e PIR.

25 UniProt UniProt Knowledgebase, due parti: Records annotati manualmente, informazioni dalla letteratura (UniProtKB/Swiss-Prot) Records risultato di analisi computazionali, in attesa di annotazione completa (UniProtKB/TrEMBL).

26 DATABASE SECONDARI ENTREZ - Information retrieval system E' stato sviluppato allNCBI (National Center for Biotechnology Information, USA) per permettere l'accesso a dati di biologia molecolare e citazioni bibliografiche. Sfrutta il concetto di neighbouring: possibilita' di collegare tra loro oggetti diversi di database differenti, indipendentemente dal fatto che essi siano direttamente cross-referenced. Tipicamente, ENTREZ permette l'accesso a database di sequenze nucleotidiche, di sequenze proteiche, di mappaggio di cromosomi e di genomi, di struttura 3D e bibliografici (PubMed).

27

28 PubMed

29 Bookshelf


Scaricare ppt "A.A. 2008-2009 CORSO DI BIOINFORMATICA per il CLT in Biotecnologie Sanitarie Università di Padova Docente: Dr. STEFANIA BORTOLUZZI."

Presentazioni simili


Annunci Google