La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

LA GENETICA CLASSICA Ereditarietà mendeliana e relative eccezioni Liceo Galvani I E 06.05.2015.

Presentazioni simili


Presentazione sul tema: "LA GENETICA CLASSICA Ereditarietà mendeliana e relative eccezioni Liceo Galvani I E 06.05.2015."— Transcript della presentazione:

1 LA GENETICA CLASSICA Ereditarietà mendeliana e relative eccezioni Liceo Galvani I E 06.05.2015

2 Carattere Qualsiasi caratteristica di un organismo Tratto Modalità assunta da un determinato carattere SemeFioreBaccelloFusto Liscio Rugoso Giallo Verde Bianco Violetto Gonfio Schiacciato Verde Giallo Fiori assiali Fiori terminali Alto Basso Forma Cotiledone ColoreFormaColore Posizione Lunghezza Carattere Tratto Facciamo il punto

3 Gene Segmento di DNA che: - codifica per una proteina specifica - determina un carattere ereditario - occupa sul cromosoma una posizione, detta locus

4 Facciamo il punto Allele Forma alternativa con cui può presentarsi un certo gene, determinando modalità diverse del relativo carattere (tratto) CGCATCTCGTTATTTAATCCTTCACTGCATTATG ------------------------------------------------------------------ Allele A Allele a CGCATCTCGTTATCTAATCCTTCACTGCATTATG ------------------------------------------------------------------ In un individuo i 2 alleli occupano sui cromosomi omologhi lo stesso locus

5 Genotipo E’ il corredo genetico di un individuo, in altre parole ciò che è “scritto” nel DNA contenuto nel nucleo di tutte le sue cellule. Fenotipo E’ l’insieme dei caratteri (declinati nei diversi tratti) che l’individuo manifesta. Dipende dal suo genotipo, dalle interazioni fra i geni e dal contributo dei fattori ambientali. Facciamo il punto

6 Caratteri ereditari Attaccatura dei lobi dell’orecchio Intreccio delle dita Fossette Uso mano dx/sx Gusto amaro Tipologia di capelli Daltonismo Attaccatura dei capelli Lentiggini Forma del pollice

7 Dominante Recessivo Allele Dominante Si manifesta sia negli individui omozigoti che eterozigoti Allele Recessivo Si manifesta solo negli individui omozigoti L’analisi genetica iniziò con Mendel Caratteri studiati delle piante di pisello

8 Gli alleli possono essere dominanti o recessivi a seconda del carattere considerato allele dell’anemia falciforme Recessivo > anemia falciforme Dominante > resistenza alla malaria L’anemia falciforme è una malattia genetica del sangue, la cui caratteristica principale è l’anemia cronica (scarsità di globuli rossi e emoglobina). Prende il nome dalla forma “ a falce” che assumono i globuli rossi malati ed è particolarmente frequente in regioni in cui la malaria è endemica.

9 Gli alleli dominanti non sono sempre i più comuni POLIDATTILIA Malformazione congenita ed ereditaria caratterizzata dalla presenza di dita in più alle mani o ai piedi. Quando non è associata ad un più ampio quadro sindromico, la polidattilia è un tratto dominante. Ne deriva che la condizione più frequente - avere 5 dita per arto - è recessiva!

10 Esempi di malattie genetiche mendeliane nell’uomo Malattia autosomica dominante: ACONDROPLASIA Malattia autosomica recessiva: ALBINISMO Alterazione dello sviluppo scheletrico e aspetto caratteristico del volto, con prominenza frontale accentuata Assenza o riduzione della melanina in pelle, capelli, peli e occhi, cui possono essere associate alterazioni dell’occhio e del nervo ottico.

11 Poliallelia Relazioni complesse fra genotipo e fenotipo Nuovi alleli si originano per mutazioni a carico della sequenza del gene. I diversi fenotipi sono espressione delle combinazioni alleliche possibili. CGCATCTCGTTATTTAATCCTTCACTGCATTATG ------------------------------------------------------------------ Allele A Allele a CGCATCTCGTTATCTAATCCTTCACTGCATTATG ------------------------------------------------------------------ Allele a b CGCATCTCGTTATTTAATCCTTCACTACATTATG ------------------------------------------------------------------ Allele a c CGCGTCTCGTTATTTAATCCTTCACTGCATTATG ------------------------------------------------------------------

12 Codominanza allele dell’anemia falciforme Recessivo > anemia falciforme Dominante > resistenza alla malaria Relazioni complesse fra genotipo e fenotipo Codominanza > globuli rossi normali e falciformi

13 Dominanza incompleta Relazioni complesse fra genotipo e fenotipo Beta talassemia o anemia mediterranea Omozigoti per l’allele “normale”: Nessun sintomo Omozigoti per l’allele “malato”: Grave anemia trasfusione-dipendente e globuli rossi di piccole dimensioni (major) Eterozigoti: Asintomatici con dimensioni dei globuli rossi notevolmente ridotte (minor)

14 Attaccatura dei lobi dell’orecchio Intreccio delle dita Fossette Uso mano dx/sx Gusto amaro Tipologia di capelli Daltonismo Attaccatura dei capelli Lentiggini Forma del pollice Eredità poligenica

15 Attaccatura dei lobi dell’orecchio Forma del pollice Spettro fenotipico continuo

16 Epistasi Interazione tra geni diversi che porta alla variazione di un carattere, mediante effetto di copertura di un gene su un altro. BB o Bb o bb ee bb EE o Ee BB o Bb EE o Ee

17 allele dell’anemia falciforme Recessivo > anemia falciforme Dominante > resistenza alla malaria Codominanza Effetto pleiotropico Pleiotropia

18 Influenza dell’ambiente sui geni Caratteri multifattoriali e contributo ambientale


Scaricare ppt "LA GENETICA CLASSICA Ereditarietà mendeliana e relative eccezioni Liceo Galvani I E 06.05.2015."

Presentazioni simili


Annunci Google