La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Evoluzione delluomo: nuovi dati e nuove ipotesi David Caramelli Dipartimento di Biologia Evoluzionistica Laboratori di Antropologia, Unità di Antropologia.

Presentazioni simili

Presentazione sul tema: "Evoluzione delluomo: nuovi dati e nuove ipotesi David Caramelli Dipartimento di Biologia Evoluzionistica Laboratori di Antropologia, Unità di Antropologia."— Transcript della presentazione:

1 Evoluzione delluomo: nuovi dati e nuove ipotesi David Caramelli Dipartimento di Biologia Evoluzionistica Laboratori di Antropologia, Unità di Antropologia Molecolare e Paleogenetica, Università di Firenze

2 Dal fossile alla molecola


4 A 16263bT 16262 G 16258A 16256 T 16234G 16230 A 16244 PRIMER L PRIMER H

5 0 0 0 0 0 2 3 7 8 9 3 7 8 6 3 Referencia GTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATT Feldhofer 1..............G........................................G..............C Mezmaiskaya..............................C....... Vindija 75..............G........................................G............... Feldhofer 2..............G........................................G............... Vindija 80..............G........................................G............... 11 11 1 1 1 1 1 00 11 2 3 4 5 5 78 12 9 9 8 4 6 Referencia TCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAA Feldhofer 1.............TT..TT................A.........T........T.....C.......... Mezmaiskaya...................................A.........T........T.......A........ Vindija 75...................................A.........T........T.....C.......... Feldhofer 2...................................A.........T........T.....C.......... Vindija 80...................................A.........T........T.....C.......... 1 11 1 2 2 2 2 6 88 8 0 2 3 3 9 23 9 9 3 0 4 Referencia AACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACA Feldhofer 1....T.............C.....C...................C.............T......G...T. Mezmaiskaya....T............CC.....C...................C.............T......G...T. Vindija 75....T............CC.....C...................C.............T......G...T. Feldhofer 2....T............CC.....C...................C.............T......G...T. Vindija 80....T............CC.....C...................C.............T......G...T. 2 2 2 2 2 2 2 4 5 5 6 6 7 9 4 6 8 2 3b 8 9 Referencia CATCAACTGCAACTCCAAAGCCACCCCT_CACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTA Feldhofer 1........A...........A.G...T.A..............T....................G...... Mezmaiskaya........A...........A.....T.A..............T....................G...... Vindija 75........A...........A.G...T.A..............T....................G...... Feldhofer 2........A...........A.....T.A..............T....................G...... Vindija 80........A...........A.G...T.A..............T....................G...... 3 3 3 3 1 2 4 6 1 0 4 2 Referencia CATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACC Feldhofer 1.....C........T.........................................C.............. Mezmaiskaya.....C........T.......................T.................C.............. Vindija 75.....C........T.........................................C.............. Feldhofer 2.....C........T.........................................C.............. Vindija 80.....C........T.........................................C.............. 4 0 Referencia CCCCTCAGATAGGGGTCCCTTGAC Feldhofer 1.......................T Mezmaiskaya....................... Vindija 75.. Feldhofer2.. Vindija 80..


7 Che cosa è un genoma antico? DNA estratto da organismi non più viventi, ma anche DNA recuperato da contesti particolari es mozzicone di sigarette tracce di sangue, peli etc Quindi è più corretto chiamare DNA degradato piuttosto che antico

8 DNA antico TempoDiagenesi Frammentato Degradato

9 DNA antico

10 K. platyops 4 3 2 1 0 Ar. ramidus Au. anamensis Au. afarensis Au. bahrelghazali Au. africanus P. aethiopicus P. robustus P. boisei Au. habilis Au. rudolfensis H. ergaster H. erectus H. antecessor Au. garhi 6 5 7 8 O. tugenensis H. heidelbergensis H. neanderthalensis H. sapiens S. tchadensis Ar. kadabba Transitional hominins Pre-modern Homo Archaic hominins Possible and probable early hominins Millions of Years Ago Anatomically modern Homo H. floresiensis Megadont archaic hominins 100.000 ybp

11 Homo sapiensHomo neandertalensis Homo erectus Homo heidelbergensis Homo floresiensis

12 Homo heidelbergensis Homo erectus

13 Homo sapiens Homo neandertalensis


15 Il loro scheletro

16 Culture Social Unit –Consisted of extended family members –Took care of the sick and injured –Mostly lived inside caves Like humans… –Knew how to use fire –Constructed complex temporary structures for shelter when migrating –Skinned animals Lacked art

17 Burials 1 st known hominids to bury dead Was it a ritual or simply to avoid attracting scavengers? Sites contain multiple individuals Usually inside caves/ rock shelters Some filled with items and pollen –Intentional or no? Occasional cannibalism

18 Hunting Mostly hunted, occasionally foraged Well suited to walking, running, hunting –Thickness and high density of leg bones Killed using stone point spears and axes –Rarely used ivory or bone until human interaction Women and sometimes even children hunted –Both men and women sustained numerous injuries from hunts – broken limbs –Few lived older than 30 years

19 Interaction with Humans Usually avoided each other when possible –Increasing numbers of humans in Neanderthal habitats made avoidance harder Culture Changes –Adoption of bone and ivory tools –Puncturing holes into animal bones for decoration Early form of art for Neanderthals


21 Perché così grande interesse nei confronti dei Neanderthal ?


23 Due modelli contrapposti sullorigine della nostra specie Out of Africa o sostituzioneModello della continuità regionale

24 Modello della Sostituzione (Stringer) CUGINI


26 Modello Multiregionale (Wolpoff) ANTENATI

27 Modello della sostituzione o anche delle Eva Africana si accorda molto bene con le evidenze offerte dalla antropologia molecolare e precisamente dallo studio del DNA Mitocondriale Mitochondrial DNA and Human Evolution, Cann R., 1987. Nature, 325: 31-36


29 DNA mitocondriale

30 DNA mitocondriale : perché? tasso di mutazione e costante 3.0 x 10^-5 o.00003 per nucleotide transmission event (nascita di una nuova generazione) Non ricombina Eredità materna

31 uovo spermatozoo DNA mitocondriale zigote

32 Eredità materna

33 1 2 3 4 5 6 7 8 9 10 antenato comune

34 I ricercatori californiani analizzarono 147 mitocondri di persone provenienti da tutti i continenti e ricostruirono quello che è diventato lalbero più famoso degli alberi evolutivi umani

35 Modello della sostituzione o anche delle Eva Africana si accorda molto bene con le evidenze offerte dalla biologia molecolare e precisamente dallo studio del DNA Mitocondriale Mitochondrial DNA and Human Evolution, Cann R., 1987. Nature, 325: 31-36

36 Maggiori Critiche da parte dei Multiregionalisti: A) Nessuno poteva assicurare che la ricostruzione al femminile della nostra evoluzione fosse veramente rappresentativa dellintero fenomeno B) Progressione continua nellanatomia dei fossili orientali di Homo e che la medesima congruenza morfologica fosse riscontrabile anche negli europei per cui i Neandertaliani dovevano essere gli antenati diretti delle attuali popolazioni

37 Nessuno poteva assicurare che la ricostruzione al femminile della nostra evoluzione fosse veramente rappresentativa dellintero fenomeno

38 La risposta alla prima critica fu subito data attraverso lanalisi del cromosoma Y che ricostruisce la storia evolutiva al maschile:

39 Come mai il Cromosoma Y ? Eredità paterna Come il DNA Mitocondriale anche il CRY non partecipa a fenomeni di ricombinazione Alto tasso di mutazione 2 x 10^-8 or 0.00000002 per nucleotide transmission event (birth of a new generation)


41 La risposta alla prima critica fu subito data attraverso lanalisi del cromosoma Y che ricostruisce la storia evolutiva al maschile: Adamo sarebbe vissuto in Africa intorno ai 100.000 anni fa

42 Progressione continua nellanatomia dei fossili orientali di Homo e che la medesima congruenza morfologica fosse riscontrabile anche negli europei per cui i Neandertaliani dovevano essere gli antenati diretti delle attuali popolazioni

43 Analisi del DNA dei Neandertaliani Paabo nel 1997 estrae e caratterizza il DNA dal primo e più famoso fossile Neandertaliano Successivamente vi sono altre conferme di questo dato

44 Differenze in sostituzioni nucleotidiche tra Homo neandertalensis, Homo sapiens, e Pan troglodites

45 NJ tree

46 La disputa sembrava chiusa a favore dei sostenitori dellorigine recente di Homo sapiens; Ma nel 1999 la disputa intellettuale improvvisamente si riapre: viene infatti recuperato uno scheletro di un bambino datato intorno ai 24500 BP appartenente sicuramente ad un rappresentante delluomo anatomicamente moderno ma con alcuni tratti tipici dei Neandertaliani: una prova per i multi regionalisti


48 Un analisi cruciale che poteva quindi mettere a tacere questa disputa scientifica sarebbe stata quella di analizzare il DNA mitocondriale di dei primi rappresentati delluomo moderno contemporaneo ai neandertaliani : Il nostro gruppo analizzò due individui Paglicci 25 e Paglicci 12 (Cromagnoidi) datati 24.000 BP


50 Dalle nostre analisi abbiamo visto che le più vecchie sequenze DNA mitocondriali europee, seppur cronologicamente più vicine ai neandertaliani che agli europei attuali, cadono allinterno della variabilità genetica delle moderne sequenze mitocondriali umane.

51 Multi dimensional scaling

52 Paglicci 25, 12



55 Separazione tra H.sapiens e H.neanderthalensis 800.000 H. erectus 40.000 arrivo in Europa 200.000 origine di H. sapiens









64 Ma chi erano i Neandertal ? Uomini o..

65 Parlavano come noi?


67 Fisicamente come erano?








75 Specie molto giovane con origine africana comune

76 Guardando un po dei numeri Homo sapiens e gli scimpanzè condividono >98% dei loro genomi Tra il 2 % delle differenze 1, 9 % è fissato nelle due diverse specie La rimanente frazione lo 0.1 % contiene tutta la variabilità genetica allinterno di una singola specie (3,213,401 Levy et al. 2007) Il 90% dell0.1 % rappresenta le differenze tra membri della stessa popolazione Le differenze tra i principali gruppi continentali rappresentano il 10% dello 0.1 % del totale quindi lo 0.010 % Ma lo 0.010% di 3 miliardi di bp significano circa 300.000 siti variabili Le differenze sono maggiori tra individui della stessa popolazione piuttosto che tra individui di popolazioni diverse

77 Variazione discontinua grande differenze tra gruppi Variazione continua piccole differenze tra gruppi ED E PER QUESTO CHE NON POSSIAMO PARLARE DI RAZZE : dato genetico, Homo sapiens Le differenze tra i principali gruppi continentali rappresentano il 10% dello 0.1 % del totale quindi lo 0.010 %

78 Ma lo 0.010 % di 3 miliardi di bp significano circa 300.000 siti variabili Ed e per questo che possiamo fare studi di genetica di popolazione per la ricostruzione della storia evolutiva della nostra specie Per comprendere le rotte migratorie delle antiche popolazioni Per tracciare i profili genetici ai fini identificativi e molto altro ancora…….. Tutti parenti, tutti differenti !!!!!!

79 Molecular Anthropology /Paleogenetic Florence group

Scaricare ppt "Evoluzione delluomo: nuovi dati e nuove ipotesi David Caramelli Dipartimento di Biologia Evoluzionistica Laboratori di Antropologia, Unità di Antropologia."

Presentazioni simili

Annunci Google