La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

La sintesi delle proteine ( materiali delle lezioni; 1ed 2008, agg. 2014) Tiziano Terrani, Liceo cantonale di Lugano 2 6952 SAVOSA.

Presentazioni simili


Presentazione sul tema: "La sintesi delle proteine ( materiali delle lezioni; 1ed 2008, agg. 2014) Tiziano Terrani, Liceo cantonale di Lugano 2 6952 SAVOSA."— Transcript della presentazione:

1 La sintesi delle proteine ( materiali delle lezioni; 1ed 2008, agg. 2014) Tiziano Terrani, Liceo cantonale di Lugano SAVOSA

2 Li Lu2, T.Terrani ( ) Genetica molecolare 2 sommario (scegliere con il cursore l’argomento desiderato!) dia 3-5Proteine: “molecole della vita” dia 6-7Come sono fatte le proteine dia 30-52Struttura generale aminoacidi/formula di struttura di tutti gli aminoacidi dia 8-9Le cellule sono fabbriche di proteine/I ribosomi dia 10Informazione genetica e acidi nucleici dia 53-70Struttura acidi nucleici (DNA/RNA) e duplicazione del DNA dia 11-12Che cosa è necessario per costruire le proteine dia 13Le fasi della sintesi proteica dia 14Relazione tra DNA e proteine dia 15-17Il codice genetico dia 18-23Sintesi delle proteine (animazione) dia 24Sintesi delle proteine: vista d’assieme dia 25-26Il t-RNA: l’interprete dia 27-29Come si riconoscono t-RNA e aminoacidi: amminoacil-t-RNA- sintetasi (animazione)

3 Li Lu2, T.Terrani ( ) Genetica molecolare 3 Proteine: “molecole della vita” DNA gene m-RNA citoplasma ribosoma proteina Qualsiasi processo vitale, sia nella singola cellula che nell’organismo pluricellulare nel suo insieme, dipende dalla presenza di proteine. A livello cellulare, i diversi tipi di proteine legati alle membrane o liberi negli spazi intracellulari servono a trasportare molecole e ioni da un lato all’altro della membrana consentono di ricevere informazioni dall’ambiente extracellulare permettono di convertire forme di energia sono responsabili dei movimenti cellulari con cilia e flagelli costituiscono l’impalcatura della cellula conferendo ad essa la sua forma specifica sono all’origine degli spostamenti di organelli e agglomerati molecolari all’interno della cellula come pure dei cromosomi durante la riproduzione cellulare fungono da catalizzatori specifici (enzimi) delle migliaia di reazioni chimiche diverse del metabolismo cellulare. Le proteine hanno compiti molteplici, sia nella struttura che nel funzionamento del sistema vivente.

4 Li Lu2, T.Terrani ( ) Genetica molecolare 4 convertire forme di energia Funzioni delle proteine di membrana comunicazione trasporto energia controllo reazioni chimiche forma e movimento

5 Li Lu2, T.Terrani ( ) Genetica molecolare 5 Proteine: “molecole della vita” DNA gene m-RNA citoplasma ribosoma proteina A livello di organismo pluricellulare, le proteine hanno un ruolo fondamentale : nel movimento essendo le componenti delle fibre muscolari contrattili (actina e miosina) nel mantenere forma e consistenza degli organi e della pelle (collagene e cheratina) nel trasporto di sostanze nel sangue (per es. emoglobina) nella difesa dell’organismo da agenti estranei (anticorpi). Nelle cellule si trovano (e vengono costruite) migliaia di proteine diverse, con funzioni differenti. La specializzazione delle cellule in compiti particolari all’interno dell’organismo pluricellulare dipende dalla presenza di proteine specifiche, tipiche di quel tipo cellulare. Nel corpo umano, sono decine di migliaia le proteine diverse presenti.

6 Li Lu2, T.Terrani ( ) Genetica molecolare 6 Come sono fatte le proteine? Le proteine sono macromolecole biologiche a struttura polimerica; esse sono cioè catene - di varia lunghezza - di aminoacidi (monomeri) uniti tra loro da legami peptidici. Nelle proteine si riconoscono una struttura primaria, cioè la sequenza degli aminoacidi, da una parte e la struttura secondaria e terziaria dall’altra, derivanti dai ripiegamenti che la catena di aminoacidi assume nello spazio. La struttura terziaria rende conto della forma tridimensionale caratteristica di ogni proteina. Da quest’ultima infine dipende in gran parte la funzione che la proteina svolge. Quando più catene proteiche si associano nella loro struttura terziaria, si ottengono dei complessi proteici con struttura quaternaria.

7 Li Lu2, T.Terrani ( ) Genetica molecolare 7 Struttura terziaria della mioglobina: una proteina di 153 aminoacidi primo aminoacido della catena ultimo aminoacido della catena polipeptidica

8 Li Lu2, T.Terrani ( ) Genetica molecolare 8 Le cellule sono fabbriche di proteine Le proteine, essendo macromolecole, vengono costruite (sintetizzate) all’interno delle cellule a partire dagli aminoacidi assorbiti con il cibo. All’interno di ogni cellula il processo della costruzione di nuove proteine rappresenta gran parte del metabolismo cellulare. Migliaia di molecole proteiche sono in costruzione ad ogni dato istante all’interno delle cellule. Le proteine vengono costruite nel citoplasma sui ribosomi.

9 Li Lu2, T.Terrani ( ) Genetica molecolare 9 I ribosomi: il “macchinario” per la sintesi proteica subunità piccola subunità grande

10 Li Lu2, T.Terrani ( ) Genetica molecolare 10 L’informazione genetica DNA gene m-RNA citoplasma ribosoma proteina Le informazioni necessarie per costruire sequenze differenti di aminoacidi (proteine differenti) sono contenute nel DNA! Per rendere possibile la costruzione delle proteine sono necessari altri due tipi di acidi nucleici: l’RNA messaggero (m-RNA): porta il messaggio del gene sul luogo della sintesi proteica (ribosoma) l’RNA di trasporto (t-RNA): trasporta al ribosoma il giusto aminoacido in corrispondenza della sua tripletta di codice

11 Li Lu2, T.Terrani ( ) Genetica molecolare 11 Che cosa è necessario per costruire una proteina? DNA gene m-RNA citoplasma ribosoma proteina Per costruire una proteina (sequenza di aminoacidi) occorrono: gli aminoacidi informazione (quanti, quali aminoacidi e in quale sequenza) energia (ATP) enzimi ribosomi (organelli cellulari), luogo della costruzione della proteina

12 Li Lu2, T.Terrani ( ) Genetica molecolare 12 La sintesi delle proteine DNA gene m-RNA citoplasma ribosoma proteina aminoacidi ATP enzimi

13 Li Lu2, T.Terrani ( ) Genetica molecolare 13 Le fasi della sintesi proteica DNA gene m-RNA citoplasma ribosoma proteina TRASCRIZIONE: l’informazione genetica relativa a una determinata proteina contenuta in un tratto di DNA (gene) viene trascritta sotto forma di un altro acido nucleico, l’RNA (“copia” del gene) Nelle cellule eucariotiche, l’informazione genetica trascritta deve essere trasportata dal nucleoplasma, sede del DNA (che forma i cromosomi) al citoplasma, nei luoghi dove verranno costruite le proteine: le molecole di RNA “copia” migrano verso il citoplasma. Per questa ragione l’RNA è detto messaggero: m-RNA Il macchinario cellulare che consente la sintesi di una proteina (legame degli aminoacidi nella sequenza indicata dall’m-RNA) è il ribosoma TRADUZIONE: l’informazione contenuta nella sequenza dei nucleotidi dell’m- RNA deve ora essere trasferita in una sequenza di aminoacidi (proteina): l’informazione deve essere tradotta dal linguaggio degli acidi nucleici (sequenza di nucleotidi) nel linguaggio delle proteine (sequenza di aminoacidi).

14 Li Lu2, T.Terrani ( ) Genetica molecolare 14 Relazione tra DNA e proteine AA 1 AA 17 AA 4 AA 5 AA 9 AA 7 AA 20 sequenza di nucleotidi sequenza di aminoacidi ? Doppia elica di DNA (2 nm di diametro) Istoni 700 nm A T G C C T A A G linguaggio a 4 lettere linguaggio a 20 lettere

15 Li Lu2, T.Terrani ( ) Genetica molecolare 15 Il codice genetico AA ? A G C Il CODICE GENETICO è l’insieme delle corrispondenze che mettono in relazione le triplette di DNA con gli aminoacidi: a quale tripletta di nucleotidi corrisponde quale aminoacido? linguaggio a 4 lettere linguaggio a 20 lettere Le regole del codice genetico consentono di tradurre il linguaggio del DNA nel linguaggio delle proteine! codice genetico traduzione

16 Li Lu2, T.Terrani ( ) Genetica molecolare 16 Il codice genetico prima posizione (5’) secondaposizione terza posizione (3’) UCAG U Phe Leu Ser Tyr STOP Cys STOP Trp UCAGUCAG C Leu Pro His Gln Arg UCAGUCAG A Ile Met Thr Asn Lys Ser Arg UCAGUCAG G Val Ala Asp Glu Gly UCAGUCAG

17 Li Lu2, T.Terrani ( ) Genetica molecolare 17 Elenco degli aminoacidi codice genetico AMINOACIDO simbolo a tre lettere simbolo a una lettera ALANINAAla AGCUGCGGCCGCA ARGININAArg RCGUCGGCGCCGAAGGAGA ACIDO ASPARTICOAsp DGAUGAC ASPARAGINAAsn NAAUAAC CISTEINACys CUGUUGC ACIDO GLUTAMICOGlu EGAGGAA GLUTAMINAGln QCAGCAA GLICINAGly GGGUGGGGGCGGA ISTIDINAHis HCAUCAC ISOLEUCINAIle IAUUAUCAUA LEUCINALeu LCUCCUAUUGUUA LISINALys KAAGAAA METIONINAMet MAUG FENILALANINAPhe FUUUUUC PROLINAPro PCCUCCGCCCCCA SERINASer SUCUUCGUCCUCAAGUAGC TREONINAThr TACUACGACCACA TRIPTOFANOTrp WUGG TIROSINATyr YUAUUAC VALINAVal VGUUGUGGUCGUA STOP UGAUAGUAA

18 Li Lu2, T.Terrani ( ) Genetica molecolare 18 Thr U G A La sintesi delle proteine T A C A C G T C G A G G C C T G T A A T G T G C A G C T C C G G A C A T His 5’ G U A DNA 5’ 3’ 5’ senso trascrizione senso lettura inizio T A C A C G T C G A G G C C T G T A filamento codificante codice Met 5’ U A C A U G U G C A G C U C C G G A C A U 3’ 5’ A U G U G C A G C U C C G G A C A U 3’ 5’ Gly C C U Leu G A G RNA-polimerasi

19 Li Lu2, T.Terrani ( ) Genetica molecolare 19 Thr U G A La sintesi delle proteine T A C A C G T C G A G G C C T G T A A T G T G C A G C T C C G G A C A T ribosoma Cys 5’ A C G Ser 5’ U C G His 5’ G U A Met 5’ U A C DNA 5’ 3’ 5’ inizio filamento codificante codice A U G U G C A G C U C C G G A C A U 3’ 5’ Gly C C U Leu G A G

20 Li Lu2, T.Terrani ( ) Genetica molecolare 20 Thr U G A La sintesi delle proteine T A C A C G T C G A G G C C T G T A A T G T G C A G C T C C G G A C A T Cys 5’ A C G Ser 5’ U C G His 5’ G U A Met 5’ U A C DNA 5’ 3’ 5’ inizio filamento codificante codice A U G U G C A G C U C C G G A C A U 3’ 5’ Gly C C U Leu G A G

21 Li Lu2, T.Terrani ( ) Genetica molecolare 21 Thr U G A La sintesi delle proteine T A C A C G T C G A G G C C T G T A A T G T G C A G C T C C G G A C A T Cys 5’ A C G Ser 5’ U C G His 5’ G U A Met DNA 5’ 3’ 5’ inizio filamento codificante codice A U G U G C A G C U C C G G A C A U 3’ 5’ Gly C C U Leu G A G Ser 5’ A G G

22 Li Lu2, T.Terrani ( ) Genetica molecolare 22 Thr U G A La sintesi delle proteine T A C A C G T C G A G G C C T G T A A T G T G C A G C T C C G G A C A T Cys Ser 5’ U C G His ’ G U A Met DNA 5’ 3’ 5’ inizio filamento codificante codice A U G U G C A G C U C C G G A C A U 3’ 5’ Leu G A G Ser 5’ A G G Gly 5’ C C U

23 Li Lu2, T.Terrani ( ) Genetica molecolare 23 Thr U G A La sintesi delle proteine T A C A C G T C G A G G C C T G T A A T G T G C A G C T C C G G A C A T Cys Ser 5’ U C G His ’ G U A Met DNA 5’ 3’ 5’ inizio filamento codificante codice A U G U G C A G C U C C G G A C A U 3’ 5’ Leu G A G Ser 5’ A G G Gly 5’ C C U His 5’ G U A NH 2

24 Li Lu2, T.Terrani ( ) Genetica molecolare 24 La sintesi delle proteine: vista d’assieme T A C A C G T C G A G G C C T G T A A T G T G C A G C T C C G G A C A T T A C A C G T C G A G G C C T G T A A U G U G C A G C U C C G G A C A U Cys 5’ A C G Ser 5’ U C G Ser 5’ A G G Gly 5’ C C U His 5’ G U A Met 5’ U A C DNA 3’ 5’ 3’ 5’ senso trascrizione senso lettura inizio RNA- polimerasi senso traduzione filamento codificante m-RNA t-RNA amminoacidi (AA) codice TRASCRIZIONE TRADUZIONE 1° AA 2° AA3° AA 4° AA 5° AA codogene codone anticodone della catena proteica 5’

25 Li Lu2, T.Terrani ( ) Genetica molecolare 25 RNA di trasporto (t-RNA) L’RNA di trasporto (t-RNA) è un filamento singolo composto da una settantina di nucleotidi solo in parte appaiati. Ne risulta una struttura tridimensionale paragonabile a quella delle proteine. In una zona particolare di questa molecola (sulla punta) è presente una tripletta di nucleotidi spaiati detta anticodone. L’aminoacido trasportato si lega all’ estremità 3’ della catena di nucleotidi. Esiste una sessantina di t-RNA differenti, caratterizzati ognuno da un anticodone specifico (  possono esistere 64 diverse triplette!) e da una forma tridimensionale differente da quella degli altri t-RNA

26 Li Lu2, T.Terrani ( ) Genetica molecolare 26 RNA di trasporto (t-RNA): l’interprete Il t-RNA parla ambedue i linguaggi, quello degli acidi nucleici (anticodone) e quello delle proteine (forma tridimensionale della struttura terziaria)

27 Li Lu2, T.Terrani ( ) Genetica molecolare 27 Come si riconoscono un aminoacido e il proprio t-RNA? Secondo il codice genetico ogni aminoacido è codificato da una o più triplette (codoni). Quando un t-RNA per mezzo dell’anticodone si appaia alla tripletta complementare (codone) dell’m-RNA a livello del ribosoma, porta legato a se l’aminoacido corrispondente. Ma come fanno un determinato t-RNA e il suo aminoacido corrispondente a riconoscersi (per poi legarsi, temporaneamente, assieme)? Thr U G A His ’ G U A Leu G A G Gly 5’ C C U

28 Li Lu2, T.Terrani ( ) Genetica molecolare 28 ENZIMA amminoacil t-RNA- sintetasi Amminoacil-t-RNA sintetasi C H COOH NH 2 CH 2 OH ENZIMA amminoacil t-RNA- sintetasi anticodone U A C A U G 3’ 5’ 3’5’ U A A Tirosina (Tyr) C H HOOC NH 2 CH 2 HO Secondo il codice genetico a questo codone corrisponde l’aminoacido Tirosina Il t-RNA della Tirosina è quello con l’anticodone AUG Perché la Tirosina si lega specificamente a questo t-RNA e non a qualsiasi altro? Grazie ad un enzima che riconosce la forma tridimemsionale del t-RNA e del gruppo R dell’AA 5’ 3’ m-RNA C H HOOC NH 2 CH 3 3

29 Li Lu2, T.Terrani ( ) Genetica molecolare 29 Amminoacil-t-RNA sintetasi ENZIMA amminoacil t-RNA- sintetasi anticodone U A C U A A A U G 3’ 5’ 3’5’ C H HOOC NH 2 CH 2 HO 5’ 3’ m-RNA

30 Li Lu2, T.Terrani ( ) Genetica molecolare 30 AMINOACIDI NH 2 O OH gruppo R (o catena laterale) variabile parte comune a tutti gli aminoacidi * * ad eccezione della prolina R H gruppo acido o carbossilico gruppo aminico C atomo di carbonio α

31 Li Lu2, T.Terrani ( ) Genetica molecolare 31 AMINOACIDI a pH 6-7 predominano le forme ionizzate! N +H+H 3 O O - R NH 2 O OH R

32 Li Lu2, T.Terrani ( ) Genetica molecolare 32 Come si legano gli aminoacidi Sequenza monotona delle parti invariabili degli aminoacidi Sequenza variabile delle catene laterali degli aminoacidi

33 Li Lu2, T.Terrani ( ) Genetica molecolare 33 ALANINA Ala NH 2 O CH 3 OH aminoacido con R non polare

34 Li Lu2, T.Terrani ( ) Genetica molecolare 34 VALINA Val NH 2 CH 3 O CH 3 OH aminoacido con R non polare aminoacido essenziale per l’uomo

35 Li Lu2, T.Terrani ( ) Genetica molecolare 35 LEUCINA Leu aminoacido con R non polare NH 2 O CH 2 C H 3 CH 3 OH aminoacido essenziale per l’uomo

36 Li Lu2, T.Terrani ( ) Genetica molecolare 36 ISOLEUCINA Ile aminoacido con R non polare NH 2 CH 2 O CH 3 CH 3 OH aminoacido essenziale per l’uomo

37 Li Lu2, T.Terrani ( ) Genetica molecolare 37 PROLINA Pro aminoacido con R non polare N H O OH CH 2 H2CH2C

38 Li Lu2, T.Terrani ( ) Genetica molecolare 38 FENILALANINA Phe aminoacido con R non polare NH 2 CH 2 O OH aminoacido essenziale per l’uomo

39 Li Lu2, T.Terrani ( ) Genetica molecolare 39 TRIPTOFANO Trp aminoacido con R non polare NH 2 CH 2 O NH OH aminoacido essenziale per l’uomo

40 Li Lu2, T.Terrani ( ) Genetica molecolare 40 METIONINA Met aminoacido con R non polare NH 2 O CH 2 CH 2 S CH 3 OH aminoacido essenziale per l’uomo

41 Li Lu2, T.Terrani ( ) Genetica molecolare 41 GLICINA Gly aminoacido con R polare privo di carica NH 2 O OH H

42 Li Lu2, T.Terrani ( ) Genetica molecolare 42 SERINA Ser aminoacido con R polare privo di carica NH 2 CH 2 OH O OH

43 Li Lu2, T.Terrani ( ) Genetica molecolare 43 TREONINA Thr NH 2 CH 3 OH O OH aminoacido con R polare privo di carica aminoacido essenziale per l’uomo

44 Li Lu2, T.Terrani ( ) Genetica molecolare 44 CISTEINA Cys NH 2 O CH 2 S H OH aminoacido con R polare privo di carica

45 Li Lu2, T.Terrani ( ) Genetica molecolare 45 TIROSINA Tyr NH 2 CH 2 O OH OH

46 Li Lu2, T.Terrani ( ) Genetica molecolare 46 ASPARAGINA Asn NH 2 O CH 2 O NH 2 OH aminoacido con R polare privo di carica

47 Li Lu2, T.Terrani ( ) Genetica molecolare 47 GLUTAMINA Gln NH 2 O CH 2 CH 2 O NH 2 OH aminoacido con R polare privo di carica

48 Li Lu2, T.Terrani ( ) Genetica molecolare 48 ACIDO ASPARTICO Asp NH 2 O CH 2 O OH OH aminoacido acido, carico negativamente a pH 6

49 Li Lu2, T.Terrani ( ) Genetica molecolare 49 ACIDO GLUTAMICO Glu NH 2 O CH 2 CH 2 O O H OH aminoacido acido, carico negativamente a pH 6

50 Li Lu2, T.Terrani ( ) Genetica molecolare 50 LISINA Lys aminoacido basico, carico positivamente a pH 6 NH 2 O CH 2 CH 2 CH 2 CH 2 NH 2 OH aminoacido essenziale per l’uomo

51 Li Lu2, T.Terrani ( ) Genetica molecolare 51 ARGININA Arg NH 2 O CH 2 CH 2 CH 2 NH NH NH 2 OH aminoacido basico, carico positivamente a pH 6

52 Li Lu2, T.Terrani ( ) Genetica molecolare 52 ISTIDINA His aminoacido basico, carico positivamente a pH 6 NH 2 O CH 2 N NH OH aminoacido essenziale per l’uomo

53 Li Lu2, T.Terrani ( ) Genetica molecolare 53 Nucleotidi (monomeri degli acidi nucleici) Un nucleotide è formato a sua volta da uno zucchero (monosaccaride) una base azotata un gruppo acido fosforico (fosfato)

54 Li Lu2, T.Terrani ( ) Genetica molecolare 54 Nucleotidi del DNA Nei nucleotidi del DNA (acido desossiribonucleico) la base azotata può essere: lo zucchero è il desossiribosio ADENINA GUANINA TIMINA CITOSINA oppure POO - O - O - gruppo acido fosforico (fosfato) purine pirimidine

55 Li Lu2, T.Terrani ( ) Genetica molecolare 55 Nucleotidi dell’RNA Nei nucleotidi dell’RNA (acido ribonucleico) la base azotata può essere: lo zucchero è il ribosio ADENINA GUANINA URACILE CITOSINA oppure POO - O - O - gruppo acido fosforico (fosfato)

56 Li Lu2, T.Terrani ( ) Genetica molecolare 56 Confronto tra nucleotidi del DNA e nucleotidi dell’RNA Nei nucleotidi del DNA (acido desossiribonucleico) nel DNA lo zucchero è il desossiribosio ADENINA GUANINA TIMINA CITOSINA oppure Nei nucleotidi dell’RNA (acido ribonucleico) URACILE nell’ RNA lo zucchero è il ribosio

57 Li Lu2, T.Terrani ( ) Genetica molecolare 57 Formule chimiche Timina e Uracile Nucleotide del DNA con TIMINA Nucleotide dell’RNA con URACILE

58 Li Lu2, T.Terrani ( ) Genetica molecolare 58 I nucleotidi si legano tra loro formando lunghe catene ADENINA GUANINA CITOSINA TIMINA A G G C C T sequenza di nucleotidi sequenza di basi azotate Polinucleotidi (polimeri di DNA) sequenza ripetitiva sequenza variabile

59 Li Lu2, T.Terrani ( ) Genetica molecolare 59 Le basi azotate si appaiano in modo specifico A CON T G CON C e naturalmente T CON A C CON G

60 Li Lu2, T.Terrani ( ) Genetica molecolare 60 Doppio filamento di DNA

61 Li Lu2, T.Terrani ( ) Genetica molecolare 61 Numerazione degli atomi di C atomo di C 1’ atomo di C 2’ atomo di C 3’ atomo di C 4’ atomo di C 5’

62 Li Lu2, T.Terrani ( ) Genetica molecolare 62 Filamenti antiparalleli e complementari 5’ 3’ 5’ atomo di C 5’ atomo di C 3’ atomo di C 5’ atomo di C 3’

63 Li Lu2, T.Terrani ( ) Genetica molecolare 63 La doppia elica

64 Li Lu2, T.Terrani ( ) Genetica molecolare 64

65 Li Lu2, T.Terrani ( ) Genetica molecolare 65 Duplicazione del DNA

66 Li Lu2, T.Terrani ( ) Genetica molecolare 66 Duplicazione del DNA

67 Li Lu2, T.Terrani ( ) Genetica molecolare 67 Duplicazione del DNA (semiconservativa) 5’ 3’ 5’ 3’5’

68 Li Lu2, T.Terrani ( ) Genetica molecolare 68 Duplicazione del DNA vecchio filamento nuovo filamento

69 Li Lu2, T.Terrani ( ) Genetica molecolare 69 Duplicazione del DNA: la DNA-POLIMERASI 5’ 3’ 5’ 3’ DNA POLIMERASI I nuovi nucleotidi vengono aggiunti all’estremità 3’ del filamento in formazione!

70 Li Lu2, T.Terrani ( ) Genetica molecolare 70 Genoma umano pAGGCTTCTGCCGGTAATGATCTGGTAAATGTTTGCACACAGTGTTTGGCCAAATCAGCGGGTGAAGACAGATTGG CGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGCGGTGCCTGAGTCAGCATGCATTGGAGTGAAGT AAACCCTTGAGCGTTCTAGCAAGGAGGCTTCTGCCGGTAATGATCTGGTAAATGTTTGCACACAGTGTTTGGCCAA ATCAGCGGGTGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGCGGTGCCTGA GTCAGCATAAGGCATTGGAAGTAGTAAACCCTTGAGCGTTCTAGCAAGGGATTGCAGGCCTGCATGCAACCTGGAT CTTATGGCCTCTGACTAGCGATTAGTCATGCCATGAGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCC GGGCCAGCTGGTTTGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGGGCGG TGCTGCTGAGTCAGCATGCATTGGAAGTAGTAAACCCTTGAGCGTTCTAGCAAGGGATTGCAGGCCTGCATGCAAC CTTGCGGATCTTTGGCCCTGACTAGCGATTAGTCATGCTAGGCTTCTGCCGGTAATGATCTGGTAAATGTTTGCAC ACAGTGTTTGGCCAAATCAGCGGGTGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTG GTTTGCGGTGCCTGAGTCAGCATAAGGCATTGGAAGTAGTAAACCCTTGAGCGTTCTAGCAAGGGATTGCAGGCC TGCATGCAACCTGGATCTTATGGCCTCTGACTAGCGATTAGTCATGCCATGAGAAGACAGATTGGCGTGACATAGC CGTAATGACAGAGTCCGGGCCAGCTGGTTGAATCGTGCAAGGTTTCGCCAAATGGCTTGATAGCGCTCTTCGAGA GGTCCGAGTATGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGGGGGTGAA GACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGCGGTGCCTGAGTCAGCATAAGGC ATTGGAAGTAGTAAACCCTTGAGCGTTCTAGCAAGGGATTGCAGGCCTGCATGCAACCTGGATCTTATGGCCTCTG ACTAGCGATTAGTCATGCCATGAGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGT TTGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGGGCGGTGCTGCTGAGTCA GCATGCATTGGAAGTAGTAAACCCTTGAGCGTTCTAGCAAGGGATTGCAGGCCTGCATGCAACCTTGCGGATCTTT GGCCCTGACTAGCGATTAGTCATGCTAGGCTTCTGCCGGTAATGATCTGGTAAATGTTTGCACACAGTGTTTGGCC AAATCAGCGGGTGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGCGGTGCCT GAGTCAGCATAAGGCATTGGAAGTAGTAAACCCTTGAGCGTTCTAGCAAGGGATTGCAGGCCTGCATGCAACCTG GATCTTATGGCCTCTGACTAGCGATTAGTCATGCCATGAGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAG TCCGGGCCAGCTGGTTGAATCGTGCAAGGTTTCGCCAAATGGCTTGATAGCGCTCTTCGAGAGGTCCGAGTATGA AGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGGGGGTGAAGACAGATTGGCGT GACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGCGGTGCCTGAGTCAGCATAAGGCATTGGAAGTAGTA AACCCTTGAGCGTTCTAGCAAGGGATTGCAGGCCTGCATGCAACCTGGATCTTATGGCCTCTGACTAGCGATTAGT CATGCCATGAGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGAAGACAGATT GGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGGGCGGTGCTGCTGAGTCAGCATGCATTGGA AGTAGTAAACCCTTGAGCGTTCTAGCAAGGGATTGCAGGCCTGCATGCAACCTTGCGGATCTTTGGCCCTGACTAG CGATTAGTCATGCTAGGCTTCTGCCGGTAATGATCTGGTAAATGTTTGCACACAGTGTTTGGCCAAATCAGCGGGT GAAGACAGATTATGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGCGGTGCCTGAGTCAGCAT AAGGCATTGGAAGTAGTAAACCCTTGAGCGTTCTAGCAAGGGATTGCAGGCCTGCATGCAACCTGGATCTTATGGC CTCTGACTAGCGATTAGTCGATGCCATGAGAAGACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCA GCTGGTTGAATCGTGCAAGGTTTCGCCAAATGGCTTGATAGCGCTCTTCGAGAGGTCCGAGTATGAAGACAGATTG GCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGGTGAAGACAGATTGGCGTGACATAGCCGTAAT GACAGAGTCCGGGCCAGCTGGTTTGCGGTGCCTGAGTCAGCATAAGGCATTGGAAGTAGTAAACCCTTGAGCGTT CTAGCAAGGGATTGCAGGCCTGCATGCAACCTGGATCTTATGGCCTCTGACTAGCGATTAGTCATGCCATGAGAAG ACAGATTGGCGTGACATAGCCGTAATGACAGAGTCCGGGCCAGCTGGTTTGAAGACAGATTGGCGTGACATAGCC GTAATGACAGAGTCCGGGCCAGCTGGTTTGGG ca basi (nucleotidi) X 1 milione  1 milione di pagine come questa per scrivere il contenuto di tutto il genoma umano (ca. 3 miliardi di coppie di nucleotidi)

71 Li Lu2, T.Terrani ( ) Genetica molecolare 71 Il codice genetico prima posizione (5’) secondaposizione terza posizione (3’) UCAG U Phe Leu Ser Tyr STOP Cys STOP Trp UCAGUCAG C Leu Pro His Gln Arg UCAGUCAG A Ile Met Thr Asn Lys Ser Arg UCAGUCAG G Val Ala Asp Glu Gly UCAGUCAG


Scaricare ppt "La sintesi delle proteine ( materiali delle lezioni; 1ed 2008, agg. 2014) Tiziano Terrani, Liceo cantonale di Lugano 2 6952 SAVOSA."

Presentazioni simili


Annunci Google