La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Controllo trascrizionale. Organismi unicellulari Duplicazione cellulare Risposta agli stimoli dell’ambiente esterno.

Presentazioni simili


Presentazione sul tema: "Controllo trascrizionale. Organismi unicellulari Duplicazione cellulare Risposta agli stimoli dell’ambiente esterno."— Transcript della presentazione:

1 Controllo trascrizionale

2 Organismi unicellulari Duplicazione cellulare Risposta agli stimoli dell’ambiente esterno

3 Organismi pluricellulari Duplicazione cellulare Sviluppo e differenziamento di tipi cellulari specializzati Risposta agli stimoli dell’ambiente esterno Coordinamento tra le funzioni dei diversi tipi cellulari

4 Virus Duplicazione del proprio genoma sfruttando a proprio vantaggio i meccanismi molecolari delle cellule e degli organismi ospiti

5 Le cellule rispondono in modo complesso a stimoli complessi Pluricellulari Induzione dei geni responsabili dell’utilizzazione del lattosio Assenza di glucosio Presenza di lattosio Unicellulari

6 La maggior parte delle risposte cellulari richiede l’attivazione e/o la repressione coordinata di molti geni

7 In tutti gli organismi viventi le informazioni contenute nel genoma non si esprimono contemporaneamente, e sono finemente regolate. Geni ad espressione costitutiva (housekeeping) Geni ad espressione condizionale (inducibili, reprimibili) Geni specializzati (tessuto specifici, che a loro volta possono essere costitutivi o condizionali)

8 Differenziamento cellulare

9

10 La produzione di tipi celulari specializzati in genere non dipende da riarrangiamenti del DNA

11 Trascrittoma Insieme degli RNA messaggeri prodotti da una determinata popolazione cellulare. Per ogni tipo cellulare diverso sono espressi all’incirca geni diversi. Proteoma Insieme delle proteine prodotte da una determinata popolazione cellulare. Genoma Insieme delle informazioni genetiche che caratterizzano un organismo.

12 Livelli di controllo dell’espressione genica

13 Il controllo della trascrizione è basato sul riconoscimento di corte sequenze di DNA da parte di diverse classi di proteine

14

15 Come funziona la trascrizione ? TTACGTAACGTCAGAACGTATAAACCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCATATTTGGCCTTGCATCCCCAGCGCGCAA 5’3’ 5’ I promotori e le RNA polimerasi sono asimmetrici Promotore

16 Come funziona la trascrizione ? TTACGTAACGTCAGAACGTATAAACCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCATATTTGGCCTTGCATCCCCAGCGCGCAA 5’3’ 5’ I promotori e le RNA polimerasi sono asimmetrici Promotore

17 TTACGTAACGTCAGAACGTATAAACCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCATATTTGGCCTTGCATCCCCAGCGCGCAA 5’3’ 5’ I promotori e le RNA polimerasi sono asimmetrici CCGGAACGUAGGG 5’ 3’ mRNA Promotore Come funziona la trascrizione ?

18 Cosa succede se inverto il promotore ? TTACGTAACGTCAGAACGTTTATACCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAAATATGGCCTTGCATCCCCAGCGCGCAA 5’3’ 5’ Promotore

19 Cosa succede se inverto il promotore ? TTACGTAACGTCAGAACGTTTATACCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAAATATGGCCTTGCATCCCCAGCGCGCAA 5’3’ 5’ Promotore

20 Cosa succede se inverto il promotore ? TTACGTAACGTCAGAACGTTTATACCGGAACGTAGGGGTCGCGCGTT AATGCATTGCAGTCTTGCAAATATGGCCTTGCATCCCCAGCGCGCAA 5’3’ 5’ AGUCUUGC 5’3’ mRNA Promotore

21 Come funziona la trascrizione ?

22 Strategie di controllo dell’espressione genica nei batteri Genoma estremamente compatto Le RNA polimerasi possono riconoscere il promotore in assenza di altre proteine Organizzazione dei geni in operoni Regioni di controllo molto piccole (in genere <200 bp)

23 Controllo negativo: l’operon del triptofano

24

25 Integrazione di due informazioni: l’operon del lattosio

26 Circuiti genetici complessi nei procarioti: il fago lambda

27 Il ciclo vitale del fago lambda

28 Lisogenia

29 Un interruttore complesso La proteina cI agisce sia da repressore (sui geni responsabili della crescita litica) sia da attivatore (della propria trascrizione)

30 Il controllo della espressione genica negli eucarioti è molto più sofisticato che nei procarioti Compartimentalizzazione di trascrizione e traduzione Genomi poco compatti, con grande quantità di DNA non codificante Sequenze geniche suddivise in esoni ed introni Regioni di controllo dei geni molto grandi (anche > bp) RNA polimerasi incapaci di iniziare la trascrizione senza altri fattori RNA messaggeri codificanti per singole proteine, no operoni

31 Il DNA eucariotico è organizzato sotto forma di cromatina

32 Regolazione a distanza

33 Struttura di un tipico promotore eucariotico

34 Il controllo della trascrizione avviene a numerosi livelli: Pre-attivazione (Induzione di uno stato trascrizionalmente competente) Inizio/re-inizio della trascrizione Elongazione del trascritto Terminazione del trascritto  Fattori di trascrizione legati a specifici promotori/enhancers  Co-attivatori (acetilasi degli istoni, attivita’ che rimodellano la cromatina)  Fattori “generali” di trascrizione (GTFs) e RNA polimerasi

35 TATA Basal tr. machinery TBP TFIIs Pol.II PROMOTORE PROSSIMALECORE ~ -200 ~ -50 ENHANCER (~ 100 bp)  La funzione principale dei fattori di trascrizione e’ di facilitare l’assemblaggio del macchinario basale di trascrizione sul promotore essenziale (core).  Questo avviene - tramite reclutamento di GTF - tramite reclutamento di HAT oppure di attivita’ che rimodellano la cromatina - tramite attivita’ acetilasiche intrinsiche Diversamente dai procarioti, la trascrizione dei geni eucarioti e’ controllata da numerosi elementi

36 Il promotore essenziale (core promoter) Determina il sito di inizio della trascrizione e dirige il legame dell’ RNA Pol II I promotori essenziali più frequenti per l’RNA Pol II sono: –TATA box: la sua sequenza e’ altamente conservata (TATAAA); si trova prevalentemente in geni che vengono trascritti rapidamente, ed e’ localizzata ~25-30 bp a monte del sito di inizio della trascrizione.  la TATA box dirige l’inizio della trascrizione a siti ben definiti –Isole CpG: proprio di molti geni “house-keeping”. La trascrizione comincia a siti multipli disseminati in una regione di circa bp.

37 L’inizio della trascrizione da parte dell’RNA Pol II richiede multipli fattori Fattori di trascrizione generali (GTF) insieme con l’RNA Pol II formano l’apparato trascrizionale basale, che lega il promotore essenziale ed è sufficiente alla trascrizione in vitro –TBP (che con i fattori associati a TBP (TAF) forma -> TFIID) –TFIIA, TFIIB, TFIIF, TFIIE, TFIIH Fattori di trascrizione specifici, anche richiesti per la trascrizione attivata: servono per reclutare e assemblare l’apparato trascrizionale –Si legano a elementi di riconoscimento sul promotore e sull’enhancer –Multipli fattori di trascrizione sono normalmente coinvolti nell’attivazione di un gene

38 Inizio della trascrizione negli eucarioti: modello sequenziale TBP + TAFs=TFIID

39 Inizio della trascrizione negli eucarioti: reclutamento dell’oloenzima TBP + TAFs=TFIID

40 Meccanismi di attivazione TBP + TAFs=TFIID

41 Meccanismi di attivazione: rimodellamento locale della cromatina TBP + TAFs=TFIID

42 Importanza delle modificazioni post-traduzionali degli istoni: acetilazione-deacetilazione TBP + TAFs=TFIID

43 Coattivatori, corepressori Richiesti per la funzione dei fattori di trascrizione specifici NON richiesti per la trascrizione basale (ma la stimolano ~10x) NON legano specificamente il DNA

44 Sinergia e cooperazione tra molecole di fattori trascrizionali: concetto di enhanceosoma TBP + TAFs=TFIID Sinergia Cooperazione Enhanceosoma

45 Sequenza di eventi nell’attivazione trascrizionale di un gene

46 Repressori trascrizionali eucariotici

47

48 Strategie di controllo trascrizionale: orologi molecolari

49 Recettori nucleari per gli ormoni

50 Strategie di controllo trascrizionale: espressione coordinata indotta da cortisolo Stesso recettore, effetti diversi dipendenti dalla combinazione di fattori presenti Alcuni geni vengono attivati, ma altri sono repressi. Nel fegato aumenta l’espressione dei geni implicati nella gluconeogenesi Nel muscolo diminuisce la captazione degli aminoacidi e stimola la proteolisi

51 Alcuni geni regolano complessi programmi di differenziamento cellulare I fattori trascrizionali della famiglia di MyoD possono converire in cellule muscolari i mioblasti, ma non altri tipi cellulari

52 Alcuni geni regolano complessi programmi di sviluppo

53 Controllo combinatorio durante lo sviluppo

54 Modularità degli elementi di controllo trascrizionale

55

56

57 Come si può limitare l’azione degli elementi di controllo: isolatori cromatinici

58 Il controllo delle beta globine umane

59 Controllo epigenetico e memoria cellulare

60 Modificazioni epigenetiche del DNA: metilazione Distinzione tra metilazione ‘de novo’ e metilazione di mantenimento

61 Il dinucleotide CpG è poco rappresentato nel DNA dei vertebrati perché soggetto a mutazione secondaria a metilazione Distinzione tra metilazione ‘de novo’ e metilazione di mantenimento

62 Isole CpG nei geni

63 La metilazione durante lo sviluppo

64 La metilazione di solito si associa con repressione dell’espressione genica: meccanismo

65 Fenomeno dell’esclusione allelica: anche se di ogni gene sono presenti due copie, in alcuni casi solo una di queste si esprime Può essere dipendente dall’origine parentale dell’allele, e in questo caso si parla di imprinting Può essere indipendente dall’origine parentale (ad es. inattivazione del cromosoma X) In entrambi i casi può essere tessuto-specifico

66 Esempi di imprinting: H19 e IGF2 H19:allele paterno represso e fortemente metilato. IGF2: allele materno represso.

67 Esempi di imprinting: Delezioni della regione 15q11-q13 in eterozigosi Sindrome di Prader-Willi Ritardo mentale Ipotonia Obesità Ipogonadismo

68 Esempi di imprinting: Delezioni della regione 15q11-q13 in eterozigosi Sindrome di Angelman Ritardo mentale Difficoltà di eloquio Ritardo di crescita Iperattività Ilarità inappropriata


Scaricare ppt "Controllo trascrizionale. Organismi unicellulari Duplicazione cellulare Risposta agli stimoli dell’ambiente esterno."

Presentazioni simili


Annunci Google