La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Genetica Forense Docente: Fulvio Cruciani Ricevimento: mercoledì 13:30-15:30 Edificio genetica, stanza 3-09 (2° piano) Telefono.

Presentazioni simili


Presentazione sul tema: "Genetica Forense Docente: Fulvio Cruciani Ricevimento: mercoledì 13:30-15:30 Edificio genetica, stanza 3-09 (2° piano) Telefono."— Transcript della presentazione:

1 Genetica Forense Docente: Fulvio Cruciani Ricevimento: mercoledì 13:30-15:30 Edificio genetica, stanza 3-09 (2° piano) Telefono (per comunicazioni urgenti): Parte del corso di «Metodologie genetico-molecolari nell’uomo»

2 Modulo Genetica Forense Programma AA Breve storia della genetica forense: dal sistema AB0 ai mini-STR. Breve storia della genetica forense: dal sistema AB0 ai mini-STR. Repertamento, conservazione e determinazione del tipo cellulare e/o tissutale dei reperti biologici. Repertamento, conservazione e determinazione del tipo cellulare e/o tissutale dei reperti biologici. Estrazione differenziale, quantificazione e determinazione del sesso genetico del DNA dei reperti. Estrazione differenziale, quantificazione e determinazione del sesso genetico del DNA dei reperti. Metodi e strumenti per la tipizzazione di marcatori polimorfici in ambito forense. Metodi e strumenti per la tipizzazione di marcatori polimorfici in ambito forense. Problematiche relative alla natura del campione biologico: DNA fortemente degradato e/o in tracce minime; determinazione dei genotipi in campioni misti. Problematiche relative alla natura del campione biologico: DNA fortemente degradato e/o in tracce minime; determinazione dei genotipi in campioni misti. Problematiche concernenti l’interpretazione del profilo di DNA: stuttering, microvarianti e alleli “off-ladder” nei microsatelliti, alleli nulli, drop-out e drop-in allelico. Problematiche concernenti l’interpretazione del profilo di DNA: stuttering, microvarianti e alleli “off-ladder” nei microsatelliti, alleli nulli, drop-out e drop-in allelico. Utilizzazione dei sistemi ad ereditarietà uniparentale in ambito forense. Utilizzazione dei sistemi ad ereditarietà uniparentale in ambito forense. Identificazione nelle indagini criminali; identificazione delle vittime dei disastri di massa. Identificazione nelle indagini criminali; identificazione delle vittime dei disastri di massa. Test di parentela e paternità. Test di parentela e paternità. Elementi di calcolo delle probabilità. Potere di esclusione, probabilità di identità, probabilità di match casuale, indice di paternità. Elementi di calcolo delle probabilità. Potere di esclusione, probabilità di identità, probabilità di match casuale, indice di paternità. Inferenza sull’origine geografica e aspetto fenotipico attraverso l’analisi del DNA. Inferenza sull’origine geografica e aspetto fenotipico attraverso l’analisi del DNA. La ricerca scientifica in ambito genetico-forense. La ricerca scientifica in ambito genetico-forense.

3 Per eventuali approfondimenti: Genetica Forense Docente: Fulvio Cruciani Testo consigliato:

4 La genetica nelle scienze forensi La genetica forense è una delle molteplici discipline delle scienze forensi. L’importanza della genetica nelle scienze forensi si è notevolmente accresciuta negli ultimi anni, grazie ai progressi nella conoscenza dei marcatori genetici polimorfici ed all’evoluzione degli strumenti utilizzati per analizzarli. I mass media hanno notevolmente contribuito all’interesse verso le indagini genetico forense….

5 La genetica come «strumento» in ambito forense e investigativo A cosa serve? Identificare individui che abbiano commesso dei crimini Identificare individui che abbiano commesso dei crimini Risolvere casi di paternità incerta Risolvere casi di paternità incerta Predire la popolazione di origine di un DNA (es. Africano, Asiatico ecc.) Predire la popolazione di origine di un DNA (es. Africano, Asiatico ecc.) Ottenere informazioni fenotipiche su un soggetto (es. colore occhi) Ottenere informazioni fenotipiche su un soggetto (es. colore occhi) Identificare e «ricostruire» cadaveri la cui identità sia ignota (vittime di catastrofi naturali, disastri aerei, guerre, genocidi) Identificare e «ricostruire» cadaveri la cui identità sia ignota (vittime di catastrofi naturali, disastri aerei, guerre, genocidi) Investigazioni su persone scomparse Investigazioni su persone scomparse Identificare tracce di sostanze illegali Identificare tracce di sostanze illegali Identificare DNA appartenente a specie a rischio di estinzione in crimini legati al loro contrabbando Identificare DNA appartenente a specie a rischio di estinzione in crimini legati al loro contrabbando …………………. ………………….

6 Il fenomeno biologico sul quale si basa la genetica forense: DIVERSITA’ GENETICA

7 La genetica forense si basa sulla presenza di diversità genetica DIVERSITA’ GENETICA: A QUALE LIVELLO? 1.Diversità genetica tra individui 2.Diversità genetica tra popolazioni 3.Diversità genetica tra specie Applicazione in Ambito forense Nella maggior parte delle applicazioni la genetica forense sfrutta la diversità genetica tra individui (variabilità intra-popolazione). In un minor numero di casi sfrutta la variabilità genetica tra specie. In alcuni casi sfrutta «direttamente» la variabilità genetica tra popolazioni, della quale va tenuto comunque sempre conto (effetti della suddivisione della popolazione, ecc.)

8 La genetica forense si basa sulla presenza di diversità genetica DIVERSITA’ GENETICA: A QUALE LIVELLO? 1.Diversità genetica tra individui 2.Diversità genetica tra popolazioni 3.Diversità genetica tra specie Le basi teoriche della genetica forense vanno ricercate nella genetica mendeliana e nella genetica delle popolazioni Applicazione in ambito forense

9 La genetica forense si basa sulla presenza di diversità genetica DIVERSITA’ GENETICA: IN QUALE PORZIONE DEL GENOMA? Autosomi DNA mitocondriale Cromosoma Y Cromosoma X I marcatori più utilizzati in ambito forense sono localizzati sugli autosomi Rilevanza in Ambito forense

10 La genetica forense si basa sulla presenza di diversità genetica DIVERSITA’ GENETICA: CHE TIPO DI VARIAZIONE? Microsatelliti (short tandem repeats, STRs) Sostituzioni nucleotidiche (~ SNPs) Minisatelliti (~ VNTR) Inserzione/delezione di basi (indels) Presenza/assenza di elementi trasponibili Copy number variants (CNVs) Polimorfismi «citogenetici» I marcatori più utilizzati in ambito forense sono i microsatelliti Rilevanza in ambito forense

11 Confronto dei profili QK Corte Ricerca in database Esclusione (no match) Compatibilità (match) May match another (K’) Raccolta Estrazione Quantificaz. Marcatori polimorfici Interpretaz.ne dei dati Conservazione Amplificaz. Interpretaz.ne statistica Caratterizzazione Separazione/ detection Campione “Q” (Question) Biology Technology Genetics Serology Profilo depositato in database Steps coinvolti Report (con peso statistico) Q = K Q ≠ K Crimine Trasferimento del materiale biologico Raccolta Estrazione Quantificaz. Marcatori polimorfici Interpretaz.ne dei dati Conservazione Amplificaz. Separazione/ Detection Reference (Known) campione “K” Steps coinvolti Sospettato individuato QUALITYASSURANCEQUALITYASSURANCE QUALITYASSURANCEQUALITYASSURANCE Profilo depositato in database

12 Esempio di Lab Report relativo ad un indagine sul DNA estratto da 2 reperti (Q1 e Q2) e da due indagati (K1 e K2) Tratto da Butler JM «Fundamentals of forensic DNA typing» 2010.

13 Breve storia della genetica forense Il primo sistema polimorfico utilizzato in ambito forense: Sistema di gruppo sanguigno ABO (scoperto nel 1900 da Landsteiner) Utilizzato per la prima volta in un processo nel 1915 in Italia (Lattes) e successivamente utilizzato in casi di identificazione e paternità incerta anche in altri paesi europei ed in US Caratteristiche : 4 fenotipi (gruppi sang. A, B, AB, 0) Rapidità di esecuzione Possibilità di esclusione Limitato potere di discriminazione Successivamente affiancato da altri sistemi di gruppo sanguigno: MN (1927), Rh (1937) fino a circa 30 sistemi di gruppo sanguigno oggi noti

14 Breve storia della genetica forense Differenze nel materiale genetico possono «tradursi» in differenze nelle sequenze aminoacidiche delle proteine. Tali differenze vennero utilizzate negli anni per studi di genetica di popolazioni ed in ambito forense. Differenti forme dello stesso enzima (isoenzimi) venivano evidenziate mediante elettroforesi su agar, agarosio o acrilammide, sfruttando la differente carica degli isoenzimi per la separazione e la specificità enzimatica per la colorazione. Caratteristiche rilevanti in ambito genetico-forense: - Numero di alleli ridotto (in genere 2-4) - Tempi di esecuzione relativamente lunghi - Potere di discriminazione maggiore (quando combinati) rispetto ai sistemi di gruppo sanguigno - Livelli di proteine bassi nei reperti, e instabili L’era dei polimorfismi proteici

15 Breve storia della genetica forense 1985: MINISATELLITI, inizia l’era del DNA typing Il primo caso criminale risolto mediante DNA typing: il signor Colin Pitchfork 1983: Lynda Mann, 15 anni, viene violentata e uccisa nel Leichestershire (UK) 1986: Dawn Ashworth, 15 anni, viene violentata e uccisa nella stessa zona Il modus operandi nei due delitti era lo stesso ed il gruppo sanguigno (gruppo A), determinato dalle tracce di liquido seminale, era il medesimo. 1986: Richard Buckland, un ragazzo del posto, venne incriminato dei due delitti, ma l’analisi del DNA mediante fingerprinting rivelò che egli era innocente. Circa 5000 individui nel Leichestershire possedevano il gruppo sanguigno A. Si organizzò uno screening di massa ed in nessun caso il DNA fingerprinting dei 5000 individui corrispondeva a quello dell’assassino. 1987: Per un puro caso, si venne a sapere che una persona del posto, un certo Colin Pitchfork, aveva chiesto ad un amico ed ottenuto di partecipare allo screening in sua vece. Il signor Pitchfork venne invitato a donare il sangue ed il profilo del suo DNA risultò identico a quello del DNA raccolto sulla scena dei due delitti.

16 Minisatelliti I minisatelliti sono una classe di DNA ripetuto in tandem, con un motivo ripetuto di basi ed un numero di ripetizioni spesso molto elevato (fino a 1000). Breve storia della genetica forense Sono localizzati in tutto il genoma umano, preferenzialmente nelle regioni subtelomeriche. Il polimorfismo consiste nel diverso numero di ripetizioni in tandem (alleli) presenti nello stesso minisatellite. Il numero degli alleli è spesso nell’ordine delle decine (sempio di sistema multiallelico).

17 Minisatelliti: la tecnica del «DNA fingerprinting» Breve storia della genetica forense Il metodo per evidenziare la variabilità dei minisatelliti si basa sulla tecnica «southern blotting». Si utilizza una sonda che riconosce un motivo “core” comune a più minisatelliti, e che permette quindi di evidenziare più minisatelliti contemporaneamente. Il DNA fingerprinting Introdotto da Alec Jeffreys nel Il DNA viene estratto, digerito con enzimi di restrizione, sottoposto ad elettroforesi, denaturato e trasferito su membrana (southern blotting). Quindi viene utilizzata una sonda multi-locus “core” minisatellite marcata con radioattivo per l’ibridazione. Il segnale radioattivo viene rivelato mediante esposizione di una lastra sensibile ai raggi X Alec Jeffreys

18 Vantaggi e limitazioni: Potere di discriminazione molto elevato Sensibilità limitata (> ng) Tecnica time-consuming Non automatizzabile Elevato peso molecolare: non adatto per campioni degradati Differenti alleli difficili da distinguere Problemi per l’interpretazione statistica Minisatelliti: esempio di «DNA fingerprinting» Breve storia della genetica forense Note sulla nomenclatura: ambiguità relativa ai termini RFLP, VNTR, DNA fingerprinting Introduzione di sonde che riconoscono un solo locus

19 Minisatelliti: esempio di «DNA fingerprinting» Breve storia della genetica forense DNA fingerprinting di una famiglia. E’ stata utilizzata una sonda multicolus di tipo (GTG) 5

20 La tecnica della reazione a catena della polimerasi ha rivoluzionato il modo di fare ricerca in diversi settori della genetica e della biologia molecolare. In ambito forense, l’introduzione della PCR ha rappresentato un punto di svolta fondamentale, permettendo di risolvere un problema molto ricorrente nelle indagini criminali: La scarsa quantità di DNA che può essere estratta dalla maggior parte dei reperti. 1985: viene descritta la tecnica PCR 1990: la tecnica PCR viene accolta in ambito forense Breve storia della genetica forense

21 1990: la prima tecnica basata su PCR accolta in ambito forense Il sistema polimorfico Human Leucocite Antigen (HLA) DQA1 Breve storia della genetica forense La tecnica (reverse dot blot) 1)Amplificazione mediante PCR di una porzione del gene DQA1. I primers sono marcati con biotina. 2)Ibridazione del prodotto PCR con oligo «allele specifici» fissati su una strip di membrana di nylon. 3)Lavaggio ad elevata stringenza: rimangono sulla membrana solo i prodotti PCR con sequenze perfettamente complementari ai relativi oligo. 4)Rivelazione mediante sistema streptavidina/biotina

22 1990: la prima tecnica basata su PCR accolta in ambito forense Il sistema polimorfico Human Leucocite Antigen (HLA) DQA1 Breve storia della genetica forense Nel sistema «DQ  amplyTaq» erano presenti inizialmente 9 sonde in grado di distinguere 6 alleli, per un totale di 21 differenti genotipi (pannelo “a” in figura) Un kit prodotto successivamente (Amplitype PM + DQA1) permetteva di discriminare un ulteriore allele in DQA (4.1 vs 4.2,4.3) e al tempo stesso permetteva di conoscere il genotipo di altri 5 sistemi polimorfici, due triallelici e tre biallelici (pannello “b” in figura, dove è mostrato il genotipo per una linea cellulare utilizzata come standard). Vantaggi e svantaggi: - Metodo semplice e rapido - Elevata sensibilità (PCR) - Potere di discriminazione relativamente basso (circa 1/10000)

23 1994: Il minisatellite D1S80 (un minisatellite amplificabile mediante PCR) Breve storia della genetica forense L’introduzione del kit Amplitype D1S80 rispondeva a due esigenze fondamentali in ambito genetico forense: -La possibiltà di analizzare quantità minime di DNA mediante PCR -La necessità di avere a disposizione marcatori multiallelici e caratterizzati da un elevato grado di eterozigosità (maggiore dei sistemi DQA1). Il minisatellite presenta una unità ripetitiva di 16 basi (corta per essere un minisatellite) con più di venti alleli caratterizzati da un numero di ripetizioni nel range L’intero prodotto PCR varia da circa 400 bp (alleli più corti) a circa 800 bp (alleli più lunghi).

24 Il minisatellite D1S80 (un minisatellite amplificabile mediante PCR) Breve storia della genetica forense Vantaggi e svantaggi: -Metodo relativamente semplice (PCR + elettroforesi) -Elevata sensibilità (PCR) -Potere di discriminazione elevato (per un singolo locus) -La presenza di alleli multipli facilita l’interpretazione delle «misture» -Range bp del prodotto PCR troppo grande (problemi con DNA degradato) -Difficoltà per l’analisi in multiplex e per l’automazione

25 1995-present: MICROSATELLITI Breve storia della genetica forense (fine) L’introduzione dei microsatelliti in ambito forense verso la metà degli anni ’90 portò alla rapida «estinzione» dei marcatori utilizzati in precedenza. Dal 1995 ad oggi i microsatelliti autosomici sono rimasti i marcatori di elezione in ambito forense, ed è opinione diffusa (sebbene non da tutti condivisa) che lo rimarranno per sempre. Ciò nonostante, altri tipi di marcatori e sistemi polimorfici vengono oggi utilizzati in casi forensi specifici: - Variazione di sequenza del DNA mitocondriale - Microsatelliti del cromosoma Y e del cromosoma X - SNPs Questi sistemi polimorfici, assieme ai microsatelliti, saranno trattati in dettaglio in lezioni dedicate

26 Confronto tra sistemi polimorfici utilizzati in ambito genetico forense nel XX secolo (variabilità vs. rapidità analisi) Speed of Analysis (Technology) Power of Discrimination (Genetics) Low High SlowFast RFLP Single Locus Probes RFLP Multi-Locus Probes ABO blood groups Multiplex STRs DQ  single STR D1S80 mtDNA PolyMarker Figure 1.1, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press Breve storia della genetica forense (fine)

27 In qualsiasi tipo di applicazione (forense, evolutiva, mappatura, diagnostica) che coinvolga dei marcatori genetici polimorfici sono disponibili (o sono stati disponibili) diversi tipi di marcatori. Storicamente, nelle diverse discipline alcuni marcatori sono stati preferiti ad altri, che sono caduti in disuso. La scelta dei marcatori si basa (o si è basata storicamente) su una serie di caratteristiche dei marcatori, che possono essere di tipo biologico o tecnico: localizzazione nel genoma tasso di mutazione grado di eterozigosità numero di alleli ereditarietà mendeliana sensibilità del metodo precisione del metodo possibilità di analisi multiple possibilità di standardizzazione tempi tecnici dell’esperimento costi dell’attrezzatura costi dell’esperimento Caratteristiche biologiche Caratteristiche tecniche

28 Natura molecolare dei microsatelliti I microsatelliti sono una classe di DNA ripetuto in tandem (VNTR, variable number of tandem repeats) caratterizzato da un piccolo numero di ripetizioni corte in tandem. Sono comuni nel DNA nucleare di tutti gli eucarioti fino ad ora esaminati (circa 1/10 mila basi) Nei primati rappresentano circa 1% del genoma

29 Esempio di microsatellite utilizzato in ambito genetico forense: D16S539

30 I microsatelliti possono essere perfetti, interrotti o composti e vengono ulteriormente classificati in base alla lunghezza del motivo ripetuto (dinucleotide repeats, trinucleotide repeats ecc..) perfetti interrotti composti Natura molecolare dei microsatelliti

31 I microsatelliti sono distribuiti in modo abbastanza omogeneo nel DNA nucleare dove si ritrovano sia sugli autosomi che nei cromosomi sessuali. Nei primati rappresentano circa 1% del genoma. Non sono invece presenti nel mtDNA umano Distribuzione dei microsatelliti

32 L’elevato tasso di mutazione nei microsatelliti è dovuto a scivolamento della polimerasi in replicazione Tasso di mutazione molto elevato: – mutazioni/STR/generazione La mutazione avviene generalmente per aumento o diminuzione di una singola unità ripetitiva Mutazioni per aumento più frequenti di mutazioni per diminuzione Il tasso di mutazione per ciascun microsatellite è positivamente correlato con la lunghezza dell’allele Mutazione nei microsatelliti

33 Il polimorfismo nei microsatelliti consiste nel diverso numero di copie del motivo semplice il numero degli alleli è generalmente compreso tra 4 e 40 il grado di variabilità dei microsatelliti è correlato positivamente con il numero di ripetizioni; microsatelliti corti sono in genere monomorfici A causa dell’elevato tasso di mutazione, gli alleli dei microsatelliti uguali in stato spesso non lo sono per discendenza (CORSO EVOL. MOLECOLARE) Microsatelliti interrotti in genere mostrano un grado minore di variabilità di microsatelliti perfetti di pari lunghezza La mutazione nei microsatelliti generalmente non ha effetti fenotipici, ma in alcuni casi è causa di importanti malattie, in gran parte neuro- degenerative (CORSO GENETICA UMANA) Variabilità genetica dei microsatelliti

34 I microsatelliti in ambito forense «Il microsatellite ideale» (nella genetica forense) 1)Microsatellite con elevata eterozigosità 2)Microsatellite con range allelico contenuto 3)Microsatellite amplificabile in corti prodotti PCR 4)Microsatellite i cui alleli siano ben separabili su gel 5)Microsatellite che presenti un ridotto fenomeno di stuttering 6)Microsatellite con tasso di mutazione contenuto 7)Microsatellite situato su autosomi Molte di queste caratteristiche si escludono vicendevolmente: Qual è un ragionevole compromesso? Tetranucleotide repeats selezionati

35 I microsatelliti in ambito forense Necessità di identificare un set unico (core) di microsatelliti che sia condiviso da tutta la comunità genetico forense. Pannello di 13 microsatelliti «core» (in giallo) secondo il CODIS, USA CODIS (Combined DNA Index System) Programma dell’FBI in supporto alla giustizia attraverso l’utilizzazione di databases di profili genetici. In UK e alcuni altri stati Europei si utilizza un core di 10 STR, 8 dei quali in comune con il CODIS I 13 microsatelliti furono scelti nel 1997 a partire da 17 loci candidati, in base alla loro variabilità e facilità di interpretazione dei risultati. I 13 loci sono tutti «tetranuceotide repeats», sia semplici che composti. L’analisi dei 13 loci del CODIS porta a profili genetici la cui probabilità di random match media è minore di 1 su un milione di milioni ( ).

36 I microsatelliti in ambito forense Necessità di identificare un set unico (core) di microsatelliti che sia condiviso da tutta la comunità genetico forense. I kit commerciali sviluppati da Applied Biosystems (a sinistra) e Promega (sotto) permettono di amplificare i 13 STR «core» del CODIS più alcuni altri STR. I kit commerciali sono in continua «evoluzione» inseguendo le richieste della comunità forense (>loci, mini STR, Y-STR, STR ipervariabili ecc.) I kit commerciali sono in continua «evoluzione» inseguendo le richieste della comunità forense ( maggior numero di loci coamplificabili, mini STR, Y-STR, STR ipervariabili ecc.)

37 Nomenclatura dei microsatelliti (e dei loro alleli) Necessità di fare riferimento ad una nomenclatura univoca per permettere il confronto tra laboratori e con i diversi database Nomenclatura degli alleli: (1) Scelta del filamento - Se il microsatellite è in un gene, si prende in considerazione il filamento codificante - Se il microsatellite non è in un gene, si prende in considerazione il filamento corrispondente alla sequenza originariamente descritta in letteratura e riportata in un database pubblico. La direzione di lettura è sempre, ovviamente, 5’-3’ ’-TTTCCC TCAT TCAT TCAT TCAT TCAT TCAT TCACCATGGA-3’ 3’-AAAGGG AGTA AGTA AGTA AGTA AGTA AGTA AGTGGTACCT-5’

38 Nomenclatura dei microsatelliti (e dei loro alleli) (2) Nome del motivo ripetuto. Nell’esempio riportato sotto, potremmo parlare di un microsatellite di tipo (TCAT) n oppure (CATT) n oppure (ATTC) n o ancora (TTCA) n (TCAT) n (3) «Microvarianti». Alleli con motivi ripetuti incompleti devono includere il numero di ripetizioni complete e, separate da un punto, il numero di basi nella ripetizione incompleta. Esempio 9.3; 14.2 ecc ’-TTTCCC TCAT TCAT TCAT TCAT TCAT TCAT TCACCATGGA-3’ 3’-AAAGGG AGTA AGTA AGTA AGTA AGTA AGTA AGTGGTACCT-5’

39 Generare un profilo STR 1. Estrazione e quantificazione del DNA 1. Estrazione e quantificazione del DNA (attenzione: questi steps in genetica forense sono di fondamentale importanza e sono successivi ad uno step di caratterizzazione del campione – vedi lezioni Maggiore Iacovacci) (attenzione: questi steps in genetica forense sono di fondamentale importanza e sono successivi ad uno step di caratterizzazione del campione – vedi lezioni Maggiore Iacovacci) Contenuto in DNA nucleare dei campioni biologici: Tipo di campione Quantità di DNA Sangue ng/mL macchia 1 cm ng macchia 1 mm 2 2 ng Liquido seminale ng/mL tampone vaginale postcoitale ng/tampone Capelli capello strappato capello perso ng/capello ng/capello Saliva Urine Cellula umana diploide ng/mL ng/mL ~5 pg

40 Amplificare tramite PCR contemporaneamente più microsatelliti (multiplex), utilizzando primers fiancheggianti ciascun locus. Amplificare tramite PCR contemporaneamente più microsatelliti (multiplex), utilizzando primers fiancheggianti ciascun locus. Generare un profilo STR: 2. Amplificazione mediante PCR multiplex Per ottenere buoni risultati i primers devono essere scelti con attenzione: - Le temperature di annealing dei vari primers devono essere simili - Devono essere valutate e minimizzate le possibili interazioni tra primers, anche appartenenti a coppie diverse (esempio complementarietà al 3’) - Una valutazione sperimentale della concentrazione ottimale dei singoli primers è sempre necessaria quando si mette a punto una nuova multiplex, così come una titolazione dei vari componenti della PCR.

41 PRESENZA DI INIBITORI: I reperti biologici possono essere mescolati con inibitori della PCR di tipo organico ed inorganico che non sempre vengono eliminati efficacemente negli step di purificazione del DNA. PRESENZA DI INIBITORI: I reperti biologici possono essere mescolati con inibitori della PCR di tipo organico ed inorganico che non sempre vengono eliminati efficacemente negli step di purificazione del DNA. Ulteriore purificazione, BSA, diluzione CONTAMINAZIONE IN LABORATORIO O IN FASE DI REPERTAZIONE: CONTAMINAZIONE IN LABORATORIO O IN FASE DI REPERTAZIONE: a causa della sua elevata sensibilità, la PCR presenta un forte problema legato alla contaminazione, in misura tanto maggiore quanto più il DNA in esame è scarso e/o degradato. Utilizzazione di guanti monouso e mascherine (in lab e in repertazione) Strumentazione e spazi pre- e post- PCR separati; Utilizzazione di puntali monouso con filtro Irradiazione con UV dell’area dedicata alla preparazione della PCR Creazione di un database di profili genetici del personale del laboratorio Generare un profilo STR: 2. Amplificazione mediante PCR multiplex Problemi in ambito forense

42 Generare un profilo STR: 3. sequenziamento mediante elettroforesi capillare

43 Contribution of the National Institute of Standards and Technology, 2010 Laser Inlet Buffer Capillary filled with polymer solution 5-20 kV -+ Outlet Buffer Sample tray Detection window (cathode) (anode) Data Acquisition Sample tray moves automatically beneath the cathode end of the capillary to deliver each sample in succession

44 Prodotto PCR fluorescente viene denaturato con formammide e posto nel campionatore Prodotto PCR fluorescente viene denaturato con formammide e posto nel campionatore Si applica voltaggio elettrico Il prodotto PCR viene elettroiniettato nel capillare Si applica voltaggio elettrico Il prodotto PCR viene elettroiniettato nel capillare Quando il frammento arriva in corrispondenza di una finestra nel capillare, una sorgente laser eccita il fluorocromo legato al prodotto PCR Quando il frammento arriva in corrispondenza di una finestra nel capillare, una sorgente laser eccita il fluorocromo legato al prodotto PCR Detector Window Generare un profilo STR: 3. sequenziamento mediante elettroforesi capillare: Il DNA migra nel polimero contenuto nel capillare; tanto più velocemente quanto minore è la grandezza del frammento Il DNA migra nel polimero contenuto nel capillare; tanto più velocemente quanto minore è la grandezza del frammento

45 Il fluorocromo eccitato dal laser emette luce nel visibile, in un determinato intervallo di lunghezze d’onda (vedi dia succ.) e con una intensità che è proporzionale alla quantità di molecole di fluorocromo eccitate. Il fluorocromo eccitato dal laser emette luce nel visibile, in un determinato intervallo di lunghezze d’onda (vedi dia succ.) e con una intensità che è proporzionale alla quantità di molecole di fluorocromo eccitate. La luce emessa viene filtrata per determinati range di lunghezza d’onda e convertita in un segnale elettrico che viene misurato in RFUs (Relative Fluorescence Units). La luce emessa viene filtrata per determinati range di lunghezza d’onda e convertita in un segnale elettrico che viene misurato in RFUs (Relative Fluorescence Units). I segnali elettrici vengono tradotti nei tipici picchi colorati degli elettroferogrammi. I segnali elettrici vengono tradotti nei tipici picchi colorati degli elettroferogrammi. Generare un profilo STR: 3. sequenziamento mediante elettroforesi capillare (segue) CCD Panel (with virtual filters) Argon ion LASER (488 nm) Color Separation Fluorescence ABI Prism spectrograph Processing with GeneScan/Genotyper software Sample Interpretation Sample Detection Capillary (filled with polymer solution)

46 WAVELENGTH (nm) Filter Set F with color contributions 5-FAMJOENED ROX Laser excitation (488 nm, nm) Laser excitation (488 nm, nm) Normalized Fluorescent Intensity Spettri di emissione dei fluorocromi Applied B. in uso nel kit AmpFlSTR. I filtri virtuali sono rappresentati dalle quattro colonne nere centrate sul picco dello spettro di ciascuno dei 4 fluorocromi. A causa della sovrapposizione degli spettri, una matrice di deconvoluzione (4 x 4) deve essere utlizzata per una corretta interpretazione dei dati. (Butler 2010 Figura 9.8)

47 Generare un profilo STR: 4. interpretazione dei dati del sequenziamento: dati grezzi

48 D3vWAFGA D8D21D18 D5D13D7 Am RAW DATA PROCESSED DATA Il software GENESCAN divide I dati grezzi in un elettroferogramma separato per ciascun colore Blue Green Yellow Red Il software GENOTYPER identifica i differenti loci e per ciascuno di essi riconosce gli alleli facendo riferimento ad uno standard di peso molecolare e ad un ladder allelico (vedi dia successive)

49 Ladder allelico (a) Ladder kit “PowerPlex ESI 17” (b) Ladder kit “Identifiler” Ladder allelico per il locus D16S539 prodotto da Promega (a) e Applied Biosystems (b)

50

51 Contribution of the National Institute of Standards and Technology, 2010 Data Collection Peak Identification Data Review by Analyst/Examiner Color Separation Peak Sizing Comparison to Allelic Ladder Confirmation of Results by Second Analyst/Examiner Genotype Assign. to Alleles GeneScan software Genotyper software Internal size standard Matrix file (spectral calibration) Allelic ladder sample GeneMapperID software Expert Systems (e.g., FSS-i3, TrueAllele) Peak Editing to Remove Artifact Calls User-defined thresholds

52 La probabilità di match casuale “la regola del prodotto” Il peso di una corrispondenza (match) tra un profilo di DNA Q ed il profilo di un sospettato K è «quantificato» in termini di probabilità. Il peso di una corrispondenza (match) tra un profilo di DNA Q ed il profilo di un sospettato K è «quantificato» in termini di probabilità. Ovvero: qual’è la probabilità che un profilo come quello creato a partire dal materiale biologico rinvenuto corrisponda al profilo genetico di un individuo scelto a caso dalla popolazione? Ovvero: qual’è la probabilità che un profilo come quello creato a partire dal materiale biologico rinvenuto corrisponda al profilo genetico di un individuo scelto a caso dalla popolazione? Si applica la regola statistica del prodotto per eventi indipendenti. Si assume che la probabilità dei singoli eventi (genotipi) corrisponda alla frequenza attesa del genotipo in questione in una popolazione che sia all’equilibrio di Hardy- Weinberg Si applica la regola statistica del prodotto per eventi indipendenti. Si assume che la probabilità dei singoli eventi (genotipi) corrisponda alla frequenza attesa del genotipo in questione in una popolazione che sia all’equilibrio di Hardy- Weinberg Prima di vedere come calcolare questa probabilità, è necessario (ri)prendere in con siderazione alcuni concetti base di genetica delle popolazioni

53 BREVE (MA FONDAMENTALE) INCISO Per la loro rilevanza in ambito genetico forense, nelle 5 slides a seguire si parlerà di: Frequenze alleliche Frequenze alleliche Frequenze genotipiche Frequenze genotipiche Equilibrio di Hardy - Weinberg Equilibrio di Hardy - Weinberg

54 Un allele è una variazione ad un locus La frequenza allelica è la frequenza di un certo allele in una popolazione. Es. Popolazione composta da 20 omozigoti CC 45 eterozigoti CT 35 omozigoti TT Frequenza allele C = (20 x )/ 2x100 = Frequenza allele T = (35 x )/ 2x100 = ad esempio Allele 1: CCGCTACGTACGGCGATCGATGGCGGCCACGCTCGCGATCGCTACGCTA Allele 2: CCGCTACGTACGGCGATCGATGGCGGCTACGCTCGCGATCGCTACGCTA Eterozigosità della popolazione per il locus in esame = = 0.489

55 Esempio: Frequenze genotipiche e frequenze alleliche del locus STR D13S317 nella popolazione caucasuica americana:

56 Equilibrio di Hardy-Weinberg Assunzioni: accoppiamento casuale no mutazione no migrazione no selezione popolazione infinita (no deriva genetica) = p 2 = q 2 = 2pq AA Aa aa sia p la frequenza di A, e q la frequenza di a. Le frequenze genotipiche raggiungono l’equilibrio in una generazione; Le frequenze alleliche rimangono costanti nel tempo All’equilibrio:

57 Le popolazioni raggiungono l’equilibrio di Hardy-Weinberg in una generazione A1A1A1A1 A1A2A1A2 A2A2A2A2 Non in equilibrio A 1 A 1 A 1 A 2 A 2 A In equilibrio A 1 A 1 A 1 A 2 A 2 A Generazione successiva p 2 2pq q 2

58 Hardy-Weinberg equilibrium Nelle popolazioni naturali, le frequenze genotipiche sono quasi sempre in equilibrio di Hardy-Weinberg

59 Frequenza allelica Frequenza genotipica Equilibrio di Hardy-Weinberg

60 Probabilità di match casuale 0.222x x2 = 0.1 Locus D3S1358

61 Probabilità di match: la regola del prodotto 1 in 79,531,528,960,000,000 1 in 101 in 1111 in 20 1 in 22,200 xx 1 in 1001 in 141 in 81 1 in 113,400 xx 1 in 1161 in 171 in 16 1 in 31,552 xx

62 La legge di H-W e la misura di variabilità dei sistemi polimorfici La maggior parte delle misure di variabilità dei singoli marcatori genetici si basa sulla legge di Hardy-Weinberg. (1) L’eterozigosità (H) corrisponde (se non diversamente specificato) alla proporzione di genotipi eterozigoti in una popolazione che sia all’equilibrio H-W (eterozigosità attesa) Se p e q sono le frequenze alleliche di un sistema biallelico, allora l’eterozigosità è il ben noto prodotto 2pq Se il sistema è multiallelico con i alleli, indicate con p i le frequenze degli alleli, l’eterozigosità corrisponde a 1-∑p i 2

63 La legge di H-W e la misura di variabilità dei sistemi polimorfici La maggior parte delle misure di variabilità dei singoli marcatori genetici si basa sulla legge di Hardy-Weinberg. (2) Probabilità di identità (matching probability) Considerato un locus, corrisponde alla probabilità che due individui «estratti» a caso dalla popolazione presentino lo stesso genotipo. Questa probabilità è pari alla sommatoria del quadrato delle frequenze dei singoli genotipi (perché?). In una popolazione all’equilibrio H-W, considerando un sistema polimorfico con i alleli, indicate con p i le frequenze degli alleli, e con X i la frequenza dei genotipi, questa probabilità corrisponde a:

64 La legge di H-W e la misura di variabilità dei sistemi polimorfici La maggior parte delle misure di variabilità dei singoli marcatori genetici si basa sulla legge di Hardy-Weinberg. (3) Potere di esclusione (probabilità di esclusione) Considerato un locus, misura quanto un locus sia «potente» nel discriminare tra genotipi di una popolazione, e corrisponde alla probabilità di «estrarre» a caso dalla popolazione due individui che presentino genotipi diversi. Questa probabilità corrisponde al complemento ad uno della probabilità di identità :

65 U.S. Caucasians, STR D13S317 H = PD = PI = Indici di diversità al locus D13S317 Nota: fare attenziona alla differenza tra: (1) probabilità di match casuale tra genotipo Q e genotipo casuale della popolazione (corrisponde alla frequenza nella popolazione del genotipo Q) e (2) probabilità di identità (PI) per l’intero locus (sempre di probabilità di match si tratta).

66 La legge di H-W e la misura di variabilità dei sistemi polimorfici Esercitasi nel calcolo dei vari indici in uso in genetica forense (più avanti vedremo anche l’indice di paternità) Ipotetico locus biallelico p = q = 0.5 H = 0.5 (val. max per locus biallelico) PD = (val max per locus biallelico) PI = (val min per locus biallelico) Ipotetico locus multiallelico 10 alleli di uguale frequenza H = 0.90 PD = PI = 0.019

67 Problemi nell’interpretazione di profili STR Purtroppo, non sempre si ottiene un risultato di facile interpretazione come quello dell’esempio utlizzato per valutare la probabilità di match casuale

68 Problemi nell’interpretazione di profili STR A. Problemi «biologici» A.1: prodotti «stutter». Come conseguenza dello scivolamento della polimerasi nell’amplificare durante la PCR ripetizioni in tandem (fenomeno analogo a quello che porta alla mutabilità in natura dei microsatelliti) si ottengono alcuni prodotti PCR più corti di un’unità rispetto al numero di ripetizioni dell’allele amplificato. In genere, il prodotto dello stuttering ha un’altezza inferiore al 20% del picco «reale» (almeno per i loci validati in ambito forense). Punti da considerare: - differenze tra loci, - differenze per lo stesso locus in esperimenti diversi, - possibili problemi nell’interpretazione di tracce miste.

69 Problemi nell’interpretazione di profili STR A. Problemi «biologici» A.2: Pattern «multiallelici» Sono generalmente conseguenza della duplicazione (intra- inter- cromosomica) della regione che contiene uno dei microsatelliti della multiplex. Per quanto si tratti di un fenomeno raro (almeno nei microsatelliti forensi standard) sono state riportate in letteratura decine di differenti pattern triallelici. Punti da considerare: -Differenza rispetto alle misture di campioni -Problemi per il calcolo delle probabilità Type 1 sbilanciata Type 2 bilanciata

70 Problemi nell’interpretazione di profili STR A. Problemi «biologici» A.3: Aggiunta di adenina al 3’ incompleta La Taq polimerasi in genere aggiunge al 3’ del filamento PCR neosintetizzato un’adenina. Le multiplex STR sono ottimizzate in modo che questo avvenga regolarmente. Può accedere tuttavia in alcuni casi che si verifichi una adenilazione incompleta dei prodotti PCR, che da luogo, per ciascun allele) a due picchi distanziati di una sola base nell’elettroferogramma. Punti da considerare: Un picco più corto di una base rispetto al normale potrebbe essere interpretato come una «microvariante» Incomplete adenylation D8S1179 -A +A -A +A

71 Problemi nell’interpretazione di profili STR A. Problemi «biologici» A.4: Alleli «off ladder» below ladder between-ladder (microvariante) Allelic ladder above ladder Sono alleli che presentano un numero minore (alleli “below ladder”) o maggiore (“above ladder”) di ripetizioni di quante ne siano presenti nei ladder commerciali per multiplex STR. Sono considerati “off ladder” anche gli alleli con una lunghezza dell’amplicone PCR tale da ricadere tra due alleli del ladder (microvarianti o alleli “between ladder”), generalmente dovuti a piccole inserzioni delezioni nell’amplicone.

72 Problemi nell’interpretazione di profili STR A. Problemi «biologici» A.5: Alleli nulli In presenza di una mutazione al 3’ del sito di annealing di uno dei due primers utilizzati per amplificare un STR, la Taq polimerasi non è in grado di sintetizzare il prodotto PCR. La conseguenza può essere quella che solo uno dei due alleli STR vengono amplificati. (vedi slide successiva per figura) Punti da considerare: -Kit differenti per STR multiplex con diversi set di primers -Problemi per il confronto con databases: stringenza della ricerca di match -Problemi nei test di paternità

73 Contribution of the National Institute of Standards and Technology, 2010 * * Allele 6 amplicon has ‘dropped out’ Imbalance in allele peak heights Heterozygous alleles are well balanced No mutation Mutation at 3’-end of primer binding site (allele dropout) Mutation in middle of primer binding site (a) (b) (c) Alleli nulli o sbilanciati dovuti a mutazioni nel sito di annealing di un primer

74 Problemi nell’interpretazione di profili STR B. Problemi «tecnici» B.1: “pull up”: Incapacità del detector nel risolvere appropriatamente i colori emessi dai fluorocromi utilizzati per marcare i primers. B.2: “Dye blobs”: Dovuti al distaccamento dei fluorocromi dai primers con conseguente loro migrazione indipendente B.3: Cristalli di urea e bolle d’aria: Rilevabili come falsi picchi sottili nell’elettroferogramma. B.4: Contaminanti: Sostanze normalmente non presenti nel polimero all’interno del capillare, fluorescenti nella regione visibile dello spettro.

75 Reperti difficili: 1.DNA degradato 2.DNA scarso 3.Campioni misti Situazioni molto comuni nelle indagini forensi di tipo investigativo Quali strategie (tecniche e computazionali) possono essere utilizzate per risolvere casi in cui sono coinvolti campioni di questo tipo?

76 Reperti difficili: L’esposizione all’ambiente (acqua,batteri e funghi, UV, nucleasi) determina la progressiva degradazione del DNA. In presenza di DNA degradato, il vantaggio dell’utilizzazione di marcatori «corti» quali gli STRs è evidente. Se il DNA è fortemente degradato, potrebbero presentarsi dei problemi di amplificazione utilizzando le multiplex STRs, principalmente a carico dei microsatelliti in ampliconi più grandi. 1.DNA degradato Progressiva diminuzione dell’amplificato

77 Reperti difficili: In situazioni di forte degradazione, si può ricorrere a markers/strategie alternative rispetto agli STR convenzionali In questi casi si possono utilizzare: -SNPs (ampliconi < 100 basi) -mtDNA (l’elevato numero di copie rispetto al nucleare aumenta la probabilità che i primer si appaino ad un segmento di DNA «intatto») -«Mini-STRs» (STR con primer ridisegnati in modo da ottenere ampliconi più piccoli di quelli utilizzati normalmente) -Altre possibilità valutate: aree protette da nucleosomi, riparazione del DNA 1.DNA degradato Base pairs Differenti Markers RFLP (minisat multi-locus D1S80 STRs miniSTRs SNPs

78 Reperti difficili: Mini STR 1.DNA degradato

79 Reperti difficili: Si parla di «low template» DNA (LT-DNA) quando la quantità di DNA disponibile per l’analisi è inferiore a pg (il contenuto in DNA di cellule diploidi). Sebbene la PCR sia in grado (con qualche difficoltà) di amplificare un bersaglio a partire da una sola cellula, il problema principale del LT-DNA è quello della sensibilità del metodo. Nel tempo sono stati messi a punto vari sistemi per aumentare il prodotto PCR, ad esempio aumentando il numero di cicli. Un’alternativa agli STR, in caso di LT_DNA, è l’analisi di mtDNA Perché? Vantaggi e svantaggi 2.DNA scarso (Low Copy Number ~ Low template; «touch» DNA)

80 Reperti difficili: Problemi: I problemi sono tutti relativi al piccolo numero di copie dello stampo. L’entità di amplificazione dei singoli loci (e dei singoli alleli di ciascun locus) è soggetta alle leggi del caso. Interi loci o singoli alleli possono essere non amplificati, oppure può verificarsi uno sbilanciamento tra alleli. Allo stesso modo, può verificarsi un’amplificazione significativa degli stutter. Figura slide successiva 2.DNA scarso

81 Reperti difficili: 2.LT-DNA: problemi con STR Replicate #1 High stutter Consensus Profile: 14,197,9.312,1311,1324,Z Correct Profile: 14,197,9.312,1311,1318,24 Replicate #2 Replicate #3

82 Reperti difficili: Quando due o più individui hanno contribuito al campione in esame si parla di campioni misti o «misture». Il profilo STR relativo a questi campioni sarà a sua volta un «profilo misto», nel quale potranno facilmente essere evidenziati loci con un numero di alleli > 2. Importanza dei sistemi multiallelici nell’analisi di misture L’altezza relativa dei picchi dell’elettroferogramma riflette in modo abbastanza preciso la quantità relativa di DNA dei due (o più) individui nella mistura, e permette di valutare se un determinato picco possa risultare dalla sovrapposizione di alleli provenienti da individui diversi. Come conseguenza delle diverse possibili combinazioni di due (o più) genotipi ad un singolo locus, si verificheranno fenomeni di sbilanciamento allelico (es mistura tra un omozigote con ripetizioni 10/10 ed un eterozigote 10/11). La maggior parte delle misture coinvolge solo due individui 3.Reperti misti

83 Reperti difficili: 3.Reperti misti Steps per l’interpretazione di profili misti 1. Identificare la presenza di una mistura 2. Designare gli alleli nell’elettroferogramma 3. Stabilire il numero di individui coinvolti 4. Stimare il contributo relativo dei diversi individui alla mistura 5. Considerare tutte le possibili combinazioni genotipiche 6. Confrontare con campione di riferimento

84 Reperti difficili: 3.Reperti misti Dal profilo misto ai singoli profili: i diversi casi, le diverse strategie (cenni)

85 Le alternative agli STR autosomici

86 Non solo STR: gli SNPs nelle scienze forensi Sebbene gli STR autosomici siano i marcatori d’elezione della genetica forense, in alcuni casi si fa ricorso a marcatori differenti (SNPs) o situati su porzioni del genoma non autosomiche (mtDNA oppure cromosoma Y). Gli SNPs sono utilizzati principalmente quando il DNA da analizzare è fortemente degradato (prodotti PCR più piccoli, quindi maggiore probabilità di successo tecnico). Trovano tuttavia applicazione anche in: Predizione circa la popolazione di origine di un reperto biologico (AIMs, ancestry informartive markers) – (perché non gli STR?) Predizione circa la popolazione di origine di un reperto biologico (AIMs, ancestry informartive markers) – (perché non gli STR?) Predizione di caratteristiche fenotipiche. Ad esempio il fenotipo «capelli rossi» può essere dedotto (in una certa misura) dall’analisi di polimorfismi nel gene «recettore della melanocortina 1» (MC1R). Predizione di caratteristiche fenotipiche. Ad esempio il fenotipo «capelli rossi» può essere dedotto (in una certa misura) dall’analisi di polimorfismi nel gene «recettore della melanocortina 1» (MC1R).

87 Non solo STR: gli SNPs nelle scienze forensi

88 Marcatori autosomici, del mtDNA e del cromosoma Y: vantaggi e svantaggi nelle scienze forensi

89 Marcatori “uniparentali” nelle scienze forensi Cromosoma Y si utilizzano principalmente Y-STR La variabilità del cromosoma Y viene sfruttata nelle scienze forensi principalmente nei casi di misture maschio-femmina (es. violenza sessuale), per ottenere un profilo STR maschio-specifico non contaminato dal DNA della vittima. Altre applicazioni interessano: - test di parentela nei quali non siano disponibili parenti stretti del probando (il profilo STR del cromosoma Y sarà identico in parenti anche molto lontani lungo le linee di discendenza maschile) - Misture con un numero elevato di maschi possono essere più facilmente interpretabili se si analizza il cromosoma Y. - Maschi deficienti per amelogenina Problemi principali: Essendo un cromosoma non ricombinante ( a parte le PAR) la variabilità si accumula solo per mutazione. Minore informazione e impossibilità di ottenere probabilità di match con la regola del prodotto (si usa la frequenza dell’intero aplotipo nella popolazione)

90 Marcatori “uniparentali” nelle scienze forensi mtDNA si “utilizza” principalmente la sequenza delle regioni ipervariabili (nel mtDNA umano non ci sono microsatelliti!!) La variabilità del mtDNA viene sfruttata nelle scienze forensi principalmente nei casi di DNA degradato o scarso (lezioni precedenti), a causa dell’elevato numero di copie di mtDNA per cellula. Al pari del cromosoma Y, il mtDNA viene usato anche nei test di parentela nei quali non siano disponibili parenti stretti del probando (la sequenza del mtDNA sarà identica in parenti anche molto lontani lungo le linee di discendenza femminile). Problemi principali: Come il cromosoma Y, mtDNA è un sistema non ricombinante e quindi la variabilità si accumula solo per mutazione. Ne consegue minore informatività («minore» variabilità) e impossibilità di ottenere probabilità di match con la regola del prodotto (si usa la frequenza dell’intero aplotipo nella popolazione per dare un peso alle compatibilità). Il DNA mitocondriale, per il tipo di genotyping cui è sottoposto (sequenziamento) non si presta facilmente nella risoluzione delle misture. La presenza frequente di eteroplasmia rappresenta un problema, soprattutto nel confronto di profili genetici provenienti da DNA estratto da tessuti diversi

91 Test di parentela e paternità

92 L’analisi del DNA può essere usata per studi sulla parentela di individui diversi. La maggior parte di questi studi riguarda: 1. Test di paternità 2. Studi per determinare se determinati individui (viventi o deceduti) siano imparentati. 3. Analisi volte a risolvere casi di persone scomparse. 4. Analisi volte ad identificare cadaveri nei disastri di massa 5. Analisi di supporto ad investigazioni criminali (…il parente dell’assassino…) 6. Predizione dell’origine etnica di un DNA (estendendo il concetto di parentela a quello di «coancestry»)

93 Test di paternità In tutti i casi, i test di parentela si basano su un concetto semplice: Individui imparentati condividono alleli in una maggiore proporzione (spesso misurabile) rispetto ad individui presi a caso dalla popolazione. Sono, in altre parole, più simili geneticamente Differenze tra autosomi, mtDNA, Cromosoma Y Consanguineità e alleli uguali per discendenza

94 Test di paternità Due possibili risultati: (1) Compatibilità: Tutti* gli “alleli obbligati paterni” del figlio sono presenti nel padre putativo (2) Esclusione: Più* “alleli obbligati paterni” del figlio non sono presenti nel genotipo del padre putativo * Attenzione ad alleli nulli e mutazioni!!!

95 Test di paternità Allele obbligato paterno L’allele (i) che il padre DEVE avere In base alle leggi dell’ereditarietà (1° legge Mendel ), considerando un locus autosomico e assumendo che “la madre sia certa”, se si conosce il genotipo di madre e figlio, è possibile dedurre (nella maggior parte dei casi) l’allele di origine paterna. Oppure (nei casi meno fortunati) due alleli di cui uno sia di origine paterna. Questo allele (o alleli) deve essere presente nel padre putativo (allele obbligato) pena esclusione della paternità.

96 Test di paternità Allele obbligato paterno

97 Test di paternità In caso di esclusione, il test può considerarsi concluso In caso di compatibilità, è necessario quantificare il “peso” dell’osservazione. P.I. = Indice di paternità (per un locus) C.P.I = Indice di paternità combinato (considerando più loci).

98 Test di paternità Indice di paternità L’ indice di paternità si calcola attraverso il rapporto di due probabilità: (1)Numeratore: probabilità che il padre putativo trasmetta l’allele(i) obbligato essendo il vero padre. Il trio in analisi è un vero trio (2)Denominatore: probabilità che un uomo qualsiasi della popolazione trasmetta l’allele(i) obbligato essendo il vero padre. Il trio in analisi è un falso trio Queste due probabilità discendono rispettivamente dalle leggi di Mendel e dalle leggi della genetica di popolazioni, il loro rapporto esprime una verosimiglianza (Likelihood Ratio, LR)

99 Test di paternità Indice di paternità: Esercitarsi nel calcolo! Esempio (semplice): Madre AB, Figlio AC, Padre AC (1)Individuare l’allele/i paterno obbligato/i (allele C in questo esempio) (2)Numeratore: Probabilità che il padre trasmetta l’allele obbligato = ½ (Mendel!!) (3)Denominatore: Probabilità che un individuo a caso della popolazione trasmetta l’allele obbligato = Frequenza dell’allele nella popolazione (Hardy-Weinberg!!)  necessità di utilizzare database di frequenze alleliche. Se l’allele C ha frequenza nella popolazione (ad esempio) p C = 0,1, allora (in questo esempio): P.I. = 0,5/0,1 = 5

100 Test di paternità Indice di paternità

101 Test di paternità Indice di paternità Un solo locus non è generalmente sufficiente per ottenere una informazione che abbia un peso rilevante circa la compatibilità osservata. Si considerano più loci C.P.I = Indice di paternità combinato Si ottiene come prodotto dei singoli P.I. Un valore di CPI > 100 viene in genere considerato sufficientemente alto da far ritenere il padre putativo il vero padre. CPI = 100 significa: « E’ 100 volte più probabile ottenere i risultati osservati (i profili genetici dei tre soggetti del trio) se il padre putativo (piuttosto che un uomo preso a caso dalla popolazione) è il vero padre Con i loci microsatelliti attualmente in uso in genetica forense, in caso di compatibilità si ottengono valori di CPI >> 100

102 Test di paternità Indice di paternità Un solo locus non è generalmente sufficiente per ottenere una informazione che abbia un peso rilevante circa la compatibilità osservata. Si considerano più loci C.P.I = Indice di paternità combinato Si ottiene come prodotto dei singoli P.I. Un valore di CPI > 100 viene in genere considerato sufficientemente alto da far ritenere il padre putativo il vero padre. CPI = 100 significa: « E’ 100 volte più probabile ottenere i risultati osservati (i profili genetici dei tre soggetti del trio) se il padre putativo (piuttosto che un uomo preso a caso dalla popolazione) è il vero padre Con i loci microsatelliti attualmente in uso in genetica forense, in caso di compatibilità si ottengono valori di CPI >> 100

103 Test di paternità Test di paternità in presenza di mutazioni In caso di esclusione si osserva generalmente non compatibilità per più loci. Ma come considerare una situazione in cui solo uno (o “pochi”) dei loci analizzati non sono compatibili? Bisogna tener conto delle possibili mutazioni Tasso di mutazione? Come si tiene conto delle mutazioni? “two exclusion rule” e CPI in presenza di mutazioni

104 Test di paternità Test di paternità in assenza di madre In caso di assenza della madre è sempre possibile determinare quale/i siano gli alleli obbligati paterni. In caso di non paternità, sarà molto frequente ottenere un giudizio di esclusione In caso di paternità, si avranno meno informazioni per dare un peso alla compatibilità osservata Si può utilizzare anche in questo caso il CPI

105 distribuzione nel genoma: sufficiente che i geni non siano in LD per una più facile trattazione statistica: OK tutti i marcatori tasso di mutazione: non fondamentale ma da tenere in considerazione OK tutti i marcatori grado di eterozigosità: fondamentale, maggiore l’eterozigosità, maggiore l’informazione: OK minisatelliti, STR ereditarietà mendeliana: importante per una più facile trattazione statistica OK STR, SNPs tempi tecnici dell’esperimento costi dell’attrezzatura costi dell’esperimento precisione del metodo tipizzazione mediante PCR: non rilevante se non in relazione ai costi possibilità di automazione su larga scala: non rilevante Nella pratica forense per i test di paternità si utilizzano quasi solamente STRs

106 Test di parentela Investigazioni su persone scomparse Tre categorie di campioni utilizzabili per identificazione di persone scomparse tramite l’analisi di profili genetici: 1) Campioni provenienti dall’individuo scomparso (spazzolino da denti, pettine, vestiti, vecchi reperti medici come biopsie) 2) Campioni di parenti che possono essere utlizzati per “ricostruire” il genotipo dell’individuo scomparso (“reverse parentage testing”) 3) Campioni provenienti da resti umani non identificati Si utilizzano e si confrontano: (1) database di profili di DNA di persone scomparse; (2) database di profili di resti umani non identificati; (3) database di profili di parenti di persone scomparse

107 Test di parentela Identificazione delle vittime dei disastri di massa (DVI) Tre categorie di campioni utilizzabili per identificazione di vittime di disastri: 1) Campioni provenienti dall’individuo scomparso (spazzolino da denti, pettine, vestiti, vecchi reperti medici come biopsie) 2) Campioni di parenti che possono essere utlizzati per “ricostruire” il genotipo dell’individuo scomparso (“reverse parentage testing”) 3) Campioni provenienti dai resti rinvenuti sulla scena del disastro Problemi: -Complicazioni dovute al numero di vittime -In alcuni casi frammentazione e dispersione dei reperti -Spesso DNA fortemente degradato a causa di incendi

108 Identificazione delle persone disperse nel World trade center in seguito ad attacco terroristico del 9/11 Il progetto ha generato Il progetto ha generato –52,000 profili STR –44,000 profili mtDNA –17,000 profili SNPs 850 delle 1594 vittime identificate grazie all’analisi del DNA 850 delle 1594 vittime identificate grazie all’analisi del DNA


Scaricare ppt "Genetica Forense Docente: Fulvio Cruciani Ricevimento: mercoledì 13:30-15:30 Edificio genetica, stanza 3-09 (2° piano) Telefono."

Presentazioni simili


Annunci Google