La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

GQuery (http://www. ncbi. nlm. nih

Presentazioni simili


Presentazione sul tema: "GQuery (http://www. ncbi. nlm. nih"— Transcript della presentazione:

1 GQuery (http://www. ncbi. nlm. nih
GQuery (http://www.ncbi.nlm.nih.gov/gquery/) è il punto di partenza per eseguire query su tutti o parte dei database dell’NCBI: si basa sul sistema di interrogazione ENTREZ Entrez is NCBI’s primary text search and retrieval system that integrates the PubMed database of biomedical literature with 39 other literature and molecular databases including DNA and protein sequence, structure, gene, genome, genetic variation and gene expression. The Entrez system comprises 40 molecular and literature databases. New databases are added as biomedical science advances and new kinds of data become available. An alphabetical list of the current databases with a brief description of each is given below. Informatica e Bioinformatica – A. A

2 PubMed (http://www.ncbi.nlm.nih.gov/pubmed)
PubMed, interrogabile tramite NCBI Entrez retrieval system, è stato sviluppato dal National Center for Biotechnology Information (NCBI) alla National Library of Medicine (NLM), ed è localizzato presso il National Institutes of Health (NIH).  PubMed consente l’accesso alle citazioni della letteratura biomedica e fornisce i link ad altre risorse biomolecolari di Entrez. Permette di trovare rapidamente una particolare pubblicazione di cui conosciamo ad es. il nome di un autore o un particolare termine PubMed comprises over 23 million citations for biomedical literature from MEDLINE, life science journals, and online books. PubMed citations and abstracts include the fields of biomedicine and health, covering portions of the life sciences, behavioral sciences, chemical sciences, and bioengineering. PubMed also provides access to additional relevant web sites and links to the other NCBI molecular biology resources. MEDLINE is the U.S. National Library of Medicine's® (NLM) premier bibliographic database that contains over 19 million references to journal articles in life sciences with a concentration on biomedicine. A distinctive feature of MEDLINE is that the records are indexed with NLM Medical Subject Headings (MeSH®). PubMed is a free resource that is developed and maintained by the National Center for Biotechnology Information (NCBI), at the U.S. National Library of Medicine (NLM), located at the National Institutes of Health (NIH). Possiamo risalire anche al nome per esteso di una rivista (e.g. mol cell biol) tramite il tasto Journals in NCBI Database Informatica e Bioinformatica – A. A

3 MeSH (Medical Subject Headings)
È un dizionario dei sinonimi e contrari (thesaurus) ‘controllato’ da NLM (National Library of Medicine). Consiste in un insieme di termini descritti in strutture gerarchiche che permettono di effettuare ricerche a vari livelli di specificità. Le descrizioni di MeSH sono disposte sia in modo alfabetico che in modo gerarchico. Questo dizionario è utilizzato dalla NLM per indicizzare gli articoli provenienti da più di 5400 riviste biomediche e non per Medline e PubMed. Serve anche per catalogare libri, documenti, audiovisivi ecc. Ogni referenza bibliografica è associata con un insieme di elementi del dizionario MeSH che ne descrivono il contenuto. Gerarchico, da termine più generale a più specifico (per una definizione più precisa della ricerca). Informatica e Bioinformatica – A. A

4 Le regole di interpretazione del sistema PubMed sono:
Termini descritti in strutture gerarchiche Le regole di interpretazione del sistema PubMed sono: - Per ogni parola viene consultato l’indice MeSH (vocabolario con tutti i termini medici e i loro sinonimi). Se non si trova nulla, viene consultato l’indice con tutti i giornali e le riviste, con i codici ISSN e le altre informazioni. - Se non si trova nulla, si cerca nel campo autori di tutte le entries possibili. An International Standard Serial Number (ISSN) is a unique eight-digit number used to identify a periodical publication at a specific media type. Informatica e Bioinformatica – A. A

5 Record MEDLINE (Medical Literature Analysis and Retrieval System Online)
Formato html Formato flat-file Informatica e Bioinformatica – A. A

6 ….. Ma per fortuna esistono strumenti che facilitano le ricerche ……..
Per poter effettuare complesse ricerche è necessario conoscere a fondo la struttura dei database e l’esatta denominazione dei campi ….. Ma per fortuna esistono strumenti che facilitano le ricerche …….. Tipica ‘Form’ di PubMed dell’NCBI Consente di salvare il risultato della vostra ricerca Consente di limitare la ricerca a determinati campi Consente di effettuare una ricerca più specifica Informatica e Bioinformatica – A. A

7 Esempio di ricerca in PubMed
Cerchiamo il termine “adaptation”. Quanti risultati abbiamo ottenuto? La ricerca può essere ritenuta soddisfacente? Come potrei impostare la query per ottenere risultati più specifici? Informatica e Bioinformatica – A. A

8 Questa volta cerchiamo il termine solo nel campo “title”
Possiamo velocizzare la nostra ricerca imponendo dei particolari filtri Questa volta cerchiamo il termine solo nel campo “title” Adesso quanti risultati soddisfano la nostra ricerca? Informatica e Bioinformatica – A. A

9 Il menù Display setting ci permette di scegliere quali campi rendere visibili, che numero di record mostrare per pagina, modificarne l’ordine (sort by) Si possono inoltre inviare i record ottenuti via , salvarli in un file ecc ecc. Informatica e Bioinformatica – A. A

10 Raffiniamo ulteriormente la nostra ricerca introducendo gli operatori booleani
Quanti risultati abbiamo trovato adesso? Informatica e Bioinformatica – A. A

11 Attenzione: se abbiamo applicato dei filtri alla ricerca, tutti i termini scritti nella query si riferiscono a quel filtro (ad esempio il campo Title) Occorre quindi esplicitare a che campo si riferisce lo specifico termine della query Informatica e Bioinformatica – A. A

12 Attenzione che in ENTREZ i filtri sono specifici del database che si sta interrogando.
Filtri nel database PubMed Filtri nel database Nucleotide Informatica e Bioinformatica – A. A

13 “Advanced” Con questa opzione viene visualizzata la “storia” delle query compiute e si può inoltre restringere la ricerca, utilizzando l’opzione “Search Builder” Con gli operatori booleani si possono aggiungere altri termini di ricerca Informatica e Bioinformatica – A. A

14 Cliccando sul tasto “Search” compaiono i risultati della ricerca formulata
Con Search details si può valutare come il sistema di retrieval ha interpretato e scomposto la nostra query. E con See more la corrispondenza tra la query generata e la query translation Informatica e Bioinformatica – A. A

15 Il nostro risultato contiene l’eventuale link alla rivista in cui è pubblicato e agli articoli correlati a quello cercato! Le modalità con cui si esegue una ricerca bibliografica sono di esempio per una qualsiasi ricerca testuale o query. Informatica e Bioinformatica – A. A

16 A proposito della ricerca bibliografica…
… per sapere se abbiamo accesso “full text” ad una rivista Informatica e Bioinformatica – A. A

17 Principali Database biologici
La maggior quantità di dati biologici presenti nei database è rappresentata da sequenze di acidi nucleici Principali Database biologici Sequenze di acidi nucleici ottenute da: DNA genomico Trascritti (mRNA) EST (corte sequenze di trascritti) Sequenze proteiche ottenute da: Sequenziamento diretto (degradazione di Edman) Traduzione informatica delle sequenze nucleotidiche (traduzione) Studi di espressione proteica (gel bidimensionale e spettrometria di massa) * Cristallografia e determinazione delle strutture secondarie e terziarie Informatica e Bioinformatica – A. A

18 Sequenze di DNA Sequenze di mRNA
Il DNA genomico viene frammentato in regioni di più o meno piccole dimensioni. I differenti frammenti vengono poi sequenziati. Con l’assemblaggio delle sequenze ottenute da questi frammenti si ottengono le lunghe sequenze di DNA presenti nei database, che rappresentano parte di o interi cromosomi. Se si vogliono conoscere lunghe sequenze di DNA, è necessario sequenziare frammenti del DNA e poi assemblare le corte sequenze in modo che si sovrappongano tra loro Sequenze parziali Sequenza assemblata Sequenze di mRNA L’mRNA (meno stabile del DNA) deve essere preventivamente trasformato in cDNA: da una molecola di mRNA si ottiene prima una copia complementare di DNA a singolo filamento che poi viene resa a doppia elica. Si procede poi come per il DNA genomico Informatica e Bioinformatica – A. A

19 Ragioni per cui sequenziare anche l’mRNA
Per individuare i geni negli eucarioti superiori (in uomo solo l’1,5-3% del genoma è codificante). Questo permette anche di studiare le sequenze fiancheggianti e quindi la regolazione della trascrizione. Per conoscere (tradurre la sequenza nucleotidica in sequenza proteica) e studiare informaticamente la relativa proteina. Per conoscere varianti (splicing alternativi) dello stesso gene e quindi probabili funzioni differenti della proteina generata. Per conoscere l’espressione genica: individuare quando (sviluppo o momento particolare) e dove (quale tessuto) un gene viene espresso. Informatica e Bioinformatica – A. A

20 Sequenze EST (Expressed Sequence Tag)
Per individuare la presenza di un trascritto non serve conoscerne tutta la sequenza, ma è sufficiente che se ne identifichi una parte. Da questo presupposto sono stati sviluppati progetti di sequenziamento di corte sequenze di cDNA chiamate EST (Expressed Sequence Tag) che hanno permesso di studiare i profili trascrizionali (espressione genica in un particolare tessuto, in un particolare momento dello sviluppo, in presenza di una particolare malattia genetica). ATG AAAAAAAAA TAA 5’UTR Seq. codificante 3’UTR polyA EST 5’ EST 3’ Attualmente nei database esistono più di 74 milioni di sequenze di EST di cui oltre 8 milioni relative a Homo sapiens (human) e quasi 5 milioni relative a topo Informatica e Bioinformatica – A. A

21 I database primari di acidi nucleici
Cosa sono i database primari? Sono i contenitori di tutte le sequenze prodotte nel mondo e rese disponibili alla comunità scientifica. Memorizzano essenzialmente le sequenze e poche altre informazioni generiche ad esse correlate (laboratorio dove è avvenuto il sequenziamento, data di produzione, organismo, descrizione …) ENA Europa GenBank USA DDBJ Giappone European Nucleotide Archive, consultabile tramite i web services messi a disposizione dal gestore EMBL-EBI, la cui caratteristica principale è che dati e tools sono disponibili gratuitamente e inoltre sono portabili (scaricabili e installabili localmente), DNA DataBank of Japan (DBGET). I tre database si aggiornano quotidianamente scambiandosi i dati ricevuti durante la giornata, in modo che sia sufficiente interrogare solo uno dei tre. Per l’interrogazione dei database ciascun gestore ha sviluppato differenti sistemi di retrivial (vi ricordate Entrez?) Informatica e Bioinformatica – A. A

22 NCBI http://www.ncbi.nih.gov/Genbank/index.html
Release attuale: 200, Febbraio 2014 Informatica e Bioinformatica – A. A

23 Informatica e Bioinformatica – A. A. 2013-2014
GenBank WGS Release Date Bases Sequences 200 Feb 2014 Informatica e Bioinformatica – A. A

24 NUCLEOTIDE http://www.ncbi.nlm.nih.gov/nucleotide/
Generiamo quindi le nostre queries… Informatica e Bioinformatica – A. A

25 Esempio di ricerca in Nucleotide
Quanti e che tipo di record vengono trovati. Nome ufficiale del gene. In questo caso siamo interessati ai trascritti… Informatica e Bioinformatica – A. A

26 ? ? ? ID per il mRNA che ci interessa.
Informatica e Bioinformatica – A. A

27 Analizziamo meglio il record
LOCUS un codice DEFINITION descrizione della sequenza ACCESSION ORGANISM l’organismo a cui appartiene la sequenza (e tassonomia) REFERENCE Riferimenti bibliografici a quella sequenza o chi l’ha sottomessa Informatica e Bioinformatica – A. A

28 Continua da precedente
COMMENT molto utile ma purtroppo non sempre presente FEATURES alcune caratteristiche e link importanti, ad esempio: le coordinate cromosomiche il gene la sequenza codificante la traduzione in proteina Informatica e Bioinformatica – A. A

29 Continua da precedente
… e molte altre informazioni E per concludere la sequenza nucleotidica Se non è chiara la descrizione dei campi si può utilizzare il link: Informatica e Bioinformatica – A. A

30 Questo è un record speciale in cui sono definiti i principali campi
Informatica e Bioinformatica – A. A

31 Ad esempio potremmo scegliere solo alcune sequenze di Sus scrofa
Come già accennato, anche nel database nucleotidico si possono raffinare le ricerche tramite l’utilizzo dei “LIMITS” Ad esempio potremmo scegliere solo alcune sequenze di Sus scrofa E’ possibile selezionare solo alcuni dei record risultanti ed effettuare delle operazioni solo su essi. Ad esempio visualizzarne la sequenza, salvarli su file.... Informatica e Bioinformatica – A. A

32 Con “DISPLAY SETTINGS” si può impostare il formato con cui visualizzare i dati
Informatica e Bioinformatica – A. A

33 IL FORMATO “FASTA” Spesso i programmi che effettuano analisi bioinformatiche sulle sequenze richiedono che esse vengano date come input in questo formato particolare. FASTA è un formato standard per la rappresentazione di una sequenza in formato testo. Consiste in una intestazione, di solito limitata a una linea di testo, e in una o più linee che riportano una sequenza di DNA o di amminoacidi usando l’alfabeto standard. Ecco un esempio: >37463.f1|g83244|telethonin ecc. ACGTGACTGCTACGTACGGGCGTTACGACTGCTACGACGCATGCTATGTC GTAGCAGCCGTGTACACGTGTTTATTCGTAGGGCTTCTA ‘>’ Simbolo d’inizio della riga di intestazione Sequenza Riga di intestazione Interruzione di riga L’intestazione (la prima riga del file precedente) è riconoscibile perché ha inizio con il simbolo ‘>’. Il testo che segue tale simbolo nella stessa riga può essere strutturato liberamente: di solito, la prima cosa che si trova scritta è un accession number, ossia l’identificatore della sequenza che ne permette il reperimento. Informatica e Bioinformatica – A. A

34 È anche possibile visualizzarne la sequenza inversa complementare:
Una volta visualizzato un record di sequenza è pure possibile estrarne solo una parte È anche possibile visualizzarne la sequenza inversa complementare: vi ricordate cosa significa? Vediamo ora altri database… Informatica e Bioinformatica – A. A

35 Informatica e Bioinformatica – A. A

36 Informatica e Bioinformatica – A. A

37 Le mutazioni possono riflettersi in alterazioni della funzionalità della proteina da esso codificata. Questo mutazioni possono causare le cosiddette malattie genetiche. Esempio: una mutazione a carico del gene della β-globina fa sì che una particolare base del gene venga sostituita con un’altra, ciò altera il codone e nella proteina ciò si riflette nella sostituzione di un glutamato con una valina e in una ridotta funzionalità della proteina che causa una malattia genetica detta anemia a cellule falciformi. Il database OMIM cataloga le malattie genetiche e fornisce descrizioni particolareggiate delle malattie e delle possibili cause (mutazioni). Informatica e Bioinformatica – A. A

38 Problemi dei database primari di acidi nucleici 
Formato dei dati (standardizzazione) Accuratezza dei dati (terminologie improprie, errori tipografici, ecc.) Comprensibilità Ridondanza (immissione della stessa sequenza più volte, ma anche produzione della stessa sequenza nucleotidica più volte per motivi vari) Per queste ragioni si sono resi necessari i DATABASE COMPOSTI Per generare il database composto si prendono i dati da più sorgenti, generalmente con formati diversi e si costruisce un nuovo database specializzato, in genere “pulito” e non ridondante. Esempio: NRdb (Non Redundant Database) Database di acidi nucleici o proteine in cui l’informazione è stata ottimizzata in modo non ripetitivo (non ridondante). Informatica e Bioinformatica – A. A

39 Database NON RIDONDANTI : RefSeq, UniGene, Gene
Come già detto nei database primari sono inserite tutte le sequenze conosciute ottenute sperimentalmente. La stessa regione genomica o lo stesso trascritto possono essere stati sequenziati più volte. Quindi ci aspettiamo che la stessa sequenza possa essere presente più volte. Per evitare problemi di ridondanza sono stati creati dei database ‘semplificati’, senza ripetizioni di informazioni. In particolare In RefSeq sono rappresentate, in modo non ridondante, tutte le sequenze genomiche, di mRNA e di proteine. In UniGene sono rappresentate in modo non ridondante, le sequenze ottenute dal sequenziamento dei trascritti (mRNA) Gene: è un sottoinsieme di RefSeq con rappresentate solo le sequenze geniche. Informatica e Bioinformatica – A. A

40 The Reference Sequence (RefSeq) collection aims to provide a comprehensive, integrated, non-redundant, well-annotated set of sequences, including genomic DNA, transcript (RNA), and protein products. RefSeq is a foundation for medical, functional, and diversity studies; they provide a stable reference for genome annotation, gene identification and characterization, mutation and polymorphism analysis, expression studies, and comparative analyses RefSeq are derived from GenBank records but differ in that each RefSeq is a synthesis of information, not an archived unit of primary research data. Similar to a review article in the literature, a RefSeq represents the consolidation of information by a particular group at a particular time. UniGene: An Organized View of the Transcriptome. Each UniGene entry is a set of transcript sequences that appear to come from the same transcription locus (gene or expressed pseudogene), together with information on protein similarities, gene expression, cDNA clone reagents, and genomic location. Informatica e Bioinformatica – A. A

41 Gene supplies gene-specific connections in the nexus of map, sequence, expression, structure, function, citation, and homology data. Unique identifiers are assigned to genes with defining sequences, genes with known map positions, and genes inferred from phenotypic information. These gene identifiers are used throughout NCBI's databases and tracked through updates of annotation. Gene includes genomes represented by NCBI Reference Sequences (or RefSeqs) and is integrated for indexing and query and retrieval from NCBI's Entrez and E-Utilities systems. Informatica e Bioinformatica – A. A

42 Le frecce indicano il senso della trascrizione
Importante  osservare il senso della trascrizione: un gene può essere codificato dal filamento ‘senso’ (detto anche ‘+’ o ‘forward’) o dal filamento antisenso (detto anche ‘-’ o reverse) Informatica e Bioinformatica – A. A

43 Osserviamo ora il gene corrispondente (omologo) presente in uomo
Osserviamo ora il gene corrispondente (omologo) presente in uomo. Sono riportate 3 isoforme, varianti del gene, dovute a splicing alternativo dello stesso gene Esoni: sono rappresentati dalle linee più spesse Introni: sono rappresentati dalle linee più sottili Informatica e Bioinformatica – A. A

44 A causa delle numerose risorse mantenute dai diversi poli bioinformatici, si rischia non sapere esattamente quale tipo di dati vengano memorizzati in un certo database, ne’ il significato di alcune terminologie. Può essere d’aiuto la consultazione della pagina web: Informatica e Bioinformatica – A. A


Scaricare ppt "GQuery (http://www. ncbi. nlm. nih"

Presentazioni simili


Annunci Google