La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Informatica e Bioinformatica – A. A. 2013-2014 1 GQuery (http://www.ncbi.nlm.nih.gov/gquery/) è il punto di partenza per eseguire query su tutti o parte.

Presentazioni simili


Presentazione sul tema: "Informatica e Bioinformatica – A. A. 2013-2014 1 GQuery (http://www.ncbi.nlm.nih.gov/gquery/) è il punto di partenza per eseguire query su tutti o parte."— Transcript della presentazione:

1 Informatica e Bioinformatica – A. A GQuery (http://www.ncbi.nlm.nih.gov/gquery/) è il punto di partenza per eseguire query su tutti o parte dei database dell’NCBI: si basa sul sistema di interrogazione ENTREZ

2 Informatica e Bioinformatica – A. A PubMed, interrogabile tramite NCBI Entrez retrieval system, è stato sviluppato dal National Center for Biotechnology Information (NCBI) alla National Library of Medicine (NLM), ed è localizzato presso il National Institutes of Health (NIH). Entrez retrieval systemNational Center for Biotechnology Information (NCBI)National Library of Medicine (NLM)National Institutes of Health (NIH) PubMed (http://www.ncbi.nlm.nih.gov/pubmed) Possiamo risalire anche al nome per esteso di una rivista (e.g. mol cell biol) tramite il tasto Journals in NCBI Database PubMed consente l’accesso alle citazioni della letteratura biomedica e fornisce i link ad altre risorse biomolecolari di Entrez. Permette di trovare rapidamente una particolare pubblicazione di cui conosciamo ad es. il nome di un autore o un particolare termine

3 Informatica e Bioinformatica – A. A MeSH (Medical Subject Headings) È un dizionario dei sinonimi e contrari (thesaurus) ‘controllato’ da NLM (National Library of Medicine). Consiste in un insieme di termini descritti in strutture gerarchiche che permettono di effettuare ricerche a vari livelli di specificità. Le descrizioni di MeSH sono disposte sia in modo alfabetico che in modo gerarchico. Questo dizionario è utilizzato dalla NLM per indicizzare gli articoli provenienti da più di 5400 riviste biomediche e non per Medline e PubMed. Serve anche per catalogare libri, documenti, audiovisivi ecc. Ogni referenza bibliografica è associata con un insieme di elementi del dizionario MeSH che ne descrivono il contenuto.

4 Informatica e Bioinformatica – A. A Le regole di interpretazione del sistema PubMed sono: - Per ogni parola viene consultato l’indice MeSH (vocabolario con tutti i termini medici e i loro sinonimi). - Se non si trova nulla, viene consultato l’indice con tutti i giornali e le riviste, con i codici ISSN e le altre informazioni. - Se non si trova nulla, si cerca nel campo autori di tutte le entries possibili. Termini descritti in strutture gerarchiche

5 Informatica e Bioinformatica – A. A Record MEDLINE (Medical Literature Analysis and Retrieval System Online) Formato html Formato flat-file

6 Informatica e Bioinformatica – A. A Per poter effettuare complesse ricerche è necessario conoscere a fondo la struttura dei database e l’esatta denominazione dei campi ….. Ma per fortuna esistono strumenti che facilitano le ricerche …….. Tipica ‘Form’ di PubMed dell’NCBI Consente di limitare la ricerca a determinati campi Consente di salvare il risultato della vostra ricerca Consente di effettuare una ricerca più specifica

7 Informatica e Bioinformatica – A. A Esempio di ricerca in PubMed Cerchiamo il termine “adaptation”. Quanti risultati abbiamo ottenuto? Come potrei impostare la query per ottenere risultati più specifici? La ricerca può essere ritenuta soddisfacente?

8 Informatica e Bioinformatica – A. A Possiamo velocizzare la nostra ricerca imponendo dei particolari filtri Questa volta cerchiamo il termine solo nel campo “title” Adesso quanti risultati soddisfano la nostra ricerca?

9 Informatica e Bioinformatica – A. A Il menù Display setting ci permette di scegliere quali campi rendere visibili, che numero di record mostrare per pagina, modificarne l’ordine (sort by) Si possono inoltre inviare i record ottenuti via , salvarli in un file ecc ecc.

10 Informatica e Bioinformatica – A. A Raffiniamo ulteriormente la nostra ricerca introducendo gli operatori booleani Quanti risultati abbiamo trovato adesso?

11 Informatica e Bioinformatica – A. A Attenzione: se abbiamo applicato dei filtri alla ricerca, tutti i termini scritti nella query si riferiscono a quel filtro (ad esempio il campo Title) Occorre quindi esplicitare a che campo si riferisce lo specifico termine della query

12 Informatica e Bioinformatica – A. A Attenzione che in ENTREZ i filtri sono specifici del database che si sta interrogando. Filtri nel database PubMed Filtri nel database Nucleotide

13 Informatica e Bioinformatica – A. A “Advanced” Con questa opzione viene visualizzata la “storia” delle query compiute e si può inoltre restringere la ricerca, utilizzando l’opzione “Search Builder” Con gli operatori booleani si possono aggiungere altri termini di ricerca

14 Informatica e Bioinformatica – A. A Cliccando sul tasto “Search” compaiono i risultati della ricerca formulata Con Search details si può valutare come il sistema di retrieval ha interpretato e scomposto la nostra query. E con See more la corrispondenza tra la query generata e la query translation

15 Informatica e Bioinformatica – A. A Il nostro risultato contiene l’eventuale link alla rivista in cui è pubblicato e agli articoli correlati a quello cercato! Le modalità con cui si esegue una ricerca bibliografica sono di esempio per una qualsiasi ricerca testuale o query.

16 Informatica e Bioinformatica – A. A A proposito della ricerca bibliografica… … per sapere se abbiamo accesso “full text” ad una rivista

17 Informatica e Bioinformatica – A. A Sequenze di acidi nucleici ottenute da: DNA genomico Trascritti (mRNA) EST (corte sequenze di trascritti) Sequenze proteiche ottenute da: Sequenziamento diretto (degradazione di Edman) Traduzione informatica delle sequenze nucleotidiche (traduzione) Studi di espressione proteica (gel bidimensionale e spettrometria di massa) * Cristallografia e determinazione delle strutture secondarie e terziarie Principali Database biologici La maggior quantità di dati biologici presenti nei database è rappresentata da sequenze di acidi nucleici

18 Informatica e Bioinformatica – A. A Sequenze di DNA Il DNA genomico viene frammentato in regioni di più o meno piccole dimensioni. I differenti frammenti vengono poi sequenziati. Con l’assemblaggio delle sequenze ottenute da questi frammenti si ottengono le lunghe sequenze di DNA presenti nei database, che rappresentano parte di o interi cromosomi. Se si vogliono conoscere lunghe sequenze di DNA, è necessario sequenziare frammenti del DNA e poi assemblare le corte sequenze in modo che si sovrappongano tra loro Sequenze parziali Sequenza assemblata Sequenze di mRNA L’mRNA (meno stabile del DNA) deve essere preventivamente trasformato in cDNA: da una molecola di mRNA si ottiene prima una copia complementare di DNA a singolo filamento che poi viene resa a doppia elica. Si procede poi come per il DNA genomico

19 Informatica e Bioinformatica – A. A Ragioni per cui sequenziare anche l’mRNA  Per individuare i geni negli eucarioti superiori (in uomo solo l’1,5-3% del genoma è codificante). Questo permette anche di studiare le sequenze fiancheggianti e quindi la regolazione della trascrizione.  Per conoscere (tradurre la sequenza nucleotidica in sequenza proteica) e studiare informaticamente la relativa proteina.  Per conoscere varianti (splicing alternativi) dello stesso gene e quindi probabili funzioni differenti della proteina generata.  Per conoscere l’espressione genica: individuare quando (sviluppo o momento particolare) e dove (quale tessuto) un gene viene espresso.

20 Informatica e Bioinformatica – A. A Sequenze EST (Expressed Sequence Tag) Per individuare la presenza di un trascritto non serve conoscerne tutta la sequenza, ma è sufficiente che se ne identifichi una parte. Da questo presupposto sono stati sviluppati progetti di sequenziamento di corte sequenze di cDNA chiamate EST (Expressed Sequence Tag) che hanno permesso di studiare i profili trascrizionali (espressione genica in un particolare tessuto, in un particolare momento dello sviluppo, in presenza di una particolare malattia genetica). ATGAAAAAAAAATAA 5’UTR Seq. codificante 3’UTR polyA EST 5’ EST 3’ Attualmente nei database esistono più di 74 milioni di sequenze di EST di cui oltre 8 milioni relative a Homo sapiens (human) e quasi 5 milioni relative a topo

21 Informatica e Bioinformatica – A. A I database primari di acidi nucleici Cosa sono i database primari? Sono i contenitori di tutte le sequenze prodotte nel mondo e rese disponibili alla comunità scientifica. Memorizzano essenzialmente le sequenze e poche altre informazioni generiche ad esse correlate (laboratorio dove è avvenuto il sequenziamento, data di produzione, organismo, descrizione …)  ENA Europa  GenBank USA  DDBJ Giappone I tre database si aggiornano quotidianamente scambiandosi i dati ricevuti durante la giornata, in modo che sia sufficiente interrogare solo uno dei tre. Per l’interrogazione dei database ciascun gestore ha sviluppato differenti sistemi di retrivial (vi ricordate Entrez?)

22 Informatica e Bioinformatica – A. A NCBI Release attuale: 200, Febbraio 2014

23 Informatica e Bioinformatica – A. A GenBankWGS ReleaseDateBasesSequencesBasesSequences 200Feb

24 Informatica e Bioinformatica – A. A NUCLEOTIDE Generiamo quindi le nostre queries…

25 Informatica e Bioinformatica – A. A Esempio di ricerca in Nucleotide Quanti e che tipo di record vengono trovati. Nome ufficiale del gene. In questo caso siamo interessati ai trascritti…

26 Informatica e Bioinformatica – A. A ? ? ? ID per il mRNA che ci interessa.

27 Informatica e Bioinformatica – A. A Analizziamo meglio il record  LOCUS un codice  DEFINITION descrizione della sequenza  ACCESSION un codice  ORGANISM l’organismo a cui appartiene la sequenza (e tassonomia)  REFERENCE Riferimenti bibliografici a quella sequenza o chi l’ha sottomessa

28 Informatica e Bioinformatica – A. A Continua da precedente  COMMENT molto utile ma purtroppo non sempre presente  FEATURES alcune caratteristiche e link importanti, ad esempio: le coordinate cromosomiche il gene la sequenza codificante la traduzione in proteina

29 Informatica e Bioinformatica – A. A Continua da precedente … e molte altre informazioni E per concludere la sequenza nucleotidica Se non è chiara la descrizione dei campi si può utilizzare il link:

30 Informatica e Bioinformatica – A. A Questo è un record speciale in cui sono definiti i principali campi

31 Informatica e Bioinformatica – A. A Ad esempio potremmo scegliere solo alcune sequenze di Sus scrofa E’ possibile selezionare solo alcuni dei record risultanti ed effettuare delle operazioni solo su essi. Ad esempio visualizzarne la sequenza, salvarli su file.... Come già accennato, anche nel database nucleotidico si possono raffinare le ricerche tramite l’utilizzo dei “LIMITS”

32 Informatica e Bioinformatica – A. A Con “DISPLAY SETTINGS” si può impostare il formato con cui visualizzare i dati

33 Informatica e Bioinformatica – A. A IL FORMATO “FASTA”  Spesso i programmi che effettuano analisi bioinformatiche sulle sequenze richiedono che esse vengano date come input in questo formato particolare.  FASTA è un formato standard per la rappresentazione di una sequenza in formato testo. Consiste in una intestazione, di solito limitata a una linea di testo, e in una o più linee che riportano una sequenza di DNA o di amminoacidi usando l’alfabeto standard. Ecco un esempio: >37463.f1|g83244|telethonin ecc. ACGTGACTGCTACGTACGGGCGTTACGACTGCTACGACGCATGCTATGTC GTAGCAGCCGTGTACACGTGTTTATTCGTAGGGCTTCTA ‘>’ Simbolo d’inizio della riga di intestazione Sequenza Riga di intestazione Interruzione di riga L’intestazione (la prima riga del file precedente) è riconoscibile perché ha inizio con il simbolo ‘>’. Il testo che segue tale simbolo nella stessa riga può essere strutturato liberamente: di solito, la prima cosa che si trova scritta è un accession number, ossia l’identificatore della sequenza che ne permette il reperimento.

34 Informatica e Bioinformatica – A. A Una volta visualizzato un record di sequenza è pure possibile estrarne solo una parte È anche possibile visualizzarne la sequenza inversa complementare: vi ricordate cosa significa? Vediamo ora altri database…

35 Informatica e Bioinformatica – A. A

36 Informatica e Bioinformatica – A. A

37 Informatica e Bioinformatica – A. A Le mutazioni possono riflettersi in alterazioni della funzionalità della proteina da esso codificata. Questo mutazioni possono causare le cosiddette malattie genetiche. Esempio: una mutazione a carico del gene della β-globina fa sì che una particolare base del gene venga sostituita con un’altra, ciò altera il codone e nella proteina ciò si riflette nella sostituzione di un glutamato con una valina e in una ridotta funzionalità della proteina che causa una malattia genetica detta anemia a cellule falciformi. Il database OMIM cataloga le malattie genetiche e fornisce descrizioni particolareggiate delle malattie e delle possibili cause (mutazioni).

38 Informatica e Bioinformatica – A. A Problemi dei database primari di acidi nucleici   Formato dei dati (standardizzazione)  Accuratezza dei dati (terminologie improprie, errori tipografici, ecc.)  Comprensibilità  Ridondanza (immissione della stessa sequenza più volte, ma anche produzione della stessa sequenza nucleotidica più volte per motivi vari) Per queste ragioni si sono resi necessari i DATABASE COMPOSTI  Per generare il database composto si prendono i dati da più sorgenti, generalmente con formati diversi e si costruisce un nuovo database specializzato, in genere “pulito” e non ridondante. Esempio: NRdb (Non Redundant Database) Database di acidi nucleici o proteine in cui l’informazione è stata ottimizzata in modo non ripetitivo (non ridondante).

39 Informatica e Bioinformatica – A. A Database NON RIDONDANTI : RefSeq, UniGene, Gene Come già detto nei database primari sono inserite tutte le sequenze conosciute ottenute sperimentalmente. La stessa regione genomica o lo stesso trascritto possono essere stati sequenziati più volte. Quindi ci aspettiamo che la stessa sequenza possa essere presente più volte. Per evitare problemi di ridondanza sono stati creati dei database ‘semplificati’, senza ripetizioni di informazioni. In particolare In RefSeq sono rappresentate, in modo non ridondante, tutte le sequenze genomiche, di mRNA e di proteine. In UniGene sono rappresentate in modo non ridondante, le sequenze ottenute dal sequenziamento dei trascritti (mRNA) Gene : è un sottoinsieme di RefSeq con rappresentate solo le sequenze geniche.

40 Informatica e Bioinformatica – A. A The Reference Sequence (RefSeq) collection aims to provide a comprehensive, integrated, non-redundant, well-annotated set of sequences, including genomic DNA, transcript (RNA), and protein products. RefSeq is a foundation for medical, functional, and diversity studies; they provide a stable reference for genome annotation, gene identification and characterization, mutation and polymorphism analysis, expression studies, and comparative analyses RefSeq are derived from GenBank records but differ in that each RefSeq is a synthesis of information, not an archived unit of primary research data. Similar to a review article in the literature, a RefSeq represents the consolidation of information by a particular group at a particular time.GenBank UniGene: An Organized View of the Transcriptome. Each UniGene entry is a set of transcript sequences that appear to come from the same transcription locus (gene or expressed pseudogene), together with information on protein similarities, gene expression, cDNA clone reagents, and genomic location.

41 Informatica e Bioinformatica – A. A GeneGene supplies gene-specific connections in the nexus of map, sequence, expression, structure, function, citation, and homology data. Unique identifiers are assigned to genes with defining sequences, genes with known map positions, and genes inferred from phenotypic information. These gene identifiers are used throughout NCBI's databases and tracked through updates of annotation. Gene includes genomes represented by NCBI Reference Sequences (or RefSeqs) and is integrated for indexing and query and retrieval from NCBI's Entrez and E-Utilities systems.NCBI Reference SequencesEntrezE-Utilities

42 Informatica e Bioinformatica – A. A Importante  osservare il senso della trascrizione: un gene può essere codificato dal filamento ‘senso’ (detto anche ‘+’ o ‘forward’) o dal filamento antisenso (detto anche ‘-’ o reverse) Le frecce indicano il senso della trascrizione

43 Informatica e Bioinformatica – A. A Esoni: sono rappresentati dalle linee più spesse Introni: sono rappresentati dalle linee più sottili Osserviamo ora il gene corrispondente (omologo) presente in uomo. Sono riportate 3 isoforme, varianti del gene, dovute a splicing alternativo dello stesso gene

44 Informatica e Bioinformatica – A. A A causa delle numerose risorse mantenute dai diversi poli bioinformatici, si rischia non sapere esattamente quale tipo di dati vengano memorizzati in un certo database, ne’ il significato di alcune terminologie. Può essere d’aiuto la consultazione della pagina web:


Scaricare ppt "Informatica e Bioinformatica – A. A. 2013-2014 1 GQuery (http://www.ncbi.nlm.nih.gov/gquery/) è il punto di partenza per eseguire query su tutti o parte."

Presentazioni simili


Annunci Google