La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

UNIVERSITA’ DI MILANO-BICOCCA LAUREA MAGISTRALE IN BIOINFORMATICA Corso di BIOINFORMATICA: TECNICHE DI BASE Prof. Giancarlo Mauri Lezione 10 Evoluzione.

Presentazioni simili


Presentazione sul tema: "UNIVERSITA’ DI MILANO-BICOCCA LAUREA MAGISTRALE IN BIOINFORMATICA Corso di BIOINFORMATICA: TECNICHE DI BASE Prof. Giancarlo Mauri Lezione 10 Evoluzione."— Transcript della presentazione:

1 UNIVERSITA’ DI MILANO-BICOCCA LAUREA MAGISTRALE IN BIOINFORMATICA Corso di BIOINFORMATICA: TECNICHE DI BASE Prof. Giancarlo Mauri Lezione 10 Evoluzione Molecolare e Analisi Filogenetica

2 2 Introduzione Problema:  studio della storia evolutiva di un insieme di specie Struttura usata per rappresentare l’evoluzione:  albero evolutivo o filogenesi  Struttura ad albero in cui le foglie sono etichettate dalle specie esistenti, i nodi interni dalle specie progenitrici Problema:  dato un insieme di specie costruire un albero evolutivo  In genere struttura dell’albero e specie progenitrici sono incognite

3 3 Albero evolutivo AAATGTACC AAATGTGCC TAATGTGCC AAAGGTACC AAATGTACC G  T mutation A  G mutation AAATGTGCC A  T mutation

4 4 I passi 1.Allineamento 2.Modello di sostituzione 3.Costruzione dell’albero 4.Valutazione dell’albero

5 5 Allineamento Scelta delle procedure di allineamento  Dipendenza dal computer nulla, parziale o completa  Richiamo della filogenia assente, a priori o ricorsivo  Stima dei parametri di allineamento a priori, dinamica o ricorsiva  Possibile allineamento rispetto a strutture superiori  Ottimizzazione matematica statistica o non statistica Estrazione di un insieme di dati filogenetici dall’allineamento  trattamento degli indels

6 6 Modello di sostituzione Matrici di sostituzione tra basi  Simmetriche (reversibilità nel tempo) o no  Stazionarie o no Tassi di sostituzione tra siti eterogenei  Esempio: terzo codone più variabile dei primi due

7 7 Costruzione dell’albero filogenetico Metodi basati sulla distanza  L’istanza del problema è un insieme di specie e delle distanze evolutive tra esse (Matrice delle distanze)  L’obiettivo è costruire un albero che rispetti le distanze date

8 8 ACTGAACGTAACGC AATGGACGTAACGCTCTGGACGTAACGC C->T->A A->T->A Distanza genetica tra sequenze omologhe Numero di sostituzioni per sito  Sono sottostimate (sostituzioni convergenti, retromutazioni)

9 9 Unweighted Pair Group Method with Arithmetic mean (Sokal e Michener 1958) Funziona per velocità circa costanti nelle diverse linee evolutive: relazione lineare tra distanza e tempo di divergenza Usa un algorimo di clusterizzazione sequenziale iterativo  Collega le sequenze più vicine a un antenato comune  Sostituisce le due sequenze col padre  Itera la procedura fino ad avere un solo elemento (radice)

10 10 UPGMA (Sokal, Michener, 1958) Initialize  C i = {s i }, for all i. Repeat until one cluster left:  Find two clusters C i, C j with min i=1,..,n;j=1,…,n d ij =(  d pq )/|C i ||C j |, p  C i, q  C j  Define node k with i,j as children, edge weight d ij  Form cluster k, remove i,j clusters Problem of UPGMA

11 11 UPGMA - Esempio ABCABC Bd AB Cd AC d BC Dd AD d BD d CD Sia d AB il valore più piccolo; A e B vengono raggruppate e il punto di biforcazione posizionato alla distanza d AB /2

12 12 UPGMA - Esempio ABC C d (AB)C D d (AB)D d CD ove d (AB)C = (d AC +d BC ) /2 e d (AB)D = (d AD +d BD ) /2. Sia ora d (AB)C il valore più piccolo; C è raggruppata con AB con punto di biforcazione a distanza d (AB)C /2. Infine si raggruppa con D e la radice è posta a distanza d (ABC)D = [(d AD +d BD +d CD )/3] /2

13 13 UPGMA - Esempio A B C D d AB /2 d (AB)C /2 d (ABC)D /2

14 14 Neighbor Joining (Saitou, Nei, 1987) Ricostruisce l’albero senza radice che minimizza la somma delle lunghezze dei rami Neighbors: coppia di sequenze, singole o composite, connesse attraverso un singolo nodo interno A B C D E

15 15 Neighbor Joining (Saitou-Nei, 1987) Initialize:  T={sequences}, L=T Choose i,j  L such that d ij -r i -r j minimized. Rest similar to UPGMA with similar modification on edge weights to k.  Here, r i, r j are the average distances from i,j to other nodes in L – to compensate long edges.

16 16 Neighbor joining - Esempio Situazione iniziale:

17 17 Neighbor joining - Esempio Tra le n(n-1)/2 diverse coppie si cerca quella che minimizza la somma delle lunghezze dei rami nell’albero seguente:

18 18 Neighbor joining - Esempio Si itera la procedura sulla nuova stella con n-1 foglie ottenuta sostituendo ai due neighbors trovati la loro combinazione

19 19 Costruzione dell’albero filogenetico Metodi basati sulle sequenze  Istanza del problema : insieme di sequenze biologiche appartenenti a diverse specie  Output: albero evolutivo (con i nodi interni etichettati dalle sequenze progenitrici) di costo minimo  Punteggio di un arco := punteggio dell’allineamento ottimale delle sequenze associate ai nodi dell’arco  Punteggio dell’albero := somma dei punteggi degli archi  Caso particolare: la struttura dell’albero viene data. Ricerca sequenze progenitrici. Anche questo caso è difficile.

20 20 Maximum parsimony (MP - Eck, Dayhoff 66) Rasoio di Occam: La miglior spiegazione dei dati è la più semplice Si trova l’albero che spiega le differenze osservate col minor numero di sostituzioni Metodo qualitativo; determina la topologia dell’albero, non la lunghezza dei rami Molto lento. Usa branch and bound

21 21 MP Siti informativi: favoriscono alcuni alberi rispetto ad altri In generale, contengono almeno due nucleotidi ciascuno dei quali è presente in almeno due sequenze MP è molto usato per la sua semplicità; è inadeguato per sequenze nucleotidiche, attendibile come analisi preliminare per le proteine Genera molti alberi equivalenti

22 22 Maximum Likelihood (ML, Felsenstein 81) Cerca il modello evolutivo, albero compreso, che ha la massima verosimiglianza rispetto alla produzione delle sequenze osservate

23 23 Maximum Likelihood Modello di Jukes-Cantor (1969) : uguale probabilità di sostituzione (1 parametro  ) Modello di Kimura (1980) (2 parametri): diversi tassi di sostituzione (  e  ) da purina (A,G) a purina o da pirimidina (C,T,U) a pirimidina Processo molto lento, per la necessità di eseguire una ricerca esaustiva su tutti gli alberi Risultati migliori di MP nelle simulazioni

24 24 ML - Esempio 1 a 2 b 3 c 4 d    t1t1 t2t2 t3t3 t4t4 t5t5 t6t6 L =         P  (t 5 ) P  (t 6 ) P  a (t 1 ) P  b (t 2 ) P  c (t 3 ) P  d (t 4 )

25 25 ML - Esempio Problema della determinazione di P ij (t) Necessità di considerare diverse topologie e diverse lunghezze dei rami.

26 26 Metodo dei quartetti Per ogni quattro sequenze si costruisce un albero di 4 nodi (quartetto), ad esempio usando ML Si costruisce poi un grande albero formato dalla (maggior parte di) questi piccoli alberi. Questo passo è NP-difficile Un nuovo approccio: correzione dei dati

27 27 Quartetti e Correzione a b c d e a b c d a e a e b e a e b c d b c d d c a e c d correzione errore Albero originale

28 28 Il Software HyperCleaning Per meno di 30 taxa, HyperCleaning è confrontabile con fastDNAml (che usa il punteggio di maximum likehood), e si comporta meglio di NJ. Per più di 30 taxa, i metodi ML e MP puri richiedono giorni e producono risultati scadenti. HyperCleaning si comporta bene, con punteggi migliori.

29 29

30 30 Valutazione degli alberi: bootstrap (Efron 79) Data la matrice di allineamento A di N sequenze lunghe L si generano n (es, n=100) allineamenti simulati :  Per j da 1 a L, si estrae un numero casuale r tra 1 e L e si pone la j-esima colonna di A k uguale alla r-esima di A  si costruiscono gli alberi filogenetici  Si attribuisce a ogni nodo un coefficiente di significatività pari alla percentuale di simulazioni che lo supportano

31 31 Confronto tra filogenesi Tutti i metodi visti sono NP-hard E’ possibile costuire alberi approssimanti e confrontarli per ottenere un albero migliore

32 32 Problemi di confronto L’istanza dei problemi di confronto è un insieme di alberi evolutivi. Esistono vari problemi di confronto MAST MIT

33 33 MIT Maximum Isomorphic Subtree L’obiettivo è individuare un sottoalbero S’ tali che gli alberi ristretti a S’ siano tutti isomorfi. Due alberi sono isomorfi se qualunque coppia di foglie ha uguale distanza in entrambi gli alberi. Nel caso gli alberi siano pesati si ha un nuovo problema: MWT (Maximum Weighted Subtree)

34 34 MAST Maximum agreement subtree L’obiettivo del problema è individuare il massimo sottoinsieme di specie S’ per cui gli alberi ristretti all’insieme S’ sono omomorfi. Due alberi sono omomorfi se risultano isomorfi a meno di nodi di grado 1.

35 35 Complessità dei problemi di confronto I problemi di confronto sono NP-hard già su tre alberi Inoltre non sono facilmente trattabili per l’approssimazione

36 36 Software filogenetico PHYLIP PROTDIST PROTPARS DNADIST DNAML fastDNAml PAUP


Scaricare ppt "UNIVERSITA’ DI MILANO-BICOCCA LAUREA MAGISTRALE IN BIOINFORMATICA Corso di BIOINFORMATICA: TECNICHE DI BASE Prof. Giancarlo Mauri Lezione 10 Evoluzione."

Presentazioni simili


Annunci Google