La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Struttura dei geni batterici La replicazione è semiconservativa.

Presentazioni simili


Presentazione sul tema: "Struttura dei geni batterici La replicazione è semiconservativa."— Transcript della presentazione:

1

2 Struttura dei geni batterici

3

4

5

6

7 La replicazione è semiconservativa

8

9 La replicazione è semidiscontinua

10 La replicazione è bidirezionale

11

12

13 (Cairns, 1961)

14 Struttura dei geni batterici

15 RNA polimerasi

16

17 l’elica 3’-5’ del DNA funge da stampo per la sintesi dell’RNA (5’-3’) nucleotidi inseriti in base alle regole della complementarità RNA: ribosio invece del desossiribosio e U al posto di T

18

19 la sequenza “codificante” del DNA è uguale a quella del messaggero

20

21 promotori riconosciuti dal fattore sigma-70 di E. coli promotore: sequenza presente a monte di tutti i geni, riconosciuta dal fattore sigma dell’RNA polimerasi, necessaria per l’inizio della trascrizione. La sequenza è conservata

22

23 TTGACaTAtAaT lettera maiuscola = basi più conservate (presenti in quella posizione rispetto al +1 in quasi tutti i casi lettera minuscola = basi presenti in molti casi ma non sempre mutazioni “down”: diminuisce l’efficienza del promotore

24 regolazione dell’espressione genica mediante l’intervento di fattori sigma alternativi geni “heat-shock”: CCCCCC- 15/17 basi- CCCC promotore riconosciuto dal fattore sigma32 attivato solo in caso di aumento della temperatura. I geni che hanno questo promotore vengono espressi (trascritti) SOLO IN PRESENZA DI QUESTO SPECIFICO FATTORE SIGMA geni “spo” in B. subtilis sono silenti e vengono trascritti solo durante la sporulazione per la presenza di fattori sigma specificamente attivati in sporulazione

25

26 SEQUENZE PALINDROMICHE: sequenze ripetute e invertite 5’- TGCA- 3’ 3’- ACGT - 5’ lette allo stesso modo su entrambi i filamenti del DNA (nella stessa direzione) rispetto all’asse di simmetria le sequenze sono specularmente complementari

27 5’-ATCCGGAT-3’ 3’-TAGGCCTA-5’ palindrome perfetta a 8 coppie di basi palindromi perfette = siti di restrizione (endonucleasi specifiche) 5’-ATCCAAGTACGGAT-3’ PALINDROME IMPERFETTA 3’-TAGGTTCATGCCTA-5’ (terminatori della trascrizione)

28

29 Terminatore forte o rho-indipendente: -struttura secondaria stabile e forte per la presenza di molte G e C nello “stem” - sequenza di tante U al 3’ della struttura secondaria (che facilita la separazione dell’ibrido DNA/RNA)

30 Terminatore forte o rho-indipendente

31 Terminatore debole o rho-dipendente

32

33

34

35 Ordinare i seguenti promotori in base alla loro forza partendo da quello pi ù forte: a) TTAACC basi CCTAAG b) TTGACC " TATATT c) TTGACA " TATAAT d) CTGACA " CATAAT sequenza consenso: TTGACa TAtAaT

36 Indicare quale delle seguenti palindromi è imperfetta ATGCATATGCTATTACAACCCTGTAA TACGTATACGATAATGTTGGGACATT

37 Scrivere la sequenza di un ipotetico terminatore forte riportando la struttura che esso assume sull'RNA 5’- tcCACCGGCTGCCGaagtgtttaCGGCAGCCGGTGtttttttt - 3’ 3’-agGTGGCCGACGGCttcacaaatGCCGTCGGCCACaaaaa..-5’ g t t g t a t a G C C G G C T A C G G C C G A T tcC GUUUUUU

38 La sequenza sotto riportata rappresenta un terminatore della trascrizione. 1) Indicare se si tratta di un terminatore forte o debole motivando la risposta 2) riportare la struttura che tale sequenza assume una volta trascritta GAACTCTAGCCCGGCTTAGCCxxxxxxxxxGGCTAAGCCGGGCTTTATATTTT CTTGAGATCGGGCCGAATCGGxxxxxxxxxCCGATTCGGCCCGAAATATAAAA

39 Struttura dei geni batterici

40 rRNA tRNA

41

42

43

44

45 attivazione degli aminoacidi formazione dell’aminoacil-AMP

46

47 N-formil-metionil-tRNA (tRNA iniziatore nei batteri) (archea metionil-tRNA)

48 Sintesi proteica: fasi di inizio Interazione sub. minore del ribosoma con mRNA (complementarità rRNA16S e sequenza SD) Legame del tRNA iniziatore (N-formil-metionina) alla tripletta di inizio AUG legame sub. maggiore del ribosoma 50S

49 Fattori di inizio (IF-1, IF-2, IF3) GTP per fornire energia tRNA iniziatore Interazione sub minore + mRNA (16S + sequenza SD)

50 SEQUENZA DI SHINE-DALGARNO: legame con il 16S della sub. minore del ribosoma SD Tripletta di inizio AUG Sequenza codificante rRNA 16S

51

52 Ribosoma: sito A = sito “accettore” (interazione con tRNA carico) Sito “P” = formazione del legame peptidico con l’aa “nuovo” Sito “E” = sito di uscita del tRNA “scarico”

53 -Legame aa2-tRNA al sito A -Legame aa1 (sito P) con aa2 (sito A)

54 Legame peptidico tra il gruppo NH2 dell’aa “nuovo” (sito A) e il gruppo COOH dell’aa precedente (sito P). Il peptide si accresce di un aa. Il tRNA del sito P si “scarica” e si allontana (sito E).

55 Il ribosoma trasloca e il tRNA che porta la catena di aa si troverà nel sito P. Il sito A è vuoto e presenta una nuova tripletta per il legame con il corrispondente tRNA carico La traslocazione è catalizzata dall’idrolisi del GTP. La formazione del legame peptidico non richiede altra energia perche il legame tra tRNA e aa è ad alta energia

56 TERMINAZIONE DELLA SINTESI PROTEICA UAA, UGA, UAG = codoni di stop (non codificanti) RF = fattori di rilascio

57

58 Accoppiamento trascrizione- traduzione (procarioti) DNA RNA + ribosomi

59 1 prodotto gene 2 o più prodotti operone

60 operone: insieme di più sequenze codificanti controllate da un unico promotore promotore SD

61

62 Regolazione dei geni batterici a livello trascrizionale, con un controllo che può riguardare l’inizio della sintesi dell’mRNA o la terminazione precoce del processo a livello traduzionale, con meccanismi che riguardano principalmente la fase di inizio del processo

63 REPRESSORE geni regolati negativamente sito operatore espressione inducibile

64 geni regolati negativamente REPRESSORE espressione reprimibile

65 geni regolati positivamente

66

67 Esempio: l'operone lacZYA

68 ENZIMI PER L’UTILIZZO DEL LATTOSIO

69 espressione inducibile (LATTOSIO = INDUTTORE)

70 RBS REPRESSORE (LacI) REPRESSORE INATTIVO INDUTTORE (lattosio) OPERONE LAC TRASCRITTO

71 Crescita con glucosio e lattosio La presenza del glucosio inibisce l’espressione dell’operone

72 glucosio lacZYA non si esprime glucosio + lattosio lacZYA si esprime a livelli molto bassi lattosio lacZYA si esprime a livelli alti + glucosio = bassi livelli intracellulari di cAMP - glucosio = alti livelli intracellulari di cAMP la presenza di glucosio ha un effetto negativo sull'espressione di lacZYA

73

74 RBS lacZYA necessita di un attivatore = proteina CAP (o CRP) legata al cAMP

75 GLUCOSIO ASSENTE Il P destinato al glucosio attiva l’adenilato ciclasi (alti livelli di cAMP) CRP ATTIVO

76 REPRESSORE INATTIVO (+lattosio) PROTEINA CAP REPRESSORE ATTIVO (-lattosio) AMP CICLICO RNA pol. -LATTOSIO: Repressore attivo Trascrizione repressa

77 REPRESSORE INATTIVO (+lattosio) PROTEINA CAP REPRESSORE ATTIVO (-lattosio) AMP CICLICO RNA pol. +LATTOSIO -GLUCOSIO : Repressore inattivo Proteina CAP attiva Trascrizione alta (utilizzo del lattosio) cAMP alti livelli

78 REPRESSORE INATTIVO (+lattosio) PROTEINA CAP REPRESSORE attivo (-lattosio) AMP CICLICO RNA pol. +LATTOSIO + GLUCOSIO Repressore inattivo Proteina CAP inattiva Trascrizione bassa (viene usato prima tutto il glucosio) cAMP basso

79 RNA pol. P Glucosio-P cAMP + Glucosio - Glucosio EIII Adenilato ciclasi REPRESSORE INATTIVO (+lattosio) PROTEINA CAP REPRESSORE ATTIVO (-lattosio) AMP CICLICO - lattosio: REPRESSORE ATTIVO, NO TRASCRIZIONE + lattosio: REPRESSORE INATTIVO, SI TRASCRIZIONE +glucosio:NO AMPc, NO ATTIVATORE, TRASCRIZIONE BASSA (utilizzo preferenziale del glucosio) - glucosio: SI AMPc, SI ATTIVATORE, TRASCRIZIONE ALTA (utilizzo del lattosio)

80

81


Scaricare ppt "Struttura dei geni batterici La replicazione è semiconservativa."

Presentazioni simili


Annunci Google