La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Semeiotica genetica Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine.

Presentazioni simili


Presentazione sul tema: "Semeiotica genetica Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine."— Transcript della presentazione:

1 Semeiotica genetica Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine (TIGEM)

2 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAG ACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGG GCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCC CTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCG CTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTC GCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAG ACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATA GCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACA CGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCG AGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGC ACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCT CGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGC TCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCT GAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACAC GTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGA

3 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACTATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCG ACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTA GCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAG CTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCC GACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCG ACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACA GCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACA GCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACA CACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCT CGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTC CTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACA GATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCT CGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCT CGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCT CGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATA TATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAG ATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACAC CGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAG CTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTG AAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGA CCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGA 1 2 Copy Number Variation 10% of the human genome could vary in copy number

4 duplicazioni segmentali il genoma umano contiene complessivamente il 13,7% di segmenti duplicati con almeno il 90% di identità di sequenza il 5,2% del genoma contiene segmenti duplicati lunghi tra 1 e 10kb, mentre il 4,5% tra 10kb e 20kb i cromosomi più colpiti sono l’Y (50,4%) ed il 22 (11,9%), ma anche il 7, 9, 10, 15, 16, 17 e X le duplicazioni segmentali possono essere intracromosomiche o intercromosomiche con tre localizzazioni differenti: –pericentromeriche (47Mb, dupliconi originati da altri cromosomi) –subtelomeriche (ciascuna solo kb, orientate) –interstiziali (solo nella specie umana sono disseminate ad una distanza media di 3Mb)

5 Malattie autosomiche dominanti Come fanno le delezioni in uno solo dei due alleli a costituire un carattere dominante? 1.il livello dimezzato di prodotto genico è insufficiente a mantenere il fenotipo 2.il difetto eterozigote diviene omozigote a livello delle cellule dei tessuti periferici (LOH) 3.un solo allele è espresso per imprinting dell’altro

6 principali sindromi da delezione

7

8 Sindrome di DiGeorge

9 DiGeorge/velocardiofacciale La sindrome di DiGeorge del22q11.2 è la più frequente sindrome da microdelezione, con un incidenza di 1 su 4000—5000 nati La delezione comprende 3Mb ed almeno 30 geni

10 Migrating neural crest cells make a contribution to the embryonic structures affected in DiGeorge syndrome. The cartoon represents a human embryo at 4–6 weeks gestation. The migration of neural crest cells from the hindbrain to the branchial arch/pharyngeal pouch system and cardiac outflow tract is indicated by the arrows. Examples of malformations associated with perturbation of this process are listed and these overlap substantially with those seen in 22q11DS AAA, arch arteries; PDA, persistent ductus arteriosus; IAA, interrupted aortic arch.

11 DiGeorge È caratterizzata da –Anomalie cardiache –T-cell deficit –palatoschisi –anomalie facciali –Ipocalcemia Mutazioni puntiformi del gene TBX1 possono portare a questi 5 tratti fenotipici, ma non alle difficoltà nell’apprendimento che è invece frequente nella sindrome da delezione

12 Williams-Beuren prevalenza alla nascita 1/ /20.000, ma può non essere diagnosticata

13 Williams una delezione tipica

14 Williams genetica delezione “de novo” trasmissione autosomica dominante delezione di 1.6MB da 21 geni contigui in eterozigosi a 7q11.23 –gene dell’elastina –LIM kinase 1 (LIMK1) –CLIP-115 che lega i microtubuli –Fattori di trascrizione GTF2I e GTF2IRD1 –effetto posizionale su altri geni circostanti la delezione

15 Williams FISH delezione 7q11.23 rilevabile mediante FISH ma non cariotipo rilevabile mediante FISH ma non cariotipo

16 Williams comportamento lieve o medio ritardo mentale (IQ tra 41 e 80) scarsa capacità di concentrazione ritardo nell’apprendimento del linguaggio e poi esagerata loquacità personalità amichevole e affettuosa danno facilmente confidenza anche a sconosciuti ansietà, spesso preoccupati per il benessere altrui ipersensibilità ai suoni memoria visiva e uditiva spesso fuori dal comune ricordano persone, luoghi e motivi musicali predisposizione ad imparare le lingue e la musica

17 Williams aspetto e segni Faccia da elfo Occhi blu (77%) con pattern stellato dell’iride (74%) ma questo vale per i nordeuropei, strabismo (40%) Naso con la punta bulbosa bocca larga e guance piene microdontia e micrognazia Statura 10 cm in meno del normale ipercalcemia stenosi periferica delle arterie polmonari stenosi aortica sopravalvolare

18 Williams foto

19

20 Imprinting

21 Nelle cellule germinali primordiali l’imprinting viene cancellato del tutto e il DNA è demetilato Successivamente nella linea germinale maschile si determina un pattern di imprinting che in alcuni loci è complementare a quello della linea germinale femminile I cromosomi su cui avviene l’imprinting (7, 11, 15) manterranno questo pattern e lo riprodurranno ad ogni mitosi Si potranno sempre distinguere l’espressione genica del cromosoma materno e paterno

22 Disomia uniparentale Due copie dello stesso cromosoma sono ereditate dallo stesso genitore Spesso questo avviene attraverso un fenomeno transitorio di trisomia, seguito dalla perdita del cromosoma singolo e mantenimento del cromosoma doppio

23 Angelman 70% dei casi delezione della regione cromosomica 15q11-q13, che è soggetta al fenomeno dell'imprinting del cromosoma paterno Il gene materno (l'unico espresso) può essere alterato con 4 meccanismi noti: –delezione –disomia uniparentale paterna –difetti nell'imprinting –mutazioni a carico del gene UBE3A (ubiquitin ligasi) La diagnosi è clinica e il difetto genetico non si identifica nel 20% dei casi

24

25 "happy puppet syndrome" si può identificare in Cucciolo (Dopey) "addormentato", il più giovane dei nani che non ha mai imparato a parlare ritardo mentale con assenza del linguaggio, difficoltà nell'equilibrio, eccessivo buon umore Angelman

26 L'incidenza è 1/ nati crisi epilettiche e comunque alterazioni dell'EEG e microcefalia relativa Angelman

27 Prader-Willi iperfagia>obesità eccessiva assunzione di liquidi reazioni abnormi ai sedativi acromicria, criptorchidismo insensibilità al dolore, lesioni cutanee sbalzi di umore

28 Prader-Willi 1/15.000

29 Malattie genetiche da mutazione in 1 allele Le mutazioni monoalleliche possono causare disordini a trasmissione dominante o recessiva legata all’X negli uomini Se la malattia a trasmissione dominante è grave in età fertile e pertanto limita o annulla la capacità riproduttiva (bassa fitness), le mutazioni monoalleliche sono nuove e spesso distribuite in modo casuale Se la malattia dominante non è grave in età fertile e non limita in alcun modo la capacità riproduttiva (normale fitness), le mutazioni monoalleliche sono ereditate da un genitore e spesso si tramandano da molte generazioni Se la malattia è recessiva legata all’X ed è letale ha una vita media di tre generazioni, perché le donne trasmettono gli alleli mutati in eterozigosi e gli uomini li eliminano

30 eredità autosomica dominante a penetranza completa (malattia che non modifica la fitness)

31 mutazioni puntiformi missenso Le mutazioni missenso sono quelle in cui il cambiamento determina nel prodotto proteico la sostituzione di un aminoacido con un aminoacido differente Sebbene queste alterazioni generalmente non provochino conseguenze nella funzionalità della proteina (polimorfismi o varianti), ci sono casi in cui anche una minima alterazione può avere conseguenze gravi

32 CRANIO 1) plagiocefalia = asimmetria del cranio Frontale o posteriore (posturale?) Può essere isolata o sindromica craniosinostosi Analisi del cariotipo specie se i genitori sono normali Esaminare le dita delle mani e dei piedi e cercare pollici ed alluci larghi Guardare eventuali colorazioni della pelle (acanthosis nigricans)

33 CRANIO 2) Cresta metopica = prominenza al centro della fronte fino alla trigonocefalia È comunemente non patologica Craniosinostosi della sutura metopica Esposizione al valproato sodico Analisi del cariotipo specie se i genitori sono normali Esaminare le dita delle mani e dei piedi e cercare pollici ed alluci larghi Possibile delezione crom.11q o 9p

34 acrocefalosindattilia sindrome di Apert 1: alla nascita craniosinostosi, volta cranica a forma conica ipertensione endocranica ritardo mentale ipoplasia della parte centrale della faccia sindattilia delle dita delle mani e dei piedi sordità e atrofia ottica

35 acrocefalosindattilia sindrome di Apert tutti i pazienti hanno la stessa mutazione Apert (Cys755Gly) del gene human fibroblast growth factor receptor 2 (FGFR2) la mutazione è in eterozigosi de novo cromosoma 10q26 la sindrome è allelica con Crouzon e Pfeiffer

36 sindrome di Pfeiffer alcuni pazienti hanno la mutazione Pfeiffer (Cys342Arg) del gene human fibroblast growth factor receptor 2 (FGFR2) altri la mutazione Pro252Arg in FGFR1 la mutazione è in eterozigosi de novo cromosoma 10q26 la sindrome è allelica con Crouzon e Apert

37 disostosi cranio facciale sindrome di Crouzon alcuni pazienti hanno la mutazione (Cys342Tyr) del gene human fibroblast growth factor receptor 2 (FGFR2) la mutazione è in eterozigosi de novo cromosoma 10q26 la sindrome è allelica con Pfeiffer e Apert con alcune mutazioni in comune

38 CRANIO 3) Macrocefalia È comunemente non patologica, specie se condivisa in famiglia Può essere un segno di ipocondroplasia Esaminare le dita delle mani e dei piedi e cercare polidattilia (Greig) osservare la pelle X-fragile, Cowden, Neurofibromatosi

39 acondroplasia nanismo dismorfico (1:35.000) arti corti e testa sproporzionatamente più grossa fronte prominente e naso appiattito altezza media 130 cm nei maschi 125 cm nelle femmine La mutazione è in eterozigosi Gly380Arg nel recettore 3 del "fibroblast growth factor" (FGFR3) a 4p16.3 autosomico dominante a penetranza completa

40 acondroplasia La mutazione conferisce una funzione aumentata al recettore dell'FGF (allele ipermorfo) che è una tirosin- chinasi di membrana In risposta all'FGF il recettore dimerizza e si fosforila trasducendo un segnale con la funzione di rallentare la proliferazione dei condrociti e quindi la crescita ossea Topi senza il gene FGF3R hanno ossa lunghe e vertebre allungate

41

42 ipocondroplasia L'ipocondroplasia ha caratteristiche simili all'acondroplasia, ma di gravità minore con un coinvolgimento craniofacciale inferiore. L'altezza può risultare ai limiti della norma e la malattia viene spesso non diagnosticata. L'ipocondroplasia è meno omogenea: circa il 70% dei casi è dovuto alla sostituzione N540K del gene FGFR3, mentre non si conosce la mutazione nel restante 30%.

43 Circa il 2% della popolazione ha un IQ<70 (ritardo mentale) il 15-20% di tutti I ritardi mentali sono attribuibili a geni del cromosoma X Il ritardo mentale legato al cromosoma X (XLMR) è geneticamente eterogeneo con 202 loci responsabili di forme che si sovrappongono clinicamente 46 geni sono stati a tutt’oggi identificati il locus che contribuisce alla frazione maggiore causa la sindrome di Martin- Bell, oggi nota come sindrome dell’X fragile

44 X fragile ritardo mentale: IQ tra 20 e 70 deficit di memoria a breve termine di informazioni complesse ritardo nel linguaggio ridotte abilità visuo-spaziali ipersensibilità agli stimoli iperattività con deficit di attenzione comportamento autistico Macrocefalia con fronte, mento e orecchie sporgenti Macroorchidismo (<30ml) dopo la pubertà Anomalie connettivali: prolasso della mitrale, lassità articolare, piede piatto Disfunzioni ipotalamiche?

45

46 Nel 1969 Lubs osservò una costrizione (marker X) sul braccio lungo del cromosoma X in quattro maschi affetti e tre carriers obbligate della stessa famiglia

47 Il sito fragile a Xq27.3 rottura o costrizione dei cromosomi in metafase che insorge quando le cellule sono esposte ad una perturbazione della replicazione del DNA siti fragili sono su tutti i cromosomi e prendono il nome della banda cromosomica, es fra(X)(q27.3) la nomenclatura HUGO chiama questo sito FRAXA, cioè il primo sito fragile identificato sul cromosoma X

48 I II IV III Segregazione, paradosso di Sherman perché non è affetto? perché è affetta? Il 20% dei maschi che portano l’allele mutato sono normali (NTM) Il 30% delle carrier presenta ritardo mentale

49 Fragile X syndrome

50

51 CRANIO 4) Microcefalia È comunemente autosomica recessiva, ma può essere dovuta a sostanze teratogene Può essere un segno di un un disturbo generale della crescita Esaminare sindattilia (Smith-Lemli- Opitz o Filippi), ipoplasia pollici e pigmentazione cutanea (Fanconi), orecchie prominenti (Richarson-Kirk)

52 CRANIO 5) Varianti della linea di attaccatura dei capelli Ciuffo ribelle (cowlick) Escludere craniosinostosi Attaccatura frontale alta (cariotipo delezione 8q, ATRX) Attaccatura bassa e widow’s peak (displasia cranio-facciale) attaccatura posteriore bassa (Noonan o Turner) dovuta ed edema nucale prenatale

53 Monosomia X (45,X0) Turner 1:2.500 Solo l’1% delle gravidanze giunge a termine Errore nella spermatogenesi nell’ 80% dei casi e non correla con l’età dei genitori Caratteristiche principali: –mancato sviluppo ovarico con amenorrea primaria e sterilità –fenotipo molto variabile –linfedema con rigonfiamento delle mani e dei piedi – pterigio del collo

54 Monosomia X (45,X0) Turner 1:2.500 –mandibola più piccola (micrognazia) –torace largo con aumento degli spazi intercostali –attaccatura bassa delle orecchie –bassa statura –quarto metacarpo corto –cardiopatia, ipertensione e anomalie renali –sia l’intelligenza sia l’attesa di vita sono normali

55 OCCHI 6) Ipertelorismo = occhi più distanziati maggiore sviluppo relativo delle ali dello sfenoide, per cui le orbite sono più distanziate tra loro: in tal caso la radice del naso è allargata Da valutare se ci sia telecanto, cioè lo spostamento laterale del canto interno Può essere associato al “Widow’s peak” e può essere familiare e benigno Osservare la madre se presenta ipertelorismo più lieve (Opitz, ATRX) Associato alla bassa statura e a brachidattilia (Aarskog)

56 mutazioni eterozigoti di PAX3 Waardenburg

57 sordità (o deficit uditivo di vario livello) bilaterale,sordità modifiche nella pigmentazione, sia dei capelli (albinismo parziale, in genere piebaldismo) che della pelle,capellipelle anomalie nello sviluppo dei tessuti derivati dalla cresta neurale lateralizzazione del canto mediale diverso colore degli occhi (eterocromia), di solito uno marrone e l'altro blueterocromia

58 OCCHI 7) Ipotelorismo = occhi più vicini Ridotta distanza interpupillare, spesso associato a sindromi cromosomiche Da valutare se ci sia telecanto che riduce l’impressione dei ipotelorismo Può essere arrivare sino alla ciclopia, nel caso di oloprosencefalia, con mancato sviluppo del tratto olfattorio Il 40% della oloprosencefalia è dovuto alla trisomia del cromosoma 13 Escludere la sindrome di Kallmann (+ipogonadismo e anosmia) e le delezioni a Xp

59 trisomia 13 Patau (1/ nati)(1/ nati) 90% dei casi nondisgiunzione materna Giunge a termine solo il 2.5% dei concepimenti Di questi il 33% muore nel primo mese, il 50% entro 2 mesi Peso sotto la norma, difficoltà suzione Oloprosencefalia, microcefalia Cecità e sordità Occhi che possono fondersi Labiopalatoschisi 80% epilessia Malformazioni cardiache sinclinodattilia piedi a calcagno prominente

60 SOPRACCIGLIA 8) sinofri = sopracciglia che si incontrano sulla linea mediana È spesso associato ad ipotelorismo Nel bambino è un segno della sindrome di “Cornelia de Lange”, con problemi gastrointestinali, ritardo, ecc Valutare ev mucopolisaccaridosi

61 MANDIBOLA 10) Micrognazia = mandibola più piccola Si vede meglio di profilo a bocca aperta Sequenza di Pierre-Robin, con palatoschisi e spostamento posteriore della lingua per mancato sviluppo mandibolare Sindrome di Stickler, associata a miopia con distacco di retina, artropatia (dovuta a mutazioni AD di geni del collageno) Aneuplodia anche nel caso di mosaicismo

62 Monosomia X (45,X0) Turner 1:2.500 –mandibola più piccola (micrognazia) –torace largo con aumento degli spazi intercostali –attaccatura bassa delle orecchie –bassa statura –quarto metacarpo corto –cardiopatia, ipertensione e anomalie renali –sia l’intelligenza sia l’attesa di vita sono normali

63 FACCIA 11) Asimmetria facciale Un certo grado è di variazione tra i due lati è comune e nella vita in utero può essere dovuta ad oligoidramnios Eventuale craniosinostosi (Pfeiffer) Può essere dovuta ad emiiperplasia isolata e i bambini non hanno altro Valutare le orecchie e le dita esiste la sindrome asymmetric crying facies (ACFS) in cui l’asimmetria si vede al pianto Può essere una manifestazione della sindrome di Proteus, associata a abnorme crescita ossea, cutanea e muscolare, a volta con mutazioni di PTEN

64 PTEN (phosphatase and tensin homolog) un nuovo guardiano del genoma Gene di 105kb a 10q23 PTEN è una è una fosfatasi doppia (dual-specificity phosphatase) agendo –sia sugli aminoacidi, serina, treonina e tirosina –sia sui lipidi, rimuovendo il fosfato D3 dell’inositolo (fosfatidilinositolo-3-fosfato fosfatasi) ha funzioni di oncosoppressore –inibendo la via del segnale basata su AKT / PKB –mantenendo la stabilità cromosomica PTEN è perduta per mutazioni, delezioni o o silenziamento del promotore in molte neoplasie primitive e metastatiche (prostata, mammella, ovaio, esofago, pancreas, ecc)

65 un solo allele mutato di PTEN (eterozigosi) La sindrome di Cowden è ereditata in modalità autosomica dominante I pazienti presentano più amartomi e lesioni in vari organi e tessuti Cancro della mammella e/o carcinoma follicolare della tiroide Macrocefalia ed anomalie del cervelletto papule sul dorso di mani e piedi papillomatosi della mucosa orale

66 sindrome di Pfeiffer alcuni pazienti hanno la mutazione Pfeiffer (Cys342Arg) del gene human fibroblast growth factor receptor 2 (FGFR2) altri la mutazione Pro252Arg in FGFR1 la mutazione è in eterozigosi de novo cromosoma 10q26 la sindrome è allelica con Crouzon e Apert

67 FACCIA 11) Aspetto miopatico Dovuto a scarso tono muscolare con faccia che sembra più stretta e bocca aperta Può essere distrofia miotonica, con storia di polidramnios, in tal caso osservare la madre con attenzione e valutare il fenomeno miotonico al pollice Può essere una patologia muscolare mitocondriale Sindrome di Moebius, con paralisi facciale ed incapacità al movimento laterale degli occhi, per deficit dei nervi VI e VII

68 anticipazione nella distrofia miotonica

69 distrofia miotonica DM1 fenomeno “miotonico”, difficoltà al rilasciamento muscolare dopo una contrazione ipotonia al volto, non debolezza importante cataratta precoce alterazioni ritmo cardiaco disfunzione tiroidea trasmissione autosomica dominante (1/8000) forma congenita con grave ipotonia neonatale

70 OCCHIO 1) Epicanto È una plica verticale di pelle ridondante tra l’occhio ed il naso. Si origina sotto l’occhio e si estende in alto verso la palpebra. Spesso il canto mediale viene oscurato Può essere normale se è depresso il ponte nasale e scompare entro i due anni Si osserva nela s. di Down ed in altre aneuploidie Si può osservare nella s. di Williams, nella s. di Ehlers-Danlos e di Stickler associata a micrognazia, miopia con distacco di retina, artropatia (dovuta a mutazioni AD di geni del collageno)

71 OCCHIO 2) Occhi infossati Possono essere un segno di un problema generale. Il neonato apre gli occhi nei primi 2gg, se non c’è fotofobia o microlftamia. Valutare di profilo l’assenza di curvatura del globo oculare Nella s. di Freeman-Sheldon si associa a camptodattilia Nella s. di Lowe (X-linked) al ritardo mentale, tubulopatia ed aminoaciduria: mutazioni del gene OCRL che regola la formazione dell’actina nelle giunzioni della lente e dei tubuli prossimali Delezioni di 1p36, con obesità, ispessimento dell’elice con asimmetria

72 OCCHIO 3) Proptosi Protrusione del globo oculare È un segno associato alla s. di Crouzon se non c’è alterazione delle dita, altrimenti altre craniosinostosi come Pfeiffer (alluci e pollici larghi) ed Apert (con sindattilia) Ehlers-Danlos, con alterazioni cutanee, iperlassità articolare, dovuta a mutazioni del gene lisil idrossilasi Unilaterale, neurofibromatosi tipo I

73 acrocefalosindattilia sindrome di Apert 1: alla nascita craniosinostosi, volta cranica a forma conica ipertensione endocranica ritardo mentale ipoplasia della parte centrale della faccia sindattilia delle dita delle mani e dei piedi sordità e atrofia ottica

74 acrocefalosindattilia sindrome di Apert tutti i pazienti hanno la stessa mutazione Apert (Cys755Gly) del gene human fibroblast growth factor receptor 2 (FGFR2) la mutazione è in eterozigosi de novo cromosoma 10q26 la sindrome è allelica con Crouzon e Pfeiffer

75 sindrome di Pfeiffer alcuni pazienti hanno la mutazione Pfeiffer (Cys342Arg) del gene human fibroblast growth factor receptor 2 (FGFR2) altri la mutazione Pro252Arg in FGFR1 la mutazione è in eterozigosi de novo cromosoma 10q26 la sindrome è allelica con Crouzon e Apert

76 disostosi cranio facciale sindrome di Crouzon alcuni pazienti hanno la mutazione (Cys342Tyr) del gene human fibroblast growth factor receptor 2 (FGFR2) la mutazione è in eterozigosi de novo cromosoma 10q26 la sindrome è allelica con Pfeiffer e Apert con alcune mutazioni in comune

77 OCCHIO 4) Sclere blu La sclera blu è normale sino ad 1 anno di età, dopo può essere importante È un segno associato alla osteogenesi imperfetta, con fratture e ritardo della dentizione Ehlers-Danlos, con alterazioni cutanee, iperlassità articolare, dovuta a mutazioni del gene lisil idrossilasi sindrome di Marfan, dovuta a mutazioni della fibrillina FBNI con aracnodattilia, apparenza magra Bambino molto piccolo alla nascita: Silver Russell

78 OCCHIO 5) Coloboma dell’iride Fissurazione dell’iride (tipo occhi di gatto) associato a coloboma della retina da cui deriva embriologicamente CHARGE: coloboma, heart, atresia choana, retardation, genital, ear malfomation con mutazioni di CDH7 (chromodomain helicase DNA binding protein 7) Wolf-Hirschhorn: ipertelorismo, con delezione 4p Neurofibromatosi I

79 OCCHIO 6) Occhi a mandorla La lunghezza della fessura palpebrale è diminuita È un segno associato alla sindome di Prader-Willi, con ipotonia neonatale, acromicrìa ed obesità dopo i 6 anni Delezioni di 1p36, con obesità, ispessimento dell’elice con asimmetria

80 Wolf-Hirschhorn delezione a 4p16.3

81 Wolf-Hirschhorn Scarso accrescimento Ritardo mentale, ipotonia Labbro leporino Conformazione ad elmo di guerriero greco

82 OCCHIO 7) microftalmia/anoftalmia Occhi piccoli in modo abnorme, infossati e con palpebre strette Occhi assenti TORCH, alcol e warfarin Nella s. di Lowe (X-linked) al ritardo mentale, tubulopatia ed aminoaciduria: mutazioni del gene OCRL che regola la formazione dell’actina nelle giunzioni della lente e dei tubuli prossimali Sindrome oculo dento digitale, con ipotelorismo, sindattilia cutanea

83 ORECCHIO elice antelice trago lobo L’architettura dell’orecchio esterno è soggetto a grande variabilità. Molte varianti non hanno alcun significato patologico

84 Orecchio 1) Posizionate in basso Sono uno dei segni più aspecifici e spesso fonte di confusione. La radice dell’elice passa sotto una linea orizzontale immaginaria che unisce i canti laterali Sindrome di Noonan con bassa statura, dismorfismo facciale, malformazioni cardiache, deformità del torace e pterigio: mutazioni di PTPN11 crom. 12q24.1 Nella s. di Rubinstein-Taybi, delez 16p, con ritardo mentale pollici larghi, orecchie malformate

85 Orecchio 2) Varianti del lobo Lobo fissurato sindrome di Beckwith- Wiedemann, con macroglossia, visceromegalia, ipoglicemia neonatale e delezioni a 11p15 Lobo assente Ehlers-Danlos, con alterazioni cutanee, iperlassità articolare, dovuta a mutazioni del gene lisil idrossilasi Lobo molto più grande sindrome di Kabuki, con obesità, ipotonia, problemi cardiaci, s. di Costello Lobo rivolto verso l’alto Mowat-Wilson, con Hirschsprung, epilessia, microcefalia, malattia cardiaca congenita da delezioni del gene Zinc finger E-box binding homeobox 2

86 Mano 1) Polidattilia post-assiale E’ presente un dito in più sul lato ulnare della mano. Può essere piccolo e sottile ed essere costituito da una proiezione di tessuto tra le articolazioni metacarpofalangee e interfalangee prossimali Patau (trisomia 13) con palatoschisi e/o soffi cardiaci Bardet-Biedl (BBS) con obesità al primo anno di vita, ipogenitalismo e poi distrofia retinica dopo i 10 anni

87 Mano 2) Polidattilia pre-assiale Duplicazione completa o parziale di un pollice normale. Si può vedere un secondo pollice adiacente. Se la duplicazione è limitata alla falange ditale, si può vedre un’unica larga unghia. Esaminare anche i piedi Effetti di sostane teratogene e diabete materno Sindrome di Robinow con ipertelorismo, palatoschisi Sindrome di Towness-Brocks (TBS) con malformazioni anali, alterazioni auricolari, insufficienza renale e mutazioni del gene SALL1 (Sal-like 1, zinc finger)

88 Mano 3) Sindattilia Fusione tra le dita che può essere ossea o coinvolgere solo la pelle tra le dita Sindrome di Apert (FGFR2) Sindattilia cutanea può essere dovuta a triploidia o mosaicismo con triploidia Sindrome di Timothy con allungamento del tratto QT per mutazioni del gene CACNA1C

89 Mano 4) Clinodattilia Deflessione mediale o laterale di una o più dita. In genere mediale del V dito. Osservare le giunzioni interfalangee che curvano l’una verso l’altra Sindrome di Down nel 60% dei casi Duplicazioni e delezioni cromosomiche varie Sindrome di Silver-Russel con basso peso e lunghezza, ma normale circonferenza cranica (disomia 7 o ipometilazione a 11p15)

90 Mano 5) aracnodattilia Dita più lunghe e sottili Sindrome di Marfan FBN1 Sindrome di Beals FBN2, con camptodattilia e contratture, appiattimento dell’elice

91 Mano 6) camptodattilia Dita in posizione flessa ad una o più articolazioni. E’ spesso coinvolto il V dito e l’articolazione interfalangea Sindrome di Beals FBN2, con camptodattilia e contratture, appiattimento dell’elice Sindrome miastenica materna

92 Mano 7) brachidattilia Dita più corte. L’accorciamento è in genere falangeo e si associa a clinodattilia Sostanze teratogene come alcool e fenitoina Sindrome di de Lange Sindrome di Robinow con ipertelorismo, spostamento dell’ombelico verso lo sterno e mutazioni del gene ROR2 Sindrome di Aarskog Brachidattilia familiare

93 Mano 8) Dita gonfie Dita più piene, segno che può confondere Coffin-Lowry che è un ritardo mentale legato all’X con ipotonia, ipertelorismo e pienezza delle labbra e mutazioni del gene RSK2. Le dita non sono doloranti

94 Mano 9) Dita sovrapposte Evidente sovrapposizione con la camptodattilia Trisomia 13 e trisomia 18 Beals sindrome con mutazioni FBN2

95 Mano 10) Ectrodattilia Mancanza delle dita centrali che si estende al metacarpo Ectrodattilia, displasia ectodermica e palatoschisi EEC sindrome con pelle secca, ipercheratosi, ipodontia, iride blu e fotofobia ed eredità autosomica dominante da mutazioni di p63

96 Mano 11) Pollici larghi Il pollice presenta un aspetto allargato Sindrome di Rubinstein-Taybi con microcefalia alluce largo fessure palbebrali che vanno verso il basso Pfeiffer Apert Brachidattilia autosomica dominante

97 Progeria Hutchinson-Gilford invecchiamento precoce bassa statura, pelle rugosa calvizie, assenza di tessuto adiposo aterosclerosi ed infarto

98 Progeria Hutchinson-Gilford nuova mutazione in eterozigosi del gene lamina A la mutazione è in eterozigosi de novo cromosoma 1q23 La mutazione non cambia l'aminoacido glicina G608G, ma introduce un sito donor di splicing GGT che fa perdere 50 aminoacidi alla proteina sperimentazione con inibitori di farnesil-trasferasi


Scaricare ppt "Semeiotica genetica Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine."

Presentazioni simili


Annunci Google