La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

INVASIONE DI IBRIDI DI TAMERICI NEGLI USA: STUDI GENETICI E CONSIDERAZIONI ECOLOGICHE Corso di Valutazione Rischio Ambientale Studente: Sara Zanardi Biotecnologie.

Presentazioni simili

Presentazione sul tema: "INVASIONE DI IBRIDI DI TAMERICI NEGLI USA: STUDI GENETICI E CONSIDERAZIONI ECOLOGICHE Corso di Valutazione Rischio Ambientale Studente: Sara Zanardi Biotecnologie."— Transcript della presentazione:

1 INVASIONE DI IBRIDI DI TAMERICI NEGLI USA: STUDI GENETICI E CONSIDERAZIONI ECOLOGICHE Corso di Valutazione Rischio Ambientale Studente: Sara Zanardi Biotecnologie Industriali

2 CARATTERISTICHE DESCRITTIVE TASSONOMIA Famiglia: Tamaricaceae Genere: Tamarix Specie: circa 54 (Cina, Mongolia, Korea, Tibet, India, sud Europa) T.ramosissima (Cina, Mongolia, Korea, Tibet, India, sud Europa) (Cina Mongolia Giappone) T.chinensis (Cina Mongolia Giappone) T.parviflora, gallica, aphylla


4 Negli USA le tamerici sono comparse circa 200 anni fa, ma solo agli metà del ‘900 ci si accorse del loro potere invasivo Negli USA le tamerici sono comparse circa 200 anni fa, ma solo agli metà del ‘900 ci si accorse del loro potere invasivo Presenti nel Gran Canyon National Park, lungo le rive dei fiumi Rio Grande e Colorado Presenti nel Gran Canyon National Park, lungo le rive dei fiumi Rio Grande e Colorado

5 DESCRIZIONE MORFOLOGICA Le tamerici sono arbusti con rami sottili e foglie squamiformi; la lamina fogliare è estremamente ridotta al fine di limitare perdite d’acqua (ADATTAMENTI XEROFITICI)

6 I fiori, ermafroditi, sono di colore rosa/bianco, riuniti in densi racemi; sono presenti tutto l’anno, soprattutto tra Aprile e Agosto I fiori, ermafroditi, sono di colore rosa/bianco, riuniti in densi racemi; sono presenti tutto l’anno, soprattutto tra Aprile e Agosto

7 Ambienti umidi o salmastri, nelle zone ripariali, costiere, ai bordi dei fiumi, sulle rive dei laghi (SALTCEDAR) Ambienti umidi o salmastri, nelle zone ripariali, costiere, ai bordi dei fiumi, sulle rive dei laghi (SALTCEDAR) Facoltativa freatofita Facoltativa freatofita Tollera inondazioni, stress salini e termici Tollera inondazioni, stress salini e termici HABITAT


9 CARATTERISTICHE DELLE TAMERICI SEMI PROTEZIONE: produce capsule ovali nelle quali racchiude i semi QUANTITA’: 2.5 x 10 8 l’anno, 500.000 a stagione LEGGERISSIMI: 1 x 10 -5 g DIFFUSIONE FACILITATA: provvisti di un estroflessione all’estremità apicale di 2 mm RESISTENZA: riescono a sopravvivere durante l’inverno GERMINAZIONE IN 24 h


11 CARATTERISTICHE DELL’AMBIENTE INVASO Le altre piante non riescono a raggiungere le falde in profondità e non tollerano alte concentrazioni saline Le altre piante non riescono a raggiungere le falde in profondità e non tollerano alte concentrazioni saline Basso tasso di predazione (erbivoria) Basso tasso di predazione (erbivoria)

12 AZIONE DELL’UOMO Utilizzata come pianta ornamentale o per proteggere le rive dall’erosione Utilizzata come pianta ornamentale o per proteggere le rive dall’erosione Costruzione dighe Costruzione dighe Conversione delle foreste ripariali native in terreni per l’agricoltura Conversione delle foreste ripariali native in terreni per l’agricoltura Creazione di aree ricche di sedimenti, sabbia, ideali substrati per la loro colonizzazione Creazione di aree ricche di sedimenti, sabbia, ideali substrati per la loro colonizzazione CAMBIAMENTO DEI NATURALI PROCESSI IDROLOGICI

13 CONSEGUENZE DELL’INVASIONE Danni economici Danni economici 1. 137 MILIARDI $l’anno, solo negli USA (agricoltura, specie protette) 2. Perdite di 6 milioni di dollari l’anno, nello stato dell’Oregon 3. Perdite di 42 milioni di dollari l’anno, nel nord e sud Dakota e Montana

14 1. Sostituisce e allontana le specie autoctone che occupano habitat simili (PIOPPO, SALICE, MESQUITE) 2. Aumenta la salinità del terreno rendendolo inadatto alla crescita di altre piante 3. Rende l’habitat di basso valore naturalistico 4. Aumenta la deposizione di sedimento 5. Aumenta l’incidenza di alluvioni 6. Riduce la popolazione di macroinvertebrati acquatici DANNI ECOLOGICI

15 POSSIBILI SOLUZIONI UTLIZZO DI PESTICIDI-ERBICIDI Applicare IMAZAPYR e GLIFOSATO sulle foglie Applicare IMAZAPYR e GLIFOSATO sulle foglie Tagliare il fusto, sradicare con bulldozer o incendiare per poi spruzzare l’erbicida Tagliare il fusto, sradicare con bulldozer o incendiare per poi spruzzare l’erbicida SCELTA EFFETTUATA IN BASE ALL’ESTENSIONE DELL’AREA INTERESSATA E IN BASE ALL’INTERESSE DELLA VEGETAZIONE PRESENTE NELLA MEDESIMA ZONA

16 Ricerche del Dipartimento dell’Agricoltura degli Stati Uniti d’America CONTROLLO BIOLOGICO Nel 1989 selezionano, come migliore candidato per controllo biologico, lo scarafaggio cinese Diorhabda elongata deserticola Nel 1989 selezionano, come migliore candidato per controllo biologico, lo scarafaggio cinese Diorhabda elongata deserticola VANTAGGI:maggiore specificità di target (specie specifico), non nocivo, ampio range geografico, adattabile agli USA

17 E’ stato fatto uno studio per rilevare se Diorhabda apportasse conseguenze anche ad altre piante come Myricaria, Franckenia. E’ stato fatto uno studio per rilevare se Diorhabda apportasse conseguenze anche ad altre piante come Myricaria, Franckenia. E’ stato visto che le larve che hanno completato il proprio ciclo vitale hanno attaccato: 1. 1. nel 67% Tamerix 2. Nel 12 % Mycaria 3. Nell’1.6% Frankenia (2001, DeLoack et all.)

18 “HIBRID TAMARIX WIDESPREAD IN U.S. INVASION AND UNDETECTED IN NATIVE ASIAN RANGE” isolate L’introduzione di una specie in una nuova regione può mettere a contatto specie che prima erano geograficamente isolate Nuove opportunità di incrocio: ibridazione Formazione di nuovi genotipi (NEW HYBRID TAXA) con alta fitness nell’habitat invaso e perdita di suscettibilità verso i predatori dei genotipi parentali

19 Obiettivi 1. 1. Capire l’identità e l’origine delle popolazioni invasive 2. 2. Individuare il numero di genotipi e aplotipi di tamerici che sono presenti negli USA 3. 3.Costruire “genealogie geniche” che dimostrino le relazioni mutazionali degli alleli esistenti AL FINE DI PROGETTARE STRATEGIE EFFICACI E SPECIFICHE PER IL CONTROLLO DELL’INVASIONE

20 FENOTIPO: Le diversità morfologiche tra specie spesso non sono sufficienti per la loro certa identificazione tassonomica FENOTIPO: Le diversità morfologiche tra specie spesso non sono sufficienti per la loro certa identificazione tassonomica GENE LEVEL: E’ nata l’esigenza di affrontare l’invasione dal punto di vista genetico-molecolare ( R. J.Petit, 2004) GENE LEVEL: E’ nata l’esigenza di affrontare l’invasione dal punto di vista genetico-molecolare ( R. J.Petit, 2004)

21 Purtroppo la bassa quantità di popolazioni di piante invasive studiate, gli scarsi livelli di ibridazione dei markers, tempi lunghi e i costi hanno portato ad abbandonare queste tecniche ANALISI MOLECOLARI DEI GENOMI DI PIANTE AUTOCTONE E INVASIVE Alloenzimi, RAPSs e AFLPs Alloenzimi, RAPSs e AFLPs

22 MATERIALI E METODI  Campioni: 269, di cui 155 provenienti da popolazioni dell’ovest degli USA e (1-8 individui per popolazione)  Campioni: 269, di cui 155 provenienti da popolazioni dell’ovest degli USA e 114 da popolazioni native in Eurasia (1-8 individui per popolazione)   Primer disegnati usando sequenze codificanti da piante coltivate dell’ordine Caryophillales (es. spinaci, garofano) PPCL1  5’ GTCCCTAAGTTTCTGCGTCG 3’ PPCL2  5’ CTTCAGGTGTTACTCTTGGG 3’   Amplificazione del 4°introne del gene nucleare fosfoenolpiruvato carbossilasi PepC

23  CONDIZIONI DI PCR: 2’ 95°C - 30 cicli; 1’ 95°C; 1’ 50°C; 2’ 72°C ; 5’ 32°C Purificazione prodotti e elettroforesi in gel d’agarosio Sequenziamento in due direzioni Clonazione alleli PepC da una varietà di individui eterozigoti e loro sequenziamento Digestione con EcoRI e HindIII per determinare il numero di copie del 4° introne di PepC nel genoma Southern-blot e ibridazione usando frammenti marcati del 4° introne di PepC.

24 RISULTATI Regione del DNA sequenziata è lunga circa 900 basi e contiene 144 siti variabili nelle specie analizzate 57% degli individui analizzati sono eterozigoti, e gli alleli di 30 individui eterozigoti clonati combaciano in tutti i casi L’analisi Southern dell’introne PepC ha mostrato solo un singolo frammento per entrambe le specie, perché è in singola o basso numero di copie 58 aplotipi in totale trovati nei 269 individui (538 alleli) Tutte le popolazioni, eccetto uno in Cina, avevano più di 1 aplotipo rappresentato, e qualcuna aveva fino a 11 differenti aplotipi in 6 piante. Usati gli aplotipi per costruire la genealogia e le relazioni mutazionali tra gli aplotipi.


26 12 dei 58 aplotipi USA (20,6%) comparabili con i 50 aplotipi Eurasia (86,2%) 4 aplotipi sia in Eurasia che USA (6,9%) 8 aplotipi solo in USA Trovato un totale di 80 combinazioni genotipiche di cui: 56 (70%) esclusive dell’Eurasia 20 (25%) esclusive degli USA 4 (5%) comuni a entrambi i territori.


28 I livelli di eterozigosi variano intrinsecamente tra le 2 specie nelle aree native Rilevate 54 diverse combinazioni genotipiche per 81 specie di T. ramosissima in Asia, di cui il 76,3% è eterozigote; 2 genotipi in 29 specie di T. chinensis in Asia e solo il 6,6% è eterozigote Questi dati rispecchiano le osservazioni fatte nel 19° secolo sul fatto che T. chienensis in Cina era coltivata estensivamente e si trovava raramente selvatica Nell’area Euroasiatica le combinazioni genotipiche più comuni sono 1/1 e 2/2 ed appartengono rispettivamente a T. ramosissima e T. chinensis; e negli USA questi genotipi sono i 2° e 3° più comuni. Negli USA il più comune è 1/2 (ibrido T. ramosissima e T.chinensis), non riscontrato in Eurasia

29 In Asia non sono conosciute barriere fisiche tra le due specie e negli USA hanno trovato i 2 genotipi (1/1) e (2/2), entrambi in 5 popolazioni che crescevano a 2 m di distanza Aplotipo 12 è il 3° più comune negli USA e differisce dall’aplotipo 1 per 14 mutazioni. Trovato solo in una pianta omozigote in Eurasia (12/12) in Azerbaijan Genotipo 2/12 trovato solo negli USA, può essere un altro nuovo ibrido (molto raro) i cui nativi provengono da 2 aree diverse (Cina e Azerbaijan) Aplotipo 7 è l’unico comune in Eurasia e USA Differisce dall’1 per 15 mutazioni ed è stato trovato solo in una popolazione negli Usa (Idaho) e in 3 Eurasia (Georgia, Turkmenistan, Kazakstan). C’è una piccola regione nativa in cui sono stati rilevati tutti gli aplotipi di T. ramosissima (Georgia e Azerbaijan).


31 E’stato possibile solo in parte identificare le aree native dei genotipi invasivi che hanno avuto applicazioni pratiche del controllo biologico, perché era necessario un maggior numero di campioni. Aplotipi 51, 53 e 55 trovati negli USA per T.ramosissima e T. chinensis derivano da altre specie invasive (T. Gallica e T. parviflora) che sono native del mediterraneo (ovest). Sono geneticamente distanti dall’aplotipo 1 e sono stati trovati negli USA in combinazione con gli aplotipi più comuni 1 e 2. Questo è stato reso possibile dagli spostamenti e dalle coltivazioni degli uomini che hanno avvicinato le specie. Aplotipi 50, 54, 56 e 57 trovati negli USA sono distanti geneticamente dall’aplotipo 1 di T. ramosissima. Si sono originati da altre specie perché non sono stati rilevati nell’area nativa di T. ramosissima e T. chinensis.

32 Trovata un scarsissima presenza di ibridi nelle regioni native Euro-asiatiche e al contrario un’estesa ibridazione tra le 2 specie invasive T. ramosissima e T. chinensis Il genotipo più comune è 1/2, che rappresenta un ibrido T. chinensis X T. ramosissima Una minore presenza di ibridi è rappresentata dalle combinazioni di T. ramosissima e T. chinensis con T. parviflora e T. gallica. Il controllo biologico ha mostrato alti livelli di specificità per l’ospite, come risultati di molti anni di evoluzione. CONCLUSIONI

33 Gli ibridi, dopo 200 anni di evoluzione, non hanno ancora mostrato specificità genotipica di predatori; per questo è stato proposto un controllo utilizzando gli insetti specifici per le specie native. Purtroppo però la presenza di nuovi ibridi può aver influenzato i risultati. L’analisi di sequenze altamente variabili del DNA ha consentito di capire la diversità, la distribuzione e le relazioni mutazionali nelle regioni native e in quelle invase e ha reso possibile ottenere informazioni sull’origine e la storia delle recenti invasioni di T. ramosissima e T. chinensis.

34 La continua introduzione di specie alloctone negli ambienti porta col tempo alla formazione di nuovi genotipi, all’alterazione genotipica delle popolazioni e quindi alla distruzione/perturbazione degli ecosistemi naturali originari.

35 SPUNTI PER LA DISCUSSIONE Il cambiamento del patrimono genetico, la formazione di ibridi è sempre un problema? Dato che la biodiversità è minacciata: è possibile arginare un’invasione? Vale la pena mantenere in una banca del germoplasma il genoma delle specie native di ogni area a rischio? E’ necessaria una regolamentazione?e per le strategie di controllo? Una pianta che subisce riarrangiamento genico “naturale” è equivalente ad una pianta OGM?

36 CONSIDERAZIONI BIOTECNOLOGICHE Studiare il patrimonio genetico delle tamerici(cercando i geni responsabili delle caratteristiche peculiari delle tamerici, che la rendono invasiva es.gene della dormienza,gene per la germinazione immediata, produzione massiccia di semi) per avere informazioni di base per applicazioni biotecnologiche(trasferimento in altre piante per aumento della produttività?miglioramento genetico piante agrarie) Studiare il patrimonio genetico delle tamerici(cercando i geni responsabili delle caratteristiche peculiari delle tamerici, che la rendono invasiva es.gene della dormienza,gene per la germinazione immediata, produzione massiccia di semi) per avere informazioni di base per applicazioni biotecnologiche(trasferimento in altre piante per aumento della produttività?miglioramento genetico piante agrarie) Si può controllare in modo genetico l’invasività? Si può controllare in modo genetico l’invasività? Bloccare certi geni: ma come si fa a trasformare tutte le tamerici?capovolgimento dello scopo di sempre(per le altre piante si vorrebbe che il transgene non si diffondesse mentre qua si vorrebbe che si trasformassero tutte le tamerici!!)

37 LA PIOGGIA NEL PINETO GABRIELE D’ANNUNZIO Taci. Su le soglie del bosco non odo parole che dici umane; ma odo parole più nuove che parlano gocciole e foglie lontane. Ascolta. Piove dalle nuvole sparse. Piove su le tamerici salmastre ed arse, piove su i pini scagliosi ed irti, piove sui mirti divini, su le ginestre fulgenti di fiori accolti, su i ginepri folti di coccole aulenti, piove su i nostri volti silvani, piove su le nostre mani ignude, su i nostri vestimenti leggieri, su i freschi pensieri che l'anima schiude novella, su la favola bella che ieri t'illuse, che oggi m'illude, o Ermione…. …C’E’ CHI NON HA MAI CONSIDERATO LE TAMERICI UNA PIANTA INVASIVA, MA SOLO UN ARBUSTO CHE DECORA IL PAESAGGIO…

Scaricare ppt "INVASIONE DI IBRIDI DI TAMERICI NEGLI USA: STUDI GENETICI E CONSIDERAZIONI ECOLOGICHE Corso di Valutazione Rischio Ambientale Studente: Sara Zanardi Biotecnologie."

Presentazioni simili

Annunci Google