La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

ALESSANDRA ANDREONI Universita degli Studi dellInsubria Dipartimento di Fisica e Matematica Via Valleggio, 11 – 22100 Como (Italy)

Presentazioni simili


Presentazione sul tema: "ALESSANDRA ANDREONI Universita degli Studi dellInsubria Dipartimento di Fisica e Matematica Via Valleggio, 11 – 22100 Como (Italy)"— Transcript della presentazione:

1 ALESSANDRA ANDREONI Universita degli Studi dellInsubria Dipartimento di Fisica e Matematica Via Valleggio, 11 – Como (Italy) Tecniche laser per la diagnosi delle malattie genetiche Luca Nardo PhD Maria Bondani C.N.R. ROBERTO ACCOLLA Giovanna TosiR.U. VARESE COMO

2 Sequenziamento Significato e funzioni delle sequenze di basi Trattare in modo più specifico patologie fino a oggi aggredite sulla base di bersagli molecolari già noti ma non sufficientemente selettivi Affrontare patologie che attualmente hanno scarsi presidi terapeutici Diagnosticare preventivamente linsorgenza di malattie genetiche.

3 Como Milan MICRO- -FLUOROMETRIA SUB-CELLULARE LOCALIZZAZIONE INTRACELLULARE DI FARMACI FLUORESCENTI FOTO- -ATTIVAZIONE DI FARMACI ANTITUMORALI ANTRACICLINE: FOTO- -ATTIVAZIONE E SITI DI LEGAME INTERAZIONE FARMACI-DNA: MECCANISMI DI LEGAME Naples

4 MICRO- -FLUOROMETRIA SUB-CELLULARE LOCALIZZAZIONE INTRACELLULARE DI FARMACI FLUORESCENTI MICRO-IMMAGINI AD ALTISSIMA RISOLUZIONE SPAZIALE FOCALIZZAZIONE DELLECCITAZIONE SELEZIONE DEL COLORANTE O FARMACO DA ECCITARE NEL MICRO-SPOT SCELTA exc IMPULSI ULTRA-BREVI

5 FOTONE DI FLUORESCENZA ALTRA VIA NON- RADIATIVA E DETERMINATO DALLA PROBABILITA DI DECADERE EMETTENDO UN FOTONE DI FLUORESCENZA RISPETTO A QUELLA DI DECADERE LIBERANDOSI DELLENERGIA DI ECCITAZIONE PER ALTRA VIA NON- RADIATIVA FOTONEDIFLUORESCENZA ALTRA VIA NON-RADIATIVA

6 ALTRE VIE DI DECADIMENTO NON-RADIATIVE FOTONI DI FLUORESCENZA QUANTO PIU NUMEROSE (ED EFFICIENTI) SONO LE ALTRE VIE DI DECADIMENTO NON-RADIATIVE TANTO PIU BREVE E IL TEMPO DI VITA IN STATO ECCITATO E QUANTO PIU CORTO E LIMPULSO FORMATO DAI FOTONI DI FLUORESCENZA DECADIMENTI NON-RADIATIVI I DECADIMENTI NON-RADIATIVI AVVENGONO PER INTERAZIONI DELLA MOLECOLA DI COLORANTE/FARMACO CON LENVIRONMENT FOTONI DI FLUORESCENZA MISURA RISOLTA IN TEMPO DELLIMPULSO FORMATO DAI FOTONI DI FLUORESCENZA ECCITAZIONE CON IMPULSI ULTRA-BREVI CARATTERIZZAZIONE DELLE INTERAZIONI DEL COLORANTE/FARMACO CON LENVIRONMENT

7 DECADIMENTO NON-RADIATIVO UN PARTICOLARE MECCANISMO DI DECADIMENTO NON-RADIATIVO IL FLUOROFORO ECCITATO DAL LASER VIENE FATTO INTERAGIRE CON UNALTRA MOLECOLA SPECIFICA D A D A A D Fluoroforo (DONOR) eccitato dal laser Acceptor (A) del FRET Struttura rigida tra D ed A DISECCITA NON-RADIATIVAMENTE QUANTO PIU GLI E VICINO GrandeLento PiccolaVeloce IMPULSO DI FLUORESCENZA: DISTANZA D/A:

8 INTERAZIONE FARMACI-DNA: MECCANISMI DI LEGAME Minor groove binders Intercalators Entrambi impediscono la replica del tratto di DNA, ma gli intercalanti provocano errori nella replica delle sequenze adiacenti (mutazioni).

9 Minor groove binders Intercalators PORTANO IL DNA AD ASSUMERE DIVERSE CONFIGURAZIONI? A TTAAAAAAAAAAAAATTTTTTTTAT ATTTTTTTTTTTTTAAAAAAAAATA D CGCGGGGGGGGGGCCGGGGGGGGGG D GCGCCCCCCCCCCGGCCCCCCCCCC A Frammenti di DNA a doppia elica: singole eliche della sequenza desiderata sonde di DNA con le sequenze complementari (A e T, C e G) D ed A per FRET attaccati agli estremi della sonda DNA-ligand binding modes TAMRA BHQ2 BIMGB Intercalator Minor groove binder Si aggiunge un Intercalator od un Minor groove binder Si cerca un effetto sulla distanza D-A studiando landamento temporale dellimpulso di fluorescenza emesso da D (TAMRA).

10 Minor groove binder RISULTATI PER DOSI CRESCENTI DI: BIMGB Minor groove binder Minor groove binder avvicina A a D DNA BENDING: la doppia elica si piega Intercalator Intercalator allontana A da D DNA STRETCHING: le doppie basi si allontanano luna dallaltra TAMRA BHQ2 Durata dellimpulsodi fluorescenza Quantita relativa di MGB (HOEC) DNA-Base Intercalator Quantita relativa di BI (QUIN)

11 ROBERTO ACCOLLA Giovanna Tosi VARESE Sequenziamento Significato e funzioni delle sequenze di basi Diagnosticare preventivamente linsorgenza di malattie genetiche. Piccole differenze, da un individuo allaltro della stessa specie, nella sequenza di basi del DNA possono codificare per un carattere del fenotipo (v. biodiversita, gruppo sanguigno, ecc.), ma anche essere associate allo sviluppo di malattie attraverso uninterferenza con processi biologici cellulari.

12 VARIANTE ALLELICA 0) Sequenza 0 A TTAAAAAAAAAAAAATTTTTTTTAT ATTTTTTTTTTTTTAAAAAAAAATA D TAAAAAAAAAAAAAATTTTTTTTAT TTTTTTTTTTTTTTAAAAAAAAATA VARIANTE ALLELICA 1) Sequenza 1 A TTAAAAAAAAAAAAATTTTTTTTAT D ATTTTTTTTTTTTTAAAAAAAAATA Sonda della Sequenza 0 Sequenza 0 TTTTTTTTTTTTTTAAAAAAAAATA Sequenza 1 ATTTTTTTTTTTTTAAAAAAAAATT Sequenza 2 ATTTTTTTTTTTTTAAAATAAAATA Sequenza 3 PUNTI DI MISMATCHING Sonda/Sequenze 1 prima base 2 terzultima base 3 base al centro DISTANZE D-A? DIVERSI ? Etc.

13 S0S0S0S0 R0R0R0R0 D A S2S2S2S2 S1S1S1S1 S3S3S3S3 R 1 R 0 A D D A A D A D D A 2662±8 ps 2621±18 ps 2765±3 ps 2300±20 ps

14 Chromosome 6 Major histocompatibility complex (MHC) locus di massima variabilita allelica: class II Human Leukocyte Antigen (HLA) varianti alleliche responsabili per un gran numero di patologie

15 Cromosoma 6

16 TAMRA BHQ2

17 D A

18 Sonda Specifica per la Sequenza 0201 Sequenza 0201 ACGAGCCCCCCGGGGAGCGCATGACGTA - TGCTCGGGGGGCCCCTCGCGTACTG CAT D A CONCLUSIONE Lunica sequenza che produce perfetto matching con la sonda per essa specifica tiene allestrema distanza da. D WORK IN PROGRESS La stessa sonda produce MASSIMO aggiungendola al DNA (tutto) semplicemente estratto dai globuli bianchi del portatore di IDDM. A

19 Bibliografia A. Andreoni, M. Bondani, L. Nardo, Feasibility of single nucleotide polymorphism genotyping with a single-probe by time-resolved Förster energy transfer Molecular and Cellular Probes 23 (2009) Available on line, doi: /j.mcp A. Andreoni, M. Bondani, L. Nardo, A time-resolved FRET method for typing polymorphic alleles of the human leukocyte antigen system by using a single DNA probe Photochem. Photobiol. Sci., 8 (2009) Available on line, DOI: / B906043J Highlighted in the magazines Chemical Technology (http://www.rsc.org/Publishing/ChemTech/index.asp) and Chemistry World (www.rsc.org/ChemistryWorld).http://www.rsc.org/Publishing/ChemTech/index.aspwww.rsc.org/ChemistryWorld L. Nardo, M. Bondani, G. Tosi, R. S. Accolla, A. Andreoni Molecular typing of single-nucleotide polymorphic genes by time-resolved fluorescence resonance energy transfer in: Photobiology: Principles, Applications and Effects, ed. by Léon N. Collignon and Claud B. Normand (Nova Science Publishers Inc., Hauppauge, NY, 2010). In press. Invited chapter. ISBN:

20 L CHANNEL t=1/(113 MHz) or t=1/(48 MHz) SAMPLE OBJ BS ADJ. DIST. CUTOFF SPAD + AQC MCA FIBER Nd:VAN, SH or TH Ti:sapphire, SH LASER PULSES ND TAC STARTSTOP ND PIN CFD FLUORESCENCE DECAY of MOLECULES Light collected at 90 deg


Scaricare ppt "ALESSANDRA ANDREONI Universita degli Studi dellInsubria Dipartimento di Fisica e Matematica Via Valleggio, 11 – 22100 Como (Italy)"

Presentazioni simili


Annunci Google