La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

SOFTWARE PER LO SVILUPPO DI MAPPE FISICHE Simone Scalabrin DiMI Studente di dottorato in Informatica www.dimi.uniud.it/scalabri Università degli Studi.

Presentazioni simili


Presentazione sul tema: "SOFTWARE PER LO SVILUPPO DI MAPPE FISICHE Simone Scalabrin DiMI Studente di dottorato in Informatica www.dimi.uniud.it/scalabri Università degli Studi."— Transcript della presentazione:

1 SOFTWARE PER LO SVILUPPO DI MAPPE FISICHE Simone Scalabrin DiMI Studente di dottorato in Informatica Università degli Studi di Udine Istituto agrario San Michele allAdige

2 MAPPA FISICA Insieme di contig Insieme di contig Ogni contig è un insieme ordinato di frammenti di DNA parzialmente sovrapposti Ogni contig è un insieme ordinato di frammenti di DNA parzialmente sovrapposti Minimal tiling pathMinimal tiling path

3 Librerie di cloni BAC, copertura del genoma pari a 7-30x, inserti sono prodotti con diversi insiemi di enzimi di restrizione A Clone BAC Digestione SeparazioneRilevamento Dimensionam 20,000 bp 10,000 bp 4,000 bp 2,000 bp 1,200 bp 800 bp B Comparazione a coppie Assemblaggio a stringenza alta C Riassemblaggio manuale con stringenza bassa D Verifica & Allineamento E Meyers, Scalabrin, Morgante 2004 Nature Reviews Genetics

4 COME SI COSTRUISCE UNA MAPPA FISICA Serie di cloni genomici parzialmente sovrappostiSerie di cloni genomici parzialmente sovrapposti Identificazione delle sovrapposizioniIdentificazione delle sovrapposizioni 1043_A _G08

5 Digestione SeparazioneRilevamento Dimensionamento 20,000 bp 10,000 bp 4,000 bp 2,000 bp 1,200 bp 800 bp B Clone BAC

6 IDENTIFICAZIONE DI SOVRAPPOSIZIONI Fingerprinting EcoRI

7 Fingerprinting IDENTIFICAZIONE DI SOVRAPPOSIZIONI

8 Fingerprinting IDENTIFICAZIONE DI SOVRAPPOSIZIONI

9 Fingerprinting IDENTIFICAZIONE DI SOVRAPPOSIZIONI

10 Scelta degli enzimi Numero di frammenti prodotti Distribuzione delle bande prodotte Composizione del genoma Costo degli enzimi

11 ENZIMI A BLUNT END 5AATGCATAGTACACATGTACTACAGATACGTACACAT 3 3TTACGTATCATGTGTACATGATGTCTATGCATGTGTA 5 Estremità piatte

12 TAGLIO BLUNT END 5AATGCATAGT 3 5ACACAT 3 3TTACGTATCA 5 3TGTGTA 5 5ACACATGTACTACAGATACGT 3 3TGTGTACATGATGTCTATGCA 5

13 ENZIMI A STICKY END 5ACTGAATGCATACTTAAGACATAGAGT 3 3TGACTTACGTATGAATTCTGTATCTCA 5 Estremità appiccicose

14 TAGLIO STICKY END 5ACTGAATGCATACT 3 5TAAGACATAGAGT 3 3TGACTTACGTATGAAT 5 3TCTGTATCTCA 5

15 IL FINGERPRINTING FLUORESCENTE T 5ACTGAATGCATACTT 3 3TGACTTACGTATGAAT 5 Marcatura fluorescente Colori differenti

16 Comparazione a coppie Assemblaggio a stringenza alta C

17 LA LOGICA DEL FINGERPRINTING Frammenti di uguale dimensione nel pattern di digestione Possibile sovrapposizione BA

18 PROBLEMI NEL CONFRONTO TRA FINGERPRINT Dimensionamento dei frammentiDimensionamento dei frammenti Falsi positivi (caso, bande doppie)Falsi positivi (caso, bande doppie) Falsi negativi (eterozigosi, bande mancanti)Falsi negativi (eterozigosi, bande mancanti)

19 TECNICHE DI FINGERPRINTING 1. Digestione semplice 2. Digestione e marca- tura radioattiva Gel dagarosio Gel dagarosio Dimensionamento poco preciso Dimensionamento poco preciso Gel di poliacrilammide Gel di poliacrilammide Dimensionamento più preciso Dimensionamento più preciso 3. Digestione e marca- tura fluorescente Gel di poliacrilammide Gel di poliacrilammide Dimensionamento più preciso Dimensionamento più preciso Meno falsi positivi grazie ai colori Meno falsi positivi grazie ai colori

20 AB TECNICHE DI FINGERPRINTING AB Digestione semplice Digestione e marcatura fluorescente FALSO POSITIVO

21 IL FINGERPRINTING FLUORESCENTE Un enzima frequent cutter che produce estremità piatteUn enzima frequent cutter che produce estremità piatte 4 enzimi che producono estremità appiccicose4 enzimi che producono estremità appiccicose Reazioni di estensione della singola base con ddNTP fluoresceinatiReazioni di estensione della singola base con ddNTP fluoresceinati Elettroforesi su poliacrilammideElettroforesi su poliacrilammide

22 LANALISI DEI DATI Individuazione dei picchi Rimozione background e bande vettore Elettrocromatogrammi ABI Prism 3730 GeneMapper Genoprofiler Script in PERL Costruzione contig FPC ATTIVITA SOFTWARE

23 ELETTROCROMATOGRAMMI (fsa) Picco elettroforetico

24 ELETTROCROMATOGRAMMI

25 INDIVIDUAZIONE DEI PICCHI Tabella in formato testo (GeneMapper)

26 ELETTROCROMATOGRAMMI Composizione per colore: Almeno 200 picchi 30 – 50 bande vere Altezza minima (livello minimo di background)

27 Eletrocromatogrammi testo Dividere in colori Massima sensibilità (FPC tratta ) 4 colori 4 zone

28 Eletrocromatogrammi testo 1028_B ,7 1739,1 5867,4 6664,5 7170,6 7319, , , , , , , , ,1 BLU VERDE ROSSO

29 LA RIMOZIONE DEL BACKGROUND Bande vere Background

30 Rimozione del rumore

31 LA RIMOZIONE DEL BACKGROUND 1 f(avg)

32 Genoprofiler 1.10

33 LA RIMOZIONE DEL BACKGROUND 2 f(ratio) Scalabrin e Morgante

34 LA RIMOZIONE DEL BACKGROUND 3 UL UA LL LA UL UA LL LA fine IG = UA1 – LA1 UL = UA – 0,3 * IG LL = LA + 0,15 * IG Scalabrin e Morgante Script in Perl

35 LA COSTRUZIONE DEI CONTIG

36 Due parametri chiave Tolerance = scarto accettato Cutoff: probabilità che il match tra due cloni sia dovuto puramente al caso (e non sia una vera sovrapposizione) Cutoff più basso maggior stringenza FPC FingerPrinted Contigs - 2 passi per assemblare i cloni in contigs: 1) Clustering: basato sul numero delle bande condivise 2) Ordinamento: trova la soluzione migliore che massimizzi le sovrapposizioni

37 Confronto tra due cloni Sulston cutoff score Dove nL e nH sono il numero minimo e massimo di bande per i due cloni ed M è il numero minimo di bande condivise, p=(1-b) nH, b=2t/gellen, t è la tolleranza, gellen è la lunghezza del gel. b rappresenta la probabilità che una banda di un clone faccia il match con una banda dellaltro clone. tt 0gellen p rappresenta la probabilità che nessuna delle nH bande del clone più grande facciano il match con una data banda del clone più piccolo.

38 Mapping BACs within contigs

39 CB Maps FPC prova a ordinare cloni basandosi su Consensus Bands Extra bands Clone name Bands + = shared band o = missing band x = 2 tolerance bin Clone order

40 Cloni Q numero sufficiente di bande per entrare in un contig molte bande extra non bene nella mappa 4 Tipi di Qs 2) Clone in posizione errata - sequenza ripetuta 1) Fingerprint di scarsa qualità 3) Soluzione non ottimale 4) Diversità allelica

41 Riassemblaggio semi-manuale a stringenza bassa D

42 Verifica e allineamento E

43 Collegamento fra mappa fisica e genetica, considerazioni Quanti contig ci aspettiamo di ottenere nella mappa fisica iniziale? –1 per cromosoma!!! –Dipende dal genoma in questione Ogni contig deve essere collegato alla mappa genetica –1 marker per contig fornisce la posizione –2 marker per contig forniscono anche lorientamento

44 RINGRAZIAMENTI Prof. Michele MorganteProf. Michele Morgante Dott. Riccardo VelascoDott. Riccardo Velasco Dott. Marco MoroldoDott. Marco Moroldo Prof. Alberto PolicritiProf. Alberto Policriti Dott. Giacomo PreteDott. Giacomo Prete Dott.sa Raffaella MarconiDott.sa Raffaella Marconi P.Ch. Nicoletta FeliceP.Ch. Nicoletta Felice Dott. Massimo PindoDott. Massimo Pindo Dott.sa Michela TroggioDott.sa Michela Troggio Dott.sa Cinzia SegalaDott.sa Cinzia Segala Dott. Paolo FontanaDott. Paolo Fontana

45 APPENDICE

46 LETTERATURA Mapping and sequencing complex genomes: Lets get physical!, Meyers, Scalabrin, Morgante, Nature Reviews Genetics, 2004Mapping and sequencing complex genomes: Lets get physical!, Meyers, Scalabrin, Morgante, Nature Reviews Genetics, 2004 FPC: a system for building contigs from restriction fingerprinted clones, Soderlund, Longden, Mott, 1997FPC: a system for building contigs from restriction fingerprinted clones, Soderlund, Longden, Mott, 1997 DNA markers in plant improvement: an overview, Kumar, 1999DNA markers in plant improvement: an overview, Kumar, 1999 Nucleotide and aplotype diversity in wine cultivars of Grape, Prete, Cattonaro, Morgante, 2003Nucleotide and aplotype diversity in wine cultivars of Grape, Prete, Cattonaro, Morgante, 2003

47 LIMPATTO DELLETEROZIGOSI 50% frammenti condivisi 50% frammenti condivisi e 4 cloni di tipo B mancanti 1200 CBu 2200 CBu

48 Descrizione del processo Giorno 1: precoltura cellulare Giorno 2: coltura cellulare Giorno 3: isolamento DNA Giorno 4: frammentazione DNA Giorno 5: marcatura DNA e separazione su sequenziatore N. campioni 1600 Tutte 5 fasi avvengono simultaneamente 8000 campioni DNA diversi processati settimanalmente 3 persone ABBACABBAC

49 Informatica

50 Robotica

51 Ancora robotica

52 Automazione 48 campioni DNA ogni 35 minuti, 2000 al giorno senza intervento operatore

53 IDENTIFICARE LE SOVRAPPOSIZIONI Marcatori VV132

54 IDENTIFICARE LE SOVRAPPOSIZIONI Marcatori VV132

55 IDENTIFICARE LE SOVRAPPOSIZIONI Marcatori VV132

56 IDENTIFICARE LE SOVRAPPOSIZIONI Marcatori VV132 Fingerprinting EcoRI

57 IDENTIFICARE LE SOVRAPPOSIZIONI Marcatori VV132 Fingerprinting

58 IDENTIFICARE LE SOVRAPPOSIZIONI Marcatori VV132 Fingerprinting

59 IDENTIFICARE LE SOVRAPPOSIZIONI Marcatori VV132 Fingerprinting

60 Codice rimozione background(3) upper_avg = avg of peaks 3-7 lower_avg = avg of 60th peak on ratio = upper_avg / lower_avg IF ( ratio < 4,5 ) { throw away } IF ( #peaks < 60 ) { threshold = 500 } ELSE { threshold = iteration() }

61 Codice ITERATION() initialGap = upper_avg – lower_avg upper_limit = heigth[7] lower_limit = heigth[60] WHILE ( avg is changing AND ratio > 4,5 ) { upper_limit = upper_avg – (0,2 * initialGap + (upper_avg - lower_avg) * (0,1 + ratio / 100)) upper_limit = upper_avg – (0,2 * initialGap + (upper_avg - lower_avg) * (0,1 + ratio / 100)) lower_limit = lower_avg + 0,1 * initialGap + (upper_avg - lower_avg)*(ratio/100) lower_limit = lower_avg + 0,1 * initialGap + (upper_avg - lower_avg)*(ratio/100) COMPUTE upper_avg, lower_avg and ratio COMPUTE upper_avg, lower_avg and ratio}

62 INTEGRAZIONE TRA MAPPA FISICA E GENETICA GR0568 0,0 GR0176 7,2 BA ,6 BA ,1 F20236b 21,8 IN ,4 GR ,4 GR ,5 F ,1 E39/M ,7 E32/M ,5 F20236a 33,7 Chr 10


Scaricare ppt "SOFTWARE PER LO SVILUPPO DI MAPPE FISICHE Simone Scalabrin DiMI Studente di dottorato in Informatica www.dimi.uniud.it/scalabri Università degli Studi."

Presentazioni simili


Annunci Google