La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

SOFTWARE PER LO SVILUPPO DI MAPPE FISICHE

Presentazioni simili


Presentazione sul tema: "SOFTWARE PER LO SVILUPPO DI MAPPE FISICHE"— Transcript della presentazione:

1 SOFTWARE PER LO SVILUPPO DI MAPPE FISICHE
DiMI Università degli Studi di Udine Istituto agrario San Michele all’Adige Simone Scalabrin Studente di dottorato in Informatica

2 MAPPA FISICA Insieme di contig
Ogni contig è un insieme ordinato di frammenti di DNA parzialmente sovrapposti Minimal tiling path

3 A Librerie di cloni BAC, copertura del genoma pari a 7-30x, inserti sono prodotti con diversi insiemi di enzimi di restrizione B Clone BAC Digestione C Comparazione a coppie Assemblaggio a stringenza alta Separazione Rilevamento Dimensionam 20,000 bp 10,000 bp 4,000 bp 2,000 bp 1,200 bp 800 bp E Verifica & Allineamento D Riassemblaggio manuale con stringenza bassa Meyers, Scalabrin, Morgante 2004 Nature Reviews Genetics

4 COME SI COSTRUISCE UNA MAPPA FISICA
Serie di cloni genomici parzialmente sovrapposti Identificazione delle sovrapposizioni 1043_A23 1096_G08

5 B Clone BAC Digestione Separazione Rilevamento 20,000 bp 10,000 bp
Dimensionamento 20,000 bp 10,000 bp 4,000 bp 2,000 bp 1,200 bp 800 bp

6 IDENTIFICAZIONE DI SOVRAPPOSIZIONI
Fingerprinting EcoRI

7 IDENTIFICAZIONE DI SOVRAPPOSIZIONI
Fingerprinting

8 IDENTIFICAZIONE DI SOVRAPPOSIZIONI
Fingerprinting

9 IDENTIFICAZIONE DI SOVRAPPOSIZIONI
Fingerprinting

10 Scelta degli enzimi Numero di frammenti prodotti
Distribuzione delle bande prodotte Composizione del genoma Costo degli enzimi

11 ENZIMI A BLUNT END 5’AATGCATAGTACACATGTACTACAGATACGTACACAT 3’
3’TTACGTATCATGTGTACATGATGTCTATGCATGTGTA 5’ Estremità piatte

12 TAGLIO BLUNT END 5’AATGCATAGT 3’ 5’ACACAT 3’
3’TTACGTATCA 5’ ’TGTGTA 5’ 5’ACACATGTACTACAGATACGT 3’ 3’TGTGTACATGATGTCTATGCA 5’

13 ENZIMI A STICKY END 5’ACTGAATGCATACTTAAGACATAGAGT 3’
3’TGACTTACGTATGAATTCTGTATCTCA 5’ Estremità appiccicose

14 TAGLIO STICKY END 5’ACTGAATGCATACT 3’ 5’TAAGACATAGAGT 3’
3’TGACTTACGTATGAAT 5’ 3’TCTGTATCTCA 5’

15 IL FINGERPRINTING FLUORESCENTE
5’ACTGAATGCATACTT 3’ 3’TGACTTACGTATGAAT 5’ Marcatura fluorescente Colori differenti

16 C Comparazione a coppie Assemblaggio a stringenza alta

17 LA LOGICA DEL FINGERPRINTING
B Frammenti di uguale dimensione nel pattern di digestione Possibile sovrapposizione

18 PROBLEMI NEL CONFRONTO TRA FINGERPRINT
Dimensionamento dei frammenti Falsi positivi (caso, bande doppie) Falsi negativi (eterozigosi, bande mancanti)

19 TECNICHE DI FINGERPRINTING
Gel d’agarosio Dimensionamento poco preciso 1. Digestione semplice 2. Digestione e marca- tura radioattiva Gel di poliacrilammide Dimensionamento più preciso Gel di poliacrilammide Dimensionamento più preciso Meno falsi positivi grazie ai colori 3. Digestione e marca- tura fluorescente

20 TECNICHE DI FINGERPRINTING
FALSO POSITIVO A B A B Digestione e marcatura fluorescente Digestione semplice

21 IL FINGERPRINTING FLUORESCENTE
Un enzima frequent cutter che produce estremità piatte 4 enzimi che producono estremità appiccicose Reazioni di estensione della singola base con ddNTP fluoresceinati Elettroforesi su poliacrilammide

22 L’ANALISI DEI DATI Elettrocromatogrammi ABI Prism 3730
SOFTWARE ATTIVITA’ Elettrocromatogrammi ABI Prism 3730 Individuazione dei picchi GeneMapper Rimozione background e bande vettore Script in PERL Genoprofiler Costruzione contig FPC

23 ELETTROCROMATOGRAMMI (fsa)
Picco elettroforetico

24 ELETTROCROMATOGRAMMI

25 INDIVIDUAZIONE DEI PICCHI
Tabella in formato testo (GeneMapper)

26 ELETTROCROMATOGRAMMI
Composizione per colore: Almeno 200 picchi 30 – 50 bande vere Altezza minima (livello minimo di background)

27 Eletrocromatogrammi → testo
Dividere in colori Massima sensibilità (FPC tratta ) 4 colori → 4 zone 50 500 50 500 50 500 50 500 15000 30000 45000 60000

28 Eletrocromatogrammi → testo
1028_B10 14 1526,7 1739,1 5867,4 6664,5 7170,6 7319,1 16500,0 18532,8 20370,9 20919,6 21139,5 22703,7 24783,3 50414,1 BLU VERDE ROSSO

29 LA RIMOZIONE DEL BACKGROUND
Bande vere Background

30 Rimozione del rumore

31 LA RIMOZIONE DEL BACKGROUND 1
f(avg)

32 Genoprofiler 1.10

33 LA RIMOZIONE DEL BACKGROUND 2
f(ratio) Scalabrin e Morgante

34 LA RIMOZIONE DEL BACKGROUND 3
UA UL UA UL fine LL LL LA LA IG = UA1 – LA1 UL = UA – 0,3 * IG LL = LA + 0,15 * IG Scalabrin e Morgante Script in Perl

35 LA COSTRUZIONE DEI CONTIG

36 Cutoff più basso → maggior stringenza
FPC 8.1 - FingerPrinted Contigs - 2 passi per assemblare i cloni in contigs: 1) Clustering: basato sul numero delle bande condivise 2) Ordinamento: trova la soluzione migliore che massimizzi le sovrapposizioni Due parametri chiave Tolerance = scarto accettato Cutoff: probabilità che il match tra due cloni sia dovuto puramente al caso (e non sia una vera sovrapposizione) Cutoff più basso → maggior stringenza

37 Confronto tra due cloni
Sulston cutoff score Dove nL e nH sono il numero minimo e massimo di bande per i due cloni ed M è il numero minimo di bande condivise, p=(1-b)nH, b=2t/gellen, t è la tolleranza, gellen è la lunghezza del gel. t t gellen b rappresenta la probabilità che una banda di un clone faccia il match con una banda dell’altro clone. p rappresenta la probabilità che nessuna delle nH bande del clone “più grande” facciano il match con una data banda del clone “più piccolo”.

38 Mapping BACs within contigs

39 CB Maps FPC prova a ordinare cloni basandosi su Consensus Bands
Clone order Clone name Bands Extra bands + = shared band o = missing band x = 2 tolerance bin

40 Cloni Q numero sufficiente di bande per entrare in un contig molte bande extra non bene nella mappa 4 Tipi di Qs 1) Fingerprint di scarsa qualità 2) Clone in posizione errata - sequenza ripetuta 3) Soluzione non ottimale 4) Diversità allelica

41 Riassemblaggio semi-manuale
D Riassemblaggio semi-manuale a stringenza bassa

42 Verifica e allineamento

43 Collegamento fra mappa fisica e genetica, considerazioni
Quanti contig ci aspettiamo di ottenere nella mappa fisica iniziale? 1 per cromosoma!!! Dipende dal genoma in questione Ogni contig deve essere collegato alla mappa genetica 1 marker per contig fornisce la posizione 2 marker per contig forniscono anche l’orientamento

44 RINGRAZIAMENTI Prof. Michele Morgante Dott. Riccardo Velasco
Dott. Marco Moroldo Prof. Alberto Policriti Dott. Giacomo Prete Dott.sa Raffaella Marconi P.Ch. Nicoletta Felice Dott. Massimo Pindo Dott.sa Michela Troggio Dott.sa Cinzia Segala Dott. Paolo Fontana

45 APPENDICE

46 LETTERATURA Mapping and sequencing complex genomes: Let’s get physical!, Meyers, Scalabrin, Morgante, Nature Reviews Genetics, 2004 FPC: a system for building contigs from restriction fingerprinted clones, Soderlund, Longden, Mott, 1997 DNA markers in plant improvement: an overview, Kumar, 1999 Nucleotide and aplotype diversity in wine cultivars of Grape, Prete, Cattonaro, Morgante, 2003

47 L’IMPATTO DELL’ETEROZIGOSI
1200 CBu 2200 CBu 50% frammenti condivisi 50% frammenti condivisi e 4 cloni di tipo B mancanti

48 Descrizione del processo
A B C N. campioni 1600 Giorno 1: precoltura cellulare Giorno 2: coltura cellulare Giorno 3: isolamento DNA Giorno 4: frammentazione DNA Giorno 5: marcatura DNA e separazione su sequenziatore Tutte 5 fasi avvengono simultaneamente 8000 campioni DNA diversi processati settimanalmente 3 persone

49 Informatica

50 Robotica

51 Ancora robotica

52 Automazione 48 campioni DNA ogni 35 minuti, 2000 al giorno
senza intervento operatore

53 IDENTIFICARE LE SOVRAPPOSIZIONI
Marcatori VV132 VV132

54 IDENTIFICARE LE SOVRAPPOSIZIONI
VV132 Marcatori VV132

55 IDENTIFICARE LE SOVRAPPOSIZIONI
Marcatori VV132

56 IDENTIFICARE LE SOVRAPPOSIZIONI
Marcatori VV132 Fingerprinting EcoRI

57 IDENTIFICARE LE SOVRAPPOSIZIONI
Marcatori VV132 Fingerprinting

58 IDENTIFICARE LE SOVRAPPOSIZIONI
Marcatori VV132 Fingerprinting

59 IDENTIFICARE LE SOVRAPPOSIZIONI
Marcatori VV132 Fingerprinting

60 Codice rimozione background(3)
upper_avg = avg of peaks 3-7 lower_avg = avg of 60th peak on ratio = upper_avg / lower_avg IF (ratio < 4,5) {throw away} IF (#peaks < 60) {threshold = 500} ELSE {threshold = iteration()}

61 Codice ITERATION() initialGap = upper_avg – lower_avg
upper_limit = heigth[7] lower_limit = heigth[60] WHILE (avg is changing AND ratio > 4,5) { upper_limit = upper_avg – (0,2 * initialGap + (upper_avg - lower_avg) * (0,1 + ratio / 100)) lower_limit = lower_avg + 0,1 * initialGap + (upper_avg - lower_avg)*(ratio/100) COMPUTE upper_avg, lower_avg and ratio }

62 INTEGRAZIONE TRA MAPPA FISICA E GENETICA
0,0 GR0176 7,2 BA0025 17,6 BA0003 21,1 F20236b 21,8 IN0126 23,4 GR0409 24,4 GR0280 25,5 F20681 26,1 E39/M49-114 26,7 E32/M62-282 30,5 F20236a 33,7 Chr 10


Scaricare ppt "SOFTWARE PER LO SVILUPPO DI MAPPE FISICHE"

Presentazioni simili


Annunci Google