La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Famiglie di fattori di trascrizione Dita di zinco Omeodominio (elica-giro-elica) HTH Elica-ansa-elica HLH Cerniera di leucina.

Copie: 2
FATTORI DI TRASCRIZIONE NEGLI EUCARIOTI ( trans-acting factors = fattori che agiscono in trans ) Possono essere distinti in: - Fattori generali - Attivatori.

FATTORI DI TRASCRIZIONE NEGLI EUCARIOTI Trans-acting factors = fattori che agiscono in trans Transattivatori = attivatori che agiscono in trans Possono.

Presentazioni simili


Presentazione sul tema: "Famiglie di fattori di trascrizione Dita di zinco Omeodominio (elica-giro-elica) HTH Elica-ansa-elica HLH Cerniera di leucina."— Transcript della presentazione:

1 Famiglie di fattori di trascrizione Dita di zinco Omeodominio (elica-giro-elica) HTH Elica-ansa-elica HLH Cerniera di leucina

2 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

3

4

5

6

7

8

9

10

11

12

13

14 Terminazione della trascrizione nei procarioti

15 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

16 Un terminatore intrinseco è costituito da due regioni palindromiche che formano una forcina di 7-20 bp. Lo stelo include una regione ricca in GC ed è seguito da un tratto di U.

17 C G C A G C A G C A G C A U G C A U GC A U U U A U A U A U G A U G A U G -OH U G A U G C A U G C A U G C A U G C A U G C U C... GGGTCGGGCGGATTACTCGCCCG CCCAGCCCGCCTAATGAGCGGGC GTTTT CAAAA AAAAAA TTTTTT A T G A C T G C G U C CC UUUUUU 5' 3' -OH 5' 3'... T T A A U G C G C C A C A C A U C G A U C G GGGTCGGGCGGATTACTCGCCCGAAAAAAAACTTGTTTT CCCAGCCCGCCTAATGAGCGGGCTTTTTTTTGAACAAAA 5' 3' 5' 3' G C G UUUUUUUU -OH... G C G C C CCCA C A C A U C G A U C G Terminatori intrinseci (terminazione rho indipendente)

18 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006 Terminatore rho dipendente Il sito di terminazione è preceduto da una sequenza ricca di C e povera di G

19 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

20

21 Antiterminazione

22 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

23

24

25

26

27 Attenuazione

28 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

29

30 Nei batteri la trascrizione e la traduzione sono accoppiate

31 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

32

33

34

35

36

37

38

39

40 Peptidi "leader" degli operoni "attenuati" codificanti i geni per la sintesi degli amminoacidi


Scaricare ppt "Famiglie di fattori di trascrizione Dita di zinco Omeodominio (elica-giro-elica) HTH Elica-ansa-elica HLH Cerniera di leucina."

Presentazioni simili


Annunci Google