La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Lez 15_16 IngGen 28_XI_06 Altre PCR: Mutagenesi e PCR inversa A volte si clonano a volte ritornano [le PCR (i prodotti)]

Presentazioni simili


Presentazione sul tema: "Lez 15_16 IngGen 28_XI_06 Altre PCR: Mutagenesi e PCR inversa A volte si clonano a volte ritornano [le PCR (i prodotti)]"— Transcript della presentazione:

1 Lez 15_16 IngGen 28_XI_06 Altre PCR: Mutagenesi e PCR inversa A volte si clonano a volte ritornano [le PCR (i prodotti)]

2 Clonaggio in plasmidi dedicati di prodotti PCR - TAQ polymerase w.t. produce aggiunte di A terminali spuri; - TAQ proof reading o altri producono ampliconi blunt ends - dal tipo di enzima si sceglie un plasmide adeguato. Esistono in vendita: - plasmidi gia linearizzati con coda di T terminale per facilitare la ligasi tra lamplicone ed il plasmide - plasmidi con topoisomerasi coniugata allestremita del plasmide che lega direttamente lamplicone senza bisogno di ligasi Clonaggio dei prodotti PCR

3 PCR inversa strategia Per amplificare le regioni limitrofe ad una regione nota - un modo diverso per fare gene-walking È necessaria: una sequenza nota una mappa di restrizione Scegliere il frammento di restrizione consono né troppo lungo (non si amplifica bene) né troppo corto (non da molta informazione)

4 PCR inversa metodo Preparazione del DNA da analizzare (genomico o cloni con parziali sequenze ignote - se non si conosce la mappa di restrizione analisi Southern - digestione del DNA preferibilmente con enzimi con tagli protruding - ligasi del frammento su se stesso - purificazione del frammento utile da gel eletroforesi - amplificazione con primers divergenti - con PCR si amplifica sempre un frammento lineare

5 PCR inversa Il nome deriva dal fatto che si usano primers disegnati su una sequenza con direzione divergente, direzione di sequenza dei primers apparentemente non convergente. Analisi Southern Frammento di DNA Ligasi per circolarizzare il frammento A B c d Sequenza nota (primers divergenti) si amplifica il frammento circolare nella regione ignota BA Sequenza nota primers divergenti C D

6 Orientamento primers PCR inversa c d d c c d a b ba ab ligasi del sito di restrizione

7 PCR nested per PCR inversa estremità ignote digerite da DNA genomico e legate regione nota I primers dovranno sempre essere complementari ai due diversi filamenti I coppia divergente II primer I amplicone II amplicone I primer II primer

8 Primo ciclo frgm + lungo d d c c d frammento di restriz legato c-d sequenza nota I ciclo II ciclo d c d c d c c possibilità di concatenamero se la taq prosegue

9 Per fare avvenire una delezione o inserzione si utilizza il metodo a tre passaggi (esempio per inserzione). pr.ext. frw. pr.int. rev. pr.ext. rev. pr.int. frw. pr.ext. frw. pr. int. rev. 3PCR indipendenti pr.ext. frw. pr.ext. rev. I III ( ) ( ) pr.int. frw. pr.ext. rev. inserzione II per inserire la sequenza mutata nella sequenza voluta o si seleziona un ricombinante dopo trasfezione o si inserisce direttamente la sequenza mutagenizzata con enzimi di restrizione. Mutagenesi tramite uso di primers modificati

10 Mutagenesi con PCR in tre passaggi DNA mitocondriale bovino acc. N. V00654, gi con bp L8014 (external forward primer) 5 -ACCCATTGTCCTTGAGTTAGT-3, H8393 (external reverse primer) 5 -GAGGGTTACAAAGCGATTGCT-3, H8242 (internal reverse primer) 5 -GAGATCTGCCGTACAGGCCTAGAATATTTTTGTTGGTGTCAGT-3 and L8283 (internal forward primer) 5 -CTAGGCCTGTACGGCAGATCTCAAAACAAAACACCCCTTGAGA-3, III PCR per estensione della regione sovrapposta I primers interni L8283 e H8242 hanno una coda al 3 -terminale che è stata usata per introdurre una inserzione di 22 bp (parte sottolineata nella sequenza del primer). La complementariet à sta nell inserzione tra il 3 dell int. frw. primer ed il 5 dell int.rev.primer L inserzione permette di discriminare per peso molecolare la sequenza bovina da quella del nuovo costrutto usato nella PCR competitiva come riferimento con varie diluizioni a partire da una concentrazione nota. Il competitore sintetico è stato clonato nel vettore pBlueScript KS + della ditta Stratagene (La Jolla, Ca.CA USA).

11 Complementarietà delle code H8242 (internal reverse primer) 5 -GAGATCTGCCGTACAGGCCTAGAATATTTTTGTTGGTGTCAGT-3 and L8283 (internal forward primer) 5 -CTAGGCCTGTACGGCAGATCTCAAAACAAAACACCCCTTGAGA-3 3 ………… TTTTATAAGATCCGGACATGCCGTCTAGAG seq mitoc. spec coda per appaiamento int rev pr templato int frw pr templato

12 appaiamento PCR I + II X X elongation solo di due filamenti

13 di un frammento f in un amplicone (3 steps = 3 passaggi) frw rev a f f b I e II PCR inserzione frw rev a f b f fannealing di 2 PCR III PCR in 2 fasi a b inserzione

14 di un frammento b da un amplicone frw rev a b c delezione a b a c 1 2 c 3liberooredil c a annealing II PCR delezione

15 in un amplicone in 3 passaggi z 3 acb z z 3 5 I II III annealing II PCR ed extension II PCR separate z a c ac z PCR finale sostituzione

16 Questo terzo metodo che abbiamo visto, può essere utilizzato sia per ottenere inserzioni o sostituzioni, ma anche delezioni però con linserzione di un nuovo frammento di lunghezza diversa, anche molto diversa. Dipende da dove si fanno partire i primers interni con la coda. In realtà si possono giuntare anche frammenti non limitrofi per costruire geni di fusione. Si possono legare esoni di geni diversi come per esempio esoni di un gene a cui attaccare la GFP o Lac Z. Applicazioni dellultimo metodo

17 esercizio 1 CTCAGAGCTG GGAAGGAGGC TCTAGATGGC GGCTGTGCCT TAGAGAGAGC GCGCTCTGCT 61 CCCTGCCTTT GCCTCACTTT ACGCAACTTT CCCTAACTTT CGGGCAGCCT CAGGGGGCCC 121 CCGTAGCCCC CTGCCTTTCC TAGGGACTTA CTGGGGTCGA TTCGAACCTT TTTTTGGGAG 181 AAAAGCAGCT TTTAGGAGCT TTCTTTTCGT GCCTTGTTGG AAAGAAGCAG CCGTACTGAG 241 AGCCCAGGTC GTTGTTTTTT CCAGCTTAGA AGCCATGGCG CACCTCCATT TTTGTGCGCT 301 CTCCTAATGA GGTTTTTTTT CTTTCGGACC TGTTTTAGTA TTAATTATTG CTTTATTTTT 361 TTGACCAGTT AACATATTTG AGGGTTATTT TATTTATTTT TCGTTTTTTA ACGGAGGATT 421 TTGCCTTTAT TTTTAATTAT TTGGGATCTG ATATTTTTCT ACTAGTAGAT AGGACTCTTG 481 GTTTGGACAT ACTACATGGA TCAGTAAATA CCTGGGCACA GGACTTCAAA GCAAACACAG 541 ATTCCCCCTC CCCCTTAATA TTTAAGAATT AAAAGATGAT GAGAAATAAG GACAAAAGCC 601 AAGAGGAGGA CAGTTCGCTA CACAGCAATG CATCGAGTCA CTCAGCCTCT GAAGAAGCTT 661 CGGGTTCAGA CTCAGGCAGT CAGTCGGAAA GTGAGCAGGG AAGTGATCCA GGAAGTGGAC 721 ATGGCAGCGA GTCGAACAGC AGCTCTGAAT CTTCTGAGAG TCAGTCGGAA TCTGAGAGCG 781 AATCAGCAGG TTCCAAATCC CAGCCAGTCC TCCCAGAAGC CAAAGAGAAG CCAGCCTCTA 841 AGAAGGAACG GATAGCTGAT GTGAAGAAGA TGTGGGAAGA ATATCCTGAT GTTTATGGGG 901 TCAGGCGGTC AAACCGAAGC AGACAAGAAC CATCGCGATT TAATATTAAG GAAGAGGCAA 961 GTAGCGGGTC TGAGAGTGGG AGCCCAAAAA GAAGAGGCCA GAGGCAGCTG AAAAAACAAG 1021 AAAAATGGAA ACAGGAACCC TCAGAAGATG AACAGGAACA AGGCACCAGT GCAGAGAGTG - Trova i primers per fare una PCR di un frammento di circa 300bp di questa sequenza, trova i primers per una PCR nested. - Trova i primers per una PCR inversa e nested - Trova a che gene appartiene questa sequenza


Scaricare ppt "Lez 15_16 IngGen 28_XI_06 Altre PCR: Mutagenesi e PCR inversa A volte si clonano a volte ritornano [le PCR (i prodotti)]"

Presentazioni simili


Annunci Google