La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Caratteristiche del DNA Macromolecola, polimero di deossi- ribonucleotidi 4 nucleotidi: adenosina, citosina, guanosina, timidina Appaiamento A-T e G-C.

Presentazioni simili


Presentazione sul tema: "Caratteristiche del DNA Macromolecola, polimero di deossi- ribonucleotidi 4 nucleotidi: adenosina, citosina, guanosina, timidina Appaiamento A-T e G-C."— Transcript della presentazione:

1

2 Caratteristiche del DNA Macromolecola, polimero di deossi- ribonucleotidi 4 nucleotidi: adenosina, citosina, guanosina, timidina Appaiamento A-T e G-C (Regola della complementarietà o di Chargaff) Struttura a doppia elica

3 Appaiamento G-C ed A-T

4

5 il CROMOSOMA BATTERICO (nucleoide) Il DNA di un microrganismo è concentrato in ununica molecola, il cromosoma batterico (alcuni batteri possono avere 2 cromosomi) - dimensioni tipiche: da 3 a bp, (1.7 mm) il cromosoma è circolare (ma alcuni importanti gruppi hanno un cromosoma lineare) Il DNA è sempre associato a proteine, ma non è altamente organizzato come negli eucarioti

6 DNA batterico – domini superavvolti

7 La replicazione del DNA è detta semiconservativa La duplicazione del DNA da parte del suo specifico macchinario enzimatico è detta replicazione Nel microrganismo, la replicazione del DNA è associata alla sua riproduzione, che avviene per scissione binaria. La replicazione del DNA è semiconservativa: cioè ognuna delle due eliche complementari di una molecola di DNA servirà da stampo per una nuova elica.

8 La replicazione del DNA dipende dalle DNA polimerasi La sintesi della nuova elica di DNA procede in direzione 5-3 Viene catalizzata dalle DNA polimerasi (almeno 3 enzimi differenti con questa funzione in E. coli) Le DNA polimerasi sono solo parte di un macchinario replicativo molto complesso che coinvolge numerosi altri enzimi e proteine (DNA girasi, elicasi, SSB protein, etc.) Richiedono dNTPs come precursori della sintesi della macromolecola, unelica di DNA stampo e un primer (RNA) da cui può partire la sintesi della nuova elica

9 Problemi legati alla replicazione in direzione 5-3 Frammenti di Okazaki

10 I PLASMIDI Molti batteri oltre al cromosoma contengono molecole di DNA più piccole (da 1-2,000 a ,000 pdb), dette plasmidi. Queste molecole non sono indispensabili per le funzioni fondamentali del batterio (ceppi della stessa specie possono esserne privi). I plasmidi sono generalmente molecole di DNA circolare e superavvolto. I plasmidi replicano indipendentemente dal cromosoma del batterio, anche se necessitano del medesimo macchinario enzimatico del cromosoma perché avvenga la loro replicazione.

11 Funzioni codificate dai plasmidi I plasmidi possono codificare per diverse funzioni che conferiscono al batterio nuove proprietà: RESISTENZA AD ANTIBIOTICI E, SOSTANZE TOSSICHE, RADIAZIONI… CAPACITA DI PRODURRE ANTIBIOTICI, TOSSINE, FATTORI DI VIRULENZA… NUOVE CAPACITA METABOLICHE …

12 Ma tornando al cromosoma batterico…….. Perché è così importante il DNA? Perché contiene linformazione genetica….. Un gene da un punto di vista genetico: GENE= unità fondamentale dellinformazione genetica Tipicamente un gene corrisponde ad una proteina (o ad un RNA con funzione specifica) Un gene da un punto di vista biochimico: Sequenze di DNA che, una volta trascritte e tradotte contengono linformazione minima necessaria per la produzione di una proteina specifica

13 Il genoma batterico medio Genoma=insieme dei geni di un organismo Un batterio come Escherichia coli possiede un genoma di bp circa che codifica per circa 4300 geni 1 gene medio=1000 nucleotidi (regioni non-codificanti escluse)

14 Sequenziamento genomico Il DNA contiene linformazione genica di un organismo, contenuta nelle sue specifiche sequenze nucleotidiche. Conoscere la sequenza di un genoma (linsieme dei geni di un organismo) ci permette di avere importanti informazioni sulla sua biologia. A tuttoggi sono state rese disponibili le sequenze di circa 500 microrganismi.

15 Interpretazione delle sequenze di DNA AATAAAAATTTAACTCAATTTGTATCAAAAAATAACAGAAATCTAGCAGTTTTTGTAT TTTATTTTTAAATTGAGTTAAACATAGTTTTTTATTGTCTTTAGATCGTCAAAAACATA TTGCTGCTGGTGCTGCAATGGCTGATGAAGCTGTTGTTCATGACAGTTATGCATTCG AACGACGACCACGACGTTACCGACTACTTCGACAACAAGTACTGTCAATACGTAAGC

16 Sequenze codificanti e non- codificanti nel genoma batterico Geni: CDS= Coding Sequences ORF= Open Reading Frames = 1000 bp N.B.: nei microrganismi le sequenze geniche non presentano interruzioni (es. da sequenze introniche)

17 Che cosa ci permette di identificare le sequenze codificanti (cioè i geni) da una sequenza di DNA? Risposta: Dalla nostra conoscenza del codice genetico! AUG o GUG (ATG e GTG nel DNA) sono il codone di inizio per la sintesi proteica UAA (TAA), UAG (TAG) e UGA (TGA) sono i codoni di stop

18 Una Open Reading Frame, cioè una lunga sequenza di codoni in frame rappresenta un potenziale gene GTG CGA ATA AAT TTC GCA CAA…………………… GGC TAC TAA Met Arg Ile Asn Phe Ala Gln……………………………Gly Tyr STOP 921 paia di basi 307 amino acidi

19 Operoni: gruppi di geni parte di una unica unità trascrizionale Lorganizzazione di geni in operoni è tipica dei Bacteria. Il numero di geni presente in un operone è variabile (2-15 geni) Generalmente i geni di un operone codificano per proteine con funzioni correlate tra loro (es. enzimi di una stessa via metabolica)

20 Il flusso dellinformazione: lespressione genica La trascrizione

21 Lespressione genica: la messa in atto dellinformazione contenuta nel DNA

22 Quali sequenze di DNA vengono trascritte? A) tutto il DNA B) le sequenze codificanti geni C) le sequenze codificanti ed una parte delle sequenze non codificanti (quali? Dove comincia e dove finisce la trascrizione?)

23 I confini di un gene (coding sequence) sono molto chiari… Un gene è identificabile dalla presenza di un codone di inizio (ATG, più raramente GTG) che dà inizio ad una sequenza codificante più o meno lunga, che termina con un segnale di stop (TAA, TAG o TGA). Il gene fa parte di un trascritto (una molecola di RNA) che parte da un promotore e finisce ad un terminatore (il trascritto può comprendere più geni che appartengono allo stesso operone) Lenzima responsabile del processo di trascrizione prende il nome di RNA polimerasi

24 LRNA polimerasi è un enzima complesso e composto da diverse subunità

25 LRNA polimerasi è un enzima complesso e composto da diverse subunità Il complesso 2 ( ) possiede lattività catalitica per la sintesi dellRNA da una molecola stampo di DNA e viene definito core enzyme Non è però in grado di legare i promotori (siti di inizio della trascrizione) in assenza della subunità (o fattore). Lassemblaggio di questa subunità porta alla formazione del cosiddetto oloenzima

26 I tre momenti base del processo di trascrizione 1: Denaturazione locale del DNA 2: Inizio della trascrizione (pol. di 20 nt di RNA circa) 3: Allungamento della molecola di RNA nascente

27 La trascrizione è un processo asimmetrico Template strand/elica stampo Coding strand

28 Il core enzyme è in grado di legare il DNA ma non di iniziare la trascrizione Complesso chiuso Complesso aperto

29 A sua volta, linizio della trascrizione si compone di diverse reazioni Core Enzyme Fattore

30 Alcuni antibiotici inibiscono lRNA polimerasi (es. Rifampicina) Antibiotico scoperto in Italia negli anni 60 Fondamentale per capire meccanismo di trascrizione (ne inibisce linizio) Utilizzato per gran parte delle infezioni batteriche (Rifocin) fino a metà anni 70 Abbandonato per alta frequenza di batteri resistenti A tuttoggi principale antibiotico nella cura della tubercolosi

31 Il sito di inizio della trascrizione: il promotore

32 Il mappaggio dei promotori

33 Il Promotore perfetto (?) A AAATAAAATTTTTAAn..nTTGACAnnn…nnnTGnTATAATnnattAn Riconosciuto dalla subunità Riconosciuti dalla subunità 4-6nt 14nt 17nt 4-6nt +1-10Ext.-35UP element

34 Come si ferma una macchina in corsa? Il terminatore

35 Terminazione intrinseca (rho-indipendente)

36 Terminazione dipendente dal fattore Rho (

37 Operoni: gruppi di geni parte di una unica unità trascrizionale Lorganizzazione di geni in operoni è tipica dei Bacteria. Il numero di geni presente in un operone è variabile (2-15 geni) Generalmente i geni di un operone codificano per proteine con funzioni correlate tra loro (es. enzimi di una stessa via metabolica)

38 Operoni: gruppi di geni parte di una unica unità trascrizionale e controllati da un unico promotore = presenza di un promotore

39 La trascrizione negli Archaea Somiglianze con eucarioti Maggiore complessità dellRNA polimerasi (circa 12 subunità assemblate in modi alternativi) –introni presenti in alcuni geni –Insensibilità a rifampicina e ad altri antibiotici che inibiscono la trascrizione dei batteri Ma anche…..somiglianze con i procarioti –mRNA policistronico


Scaricare ppt "Caratteristiche del DNA Macromolecola, polimero di deossi- ribonucleotidi 4 nucleotidi: adenosina, citosina, guanosina, timidina Appaiamento A-T e G-C."

Presentazioni simili


Annunci Google