La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Alessia Stell Adriana Maggi Lab 2 Dicembre 2010 Ingegneria animale e animali transgenici.

Presentazioni simili


Presentazione sul tema: "Alessia Stell Adriana Maggi Lab 2 Dicembre 2010 Ingegneria animale e animali transgenici."— Transcript della presentazione:

1 Alessia Stell Adriana Maggi Lab 2 Dicembre 2010 Ingegneria animale e animali transgenici

2 Manipolazione genetica tradizionale

3 Manipolazione genetica moderna – DNA RICOMBINANTE

4 Cosa mancava per passare dalla manipolazione genetica tradizionale a quella moderna? 1967: Scoperta della DNA ligasi 1968: Scoperta degli enzimi di restrizione 1972: Avanzamenti nelle tecniche di trasferimento del DNA e nelluso di plasmidi

5 Animale Transgenico: animale nel cui genoma è stato inserito uno o più frammenti di DNA esogeno Transgene: frammento di DNA esogeno integrato stabilmente nel patrimonio genetico di cellule animali o vegetali

6 Metodi di Ingegneria animale

7 Gene Targeting Clonazione Sono 3 i metodi principali di ingegneria animale Transgenesi standard 1 2 3

8 1 Microiniezione di DNA lineare nella cellula uovo fecondata SCOPO : Guadagno di funzione CARATTERISTICA : inserzione random, casuale

9 Introduzione di una sequenza di DNA purificata in uno dei due pronuclei della cellula uovo fecondata

10 La procedura per ottenere la transgenesi standard si basa su 4 fasi distinte 1. Preparazione degli oociti fecondati 2. Preparazione dei costrutti 3. Preparazione delle femmine pseudogravide 4. Screening della progenie

11 La procedura per ottenere la transgenesi standard si basa su 4 fasi distinte Cocktail ormonale per la superovulazione: PMS (pregnant mares serum) HCG (human chorionic gonadotropin) Accoppiamento Raccolta degli oociti fecondati 1. Preparazione degli oociti fecondati 2. Preparazione dei costrutti 3. Preparazione delle femmine pseudogravide 4. Screening della progenie

12 La procedura per ottenere la transgenesi standard si basa su 4 fasi distinte Costruzione del transgene Amplificazione del transgene Purificazione del transgene 1. Preparazione degli oociti fecondati 2. Preparazione dei costrutti 3. Preparazione delle femmine pseudogravide 4. Screening della progenie

13 La procedura per ottenere la transgenesi standard si basa su 4 fasi distinte Accoppiamento delle femmine con maschio vasectomizzato Trasferimento delle uova fecondate microiniettate con il gene di interesse nellutero di femmina pseudogravida pseudogravida vasectomizzato X 1. Preparazione degli oociti fecondati 2. Preparazione dei costrutti 3. Preparazione delle femmine pseudogravide 4. Screening della progenie

14 La procedura per ottenere la transgenesi standard si basa su 4 fasi distinte Estrazione DNA dalle code della progenie Analisi tramite PCRAnalisi tramite Southern-blot M C C Preparazione degli oociti fecondati 2. Preparazione dei costrutti 3. Preparazione delle femmine pseudogravide 4. Screening della progenie

15 Linserzione del transgene è casuale RICOMBINAZIONE NON OMOLOGA Non si sa dove si è localizzato il transgene; Non si può regolare il numero di copie introdotte nel pronucleo, né quante si uniranno in concatameri per lintegrazione; Guadagno di funzione o perdita di funzione? Incrociamo le dita!!

16 Gene Targeting 2 Ricombinazione omologa in embrionic stem (ES) cells SCOPO : Perdita o modifica di funzione CARATTERISTICA : inserzione mirata

17 La RICOMBINAZIONE OMOLOGA è il meccanismo che permette il gene targeting AGGTGCCTGACTTTCAGCCGATCCA Gene inattivo AGGTGCCTGACTTTCAGCCGATCCA X X

18 La procedura per ottenere il gene targeting si basa su 4 fasi distinte 1. Preparazione delle ES cells pluripotenti e trasfezione 2. Selezione delle ES 3. Iniezione delle ES trasfettate in una nuova blastocisti 4. Screening della progenie

19 Preparazione del transgene La procedura per ottenere il gene targeting si basa su 4 fasi distinte Preparazione delle ES pluripotenti dalla blastocisti Elettroporazione Sequenze di ricombinazione Omologa Neo r – resistenza alla Neomicina Tk - thymidine kinase Gene non attivo 1. Preparazione delle ES cells pluripotenti e trasfezione 2. Selezione delle ES 3. Iniezione delle ES trasfettate in una nuova blastocisti 4. Screening della progenie

20 La procedura per ottenere il gene targeting si basa su 4 fasi distinte Sequenze di ricombinazione Omologa Neo r – resistenza alla Neomicina Tk - thymidine kinase Gene non attivo Trattamento con neomicina e ganciclovir X X No integrazione Integrazione sito-specifica (1/1000) Integrazione random 1. Preparazione delle ES cells pluripotenti e trasfezione 2. Selezione delle ES 3. Iniezione delle ES trasfettate in una nuova blastocisti 4. Screening della progenie

21 La procedura per ottenere il gene targeting si basa su 4 fasi distinte ES inserite in una blastocisti di topo nero 1. Preparazione delle ES cells pluripotenti e trasfezione 2. Selezione delle ES 3. Iniezione delle ES trasfettate in una nuova blastocisti 4. Screening della progenie

22 La procedura per ottenere il gene targeting si basa su 4 fasi distinte Topo chimera 1. Preparazione delle ES cells pluripotenti e trasfezione 2. Selezione delle ES 3. Iniezione delle ES trasfettate in una nuova blastocisti 4. Screening della progenie

23 Linserzione del transgene è mirata RICOMBINAZIONE OMOLOGA Si conosce la localizzazione genica dellinserimento del transgene; Problemi: espressione tempo e spazio specifica? Obiettivo raggiunto!

24 Trasferimento del nucleo di una cellula somatica in un oocita anucleato SCOPO : ottenimento di gemelli di un fenotipo di interesse Clonazione 3

25 I Cloni vengono ottenuti attraverso Somatic Cell Nuclear Transfer

26 Il materiale genetico viene copiato in toto Nuclear Transfer Le cellule somatiche da cui si preleva il nucleo possono essere ingegnerizzate prima del reimpianto.

27 Altre tipologie di Ingegneria animale

28 Animali reporter Altre tecniche, oltre a quelle classiche, sono state sviluppate in ingegneria animale Knockout condizionali 1 2

29 1 Eliminare un gene in un tessuto, in un organo o in una fase particolare di sviluppo SCOPO : ottenere informazioni più precise sulla funzione del gene; garantire il normale sviluppo del topo knockout.

30 Il sistema Cre-LoxP è uno dei sistemi più utilizzati La CRE è una RICOMBINASILOXP sono le sequenze riconosciute da CRE Gene da excidere

31 Esempio: delezione di IGF-1 fegato-specifica: topi LID (liver IGF1 specific deficient) Esone 4 LoxP Cre X Promotore dellalbumina X CRE 80% IGF-I plasmatico

32 Inserimento di un gene codificante una proteina facilmente identificabile e rilevabile SCOPO : la proteina reporter dà informazioni rapide e dinamiche sugli eventi molecolari che si vogliono studiare Animali reporter 2

33 La luciferasi è uno dei geni reporter più utilizzati nei topi Sequenze regolatorie Gene ESOGENO Emivita breve Facilmente detectabile

34 Esempio: il topo reporter ERE-Luc LuciferasiTkERE X2MAR Transgene inserito nel topo ERE-Luc

35 Applicazioni pratiche dell Ingegneria animale

36 Studio di funzione genica (ricerca di base) 1 Modelli di patologia umana Produzione di biofarmaci Screening di farmaci Produzione di organi per xenotrapianti 5 Transgenesi standard Gene targeting ClonaggioKO condizionale Animale reporter

37 Studio di funzione genica (ricerca di base) 1 Inserimento di gene (o boost dellespressione di un gene) tramite transgenesi standard Palmiter et al, Nature, 1982 Delezione di un gene tramite gene targeting

38 ESTROGEN RECEPTOR KNOCKOUT MICE Couse & Korach, Endocrine Reviews, 1999

39 Modelli di patologia umana 2 Inserimento di gene (o boost dellespressione di un gene) tramite transgenesi standard: Oncogeni (c-neu, c-myc, H-ras): tumori Antigeni di istocompatibilità: autoimmunità β-globina umana: talassemia Recettore LDL: aterosclerosi APP umana: morbo di Alzheimer Delezione di un gene tramite gene targeting: Apolipoproteina E: aterosclerosi Glucocerebrosidasi: malattia di Gaucher CFTR umana: fibrosi cistica […]

40 Esempio: modelli di overespressione di APP umana per lo studio della malattia di Alzheimer Lord A, Neurobiol Aging, 2006

41 Produzione di biofarmaci 3 + Insulina + Emoglobina + tPA + GH Produzione di proteine ricombinanti biologicamente attive nella ghiandola mammaria di animali transgenici

42 Abbondanza: 5–10g/L al giorno paragonato ad 1 g/L delle cellule. Costo Adattabilità alle richieste Funzionalità: le proteine sono folded in maniera naturale Raccolta: facile purificazione dal latte Pro/contro del biopharming Tempistiche: lunghi tempi per messa a punto e valudazione di animali transgenici Attesa della lattazione Inserzione casuale: può causare problemi allanimale

43 Screening di farmaci 4 REPORTER Promotore attivato Lattività del promotore è osservata in tempo reale e nel contesto fisiologico dellintero organismo

44 Che caratteristiche deve avere un animale reporter per permettere lo screening di farmaci? Permettere di localizzare le aree dove il composto è attivo Permettere di valutare la risposta del farmaco dopo ripetute somministrazioni Permettere la misurazione della minima dose efficace Permettere di identificare siti di accumulo in caso di somministrazioni croniche

45 Il modello ERE-Luc per lo screening di farmaci – in acuto Nelle aree del corpo dellanimale Nelle aree del cervello dellanimale

46 Il modello ERE-Luc per lo screening di farmaci – in cronico

47 Produzione di organi per xenotrapianti 5 X Rigetto dovuto alla reattività degli anticorpi umani verso le proteine endoteliali esogene (che mancano di uno zucchero, il fucosio) Inserimento in animali transgenici della fucosio-transferasi

48 Un maiale ci salverà??


Scaricare ppt "Alessia Stell Adriana Maggi Lab 2 Dicembre 2010 Ingegneria animale e animali transgenici."

Presentazioni simili


Annunci Google