La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

AUTISMO Genetica molecolare Anomalie strutturali Ambiente Inquinamento Stress ossidativo.

Presentazioni simili


Presentazione sul tema: "AUTISMO Genetica molecolare Anomalie strutturali Ambiente Inquinamento Stress ossidativo."— Transcript della presentazione:

1 AUTISMO Genetica molecolare Anomalie strutturali Ambiente Inquinamento Stress ossidativo

2 I Disturbi dello Spettro autistico (ASD) Disturbi cronici, ad eziologia sconosciuta, biologicamente determinati, ad esordio in età evolutiva, caratterizzati da: »Deficit nellinterazione sociale »Deficit nella comunicazione verbale e non verbale »Comportamenti, interessi ed attività ristretti, ripetitivi e stereotipati

3 Compromissione qualitativa dellinterazione sociale a) compromissione nelluso di svariati comportamenti non verbali, come: sguardo diretto, espressione mimica, posture corporee e gesti che regolano linterazione sociale b) incapacità di sviluppare relazioni con i coetanei adeguate al livello di sviluppo c) mancanza di ricerca spontanea nella condivisione di gioie, interessi o obiettivi con altre persone (per. es. non mostrare, portare, né richiamare lattenzione su oggetti di proprio interesse) d) mancanza di reciprocità sociale ed emotiva

4 a) ritardo o totale mancanza dello sviluppo del linguaggio parlato (non accompagnato da un tentativo di compenso attraverso modalità alternative di comunicazione come gesti o mimica) b)in soggetti con linguaggio adeguato, marcata compromissione della capacità di iniziare o sostenere una conversazione con altri c)uso di linguaggio stereotipato e ripetitivo o linguaggio eccentrico d)mancanza di giochi di simulazione vari e spontanei, o di giochi di imitazione sociale adeguati sviluppo; Compromissione qualitativa della comunicazione

5 Modalità di comportamento, interessi e attività ristretti, ripetitivi e stereotipati a) dedizione assorbente ad uno o più tipi di interessi ristretti e stereotipati anomali o per intensità o per focalizzazione b) sottomissione del tutto rigida ad inutili abitudini o rituali specifici c) manierismi motori stereotipati e ripetitivi (battere o torcere le mani o il capo, o complessi movimenti di tutto il corpo) d) persistente ed eccessivo interesse per parti di oggetti;

6 Autismo infantile l caratterizzato da sintomi in 3 diverse aree: 1.compromissione della comunicazione verbale e non verbale 2.problemi nellinterazione sociale 3.attività, modalità di comportamento ed interessi ristretti, ripetitivi e stereotipati »I sintomi insorgono nella prima infanzia (entro i 3 anni) e perdurano per tutta la vita Parte di uno spettro più ampio di disturbi fra cui la Sindrome di Asperger e altri Disturbi Generalizzati dello Sviluppo (PDD)

7 Prevalenza nella popolazione ~ 5/ >stima generalmente riportata Studi recenti hanno indicato una prevalenza più alta: 1-3/1000 definizione stringente di autismo 6/1000 disturbi dello spettro autistico La prevalenza dellautismo sta aumentando? Cambiamento graduale nei criteri diagnostici e negli strumenti diagnostici Maggiore conoscenza del disturbo Rapporto maschi/femmine ~ 3-4:1 Ritardo mentale presente in ~ 75%

8 Fattori genetici La prima descrizione risale a L.Kanner (1943) Limportanza di fattori genetici alla base dellautismo non venne riconosciuta fino alla metà anni 70 »Assenza di trasmissione verticale »Basso tasso di autismo nei fratelli di individui affetti ( 3%)

9 Importanza di fattori genetici: STUDI DI RICORRENZA FAMILIARE: RISCHIO RELATIVO R Esprime il grado di aggregazione familiare di un carattere s = rischio nei fratelli/sorelle di un affetto rischio nella popolazione generale CONCORDANZA IN GEMELLI MONOZIGOTICI/DIZIGOTICI Permettono di stabilire se laggregazione familiare e dovuta allambiente familiare in comune oppure a fattori genetici MZ = 100% geni in comune DZ = 50% geni in comune Una maggiore concordanza in gemelli MZ e indice di fattori genetici. Tuttavia: Tendenza a trattare i gemelli MZ in modo piu simile dei DZ Differenze genetiche fra gemelli MZ (geni sistema immunitario, mutazioni somatiche, pattern inattivazione X) STUDIO DI INDIVIDUI ADOTTATI Altro metodo per individuare il contributo di fattori ambientali ed effetti genetici

10 Studi di gemelli grossa disparità fra i tassi di concordanza dei gem. MZ e DZ: importanza di fattori genetici Concordanza molto bassa nei DZ: azione epistatica di più geni Concordanza per un più ampio spettro di disturbi socio-cognitivi in forma meno grave che nellautismo: broader phenotype Eterogeneità clinica Bailey et al, 1995 (same sex)

11 Studi di ricorrenza familiare Frequenza nei fratelli di probandi 3% (~ 6% per PDD) Maggiore rischio di ricorrenza rispetto alla prevalenza nella popolazione s = broader phenotype Relazione diretta fra gravità dellautismo e broader phenotype nei familiari Bolton et al, 1994

12 Studi epidemiologici: conclusioni Forte componente genetica La predisposizione genetica si estende oltre la diagnosi classica di autismo, includendo il broader phenotype Escluso modello Mendeliano monogenico Lautismo è un disturbo genetico multifattoriale, cioè non riconducibile a mutazioni di un singolo gene, ma dovuto allazione di varianti in più geni e allinterzione e con lambiente

13 Teorie Neurocognitive Teoria della Mente Deficit della Relazione Sociale Alterazione delle Funzioni Esecutive Debole Coerenza Centrale Ricerche Neurobiologiche Neuropatologia e Neuroradiologia Studi elettroencefalografici Studi Biochimico-Metabolici Genetica Anomalie intestinali e celiachia Fattori di rischio perinatali Eziologia ?

14 Mutazioni e polimorfismi actcgggctaaactttcggggcccaaactacgactagctagctactagctagctaacttcggatcggatcggatcggatc actcgggctaaactttcggggccTaaactacgactagctagctactagctagctaacttcggatcggatcggatcggatc actcg A gctaaactttcggggcccaaactacgactagcta C ctactagctagctaacttcggatcggatcggatcggatc Polimorfismi varianti di 1 tratto di DNA presenti nella popolazione con frequenze non trascurabili (>1%). In genere non patogeniche DNA proteina Mutazioni varianti rare di 1 tratto di DNA che hanno un effetto sul fenotipo STOP

15 Caratteri genetici complessi SUSCEPTIBILITY ALLELES Numero di Fattori di Rischio Frequenza Valore soglia Il carattere è influenzato da un certo numero di fattori di rischio Individualmente ciascun fatt. di rischio ha un effetto moderato. La piena manifestazione del carattere è la risultante dellazione combinata dei vari fattori di rischio

16 Caratteri genetici complessi Eterogeneità A B C Fenotipo

17 Patologie genetiche Sclerosi tuberosa Sindrome X-Fragile Anomalie cromosomiche l 15q11-q13 l 1-3 % l Duplicazioni interstiziali o [inv-dup 15] l Ereditate per via materna Associazione con condizioni genetiche conosciute Non sappiamo ancora quanti siano i geni implicati nellautismo e come questi interagiscano fra di loro e con altri fattori non genetici. Solo in una minoranza dei casi (<10%) lautismo è riconducibile ad una causa nota:

18 Come identificare i geni? Screening dellintero genoma umano analizzando un elevato numero di famiglie con almeno 2 individui affetti (multiplex) con metodi di LINKAGE non parametrici ASSOCIAZIONE ALLELICA (linkage disequilibrium mapping) Geni CANDIDATI Anomalie citogenetiche

19 Analisi di LINKAGE tradizionale (Metodi parametrici ) D1D D1D D2D D1D NRRR Dipende dalla specificazione di un modello di ereditarietà Si contano gli eventi di ricombinazione fra due loci Test: frazione di ricombinazione ( ) < 0.5

20 A,CA,CB,DA,CA,CE,GF,GF,H A,BC,DE,FG,H A,DA,HE,D A,ED,H Metodi di linkage Non-parametrici 2 alleli in comune 25% 40% 1 allele in comune 50% 55% 0 alleli in comune 25% 5% Regione qualsiasi Regione vicina ad un gene di suscettibilità Si basano sulla condivisione di alleli di un marcatore da parte di individui affetti allinterno di una stessa famiglia Famiglie con almeno 2 fratelli affetti

21 Problemi negli studi di linkage di malattie complesse Difficile stabilire la soglia di significatività MLS > 3.6? Replicazione indipendente dei risultati positivi Per replicare un risultato positivo è necessario un campione di famiglie di dimensioni molto maggiori rispetto al campione originario Picchi di linkage molto larghi ed imprecisi rispetto alla posizione del locus malattia

22 Summary of genome screen results

23 Convergenza dei risultati di linkage sul crom. 7 The shaded bars represent the linkage findings of different research groups.

24 Dagli studi di linkage allidentificazione dei geni di suscettibiltà… E probabile la presenza di fattori genetici di rischio per lautismo sui cromosomi 2, 7, 16, 17, 15, … Esame più in dettaglio delle regioni cromosomiche identificate: sono molto ampie e contengono centinaia di geni: ciascuno di essi potrebbe essere il responsabile Aumentare il numero di famiglie studiate Analisi combinata dei dati di diversi gruppi di ricerca Studio di individui affetti con anomalie cromosomiche che coinvolgono queste regioni Studio di geni candidati Studi di associazione allelica / Linkage disequilibrium mapping nuovi STUDI DI CGH array

25 Geni candidati Che tipo di geni possono essere coinvolti nellautismo? Geni che sono attivi nel cervello Geni coinvolti nello sviluppo del cervello, nella migrazione neuronale, nel metabolismo dei neurotrasmettitori… Attualmente diversi gruppi di ricerca stanno esaminando alcuni di questi geni per identificare varianti della sequenza di DNA che costituiscano dei fattori di rischio per lautismo METODO: Screening di varianti di sequenza in individui affetti (DHPLC) Test delle varianti identificate: Casi-controlli TDT

26 Reelin Ruolo fondamentale nella regolazione della migrazione di diversi tipi di neuroni durante lo sviluppo del cervello. Espressa anche nel cervello adulto, dove puo avere un ruolo nella plasticità sinaptica Topi reeler (reln-/reln-): sintomi neurologici (atassia, tremore) e alterazioni citoarchitettoniche in diverse aree del cervello (corteccia, ippocampo e cervelletto) simili a quelle descritti in studi post-mortem di indiv. autistici Topi eterozigoti reeler (reln-/+): deficit in alcuni test comportamentali; ridotta densità spine dendridiche, deficit di GAD67, riduzione post- natale del num di cell Purkinje solo nei maschi Nelluomo: mutazioni recessive causano lissencefalia

27 Reelin IIIIIIIVVVIVIIVIII F-spondin-like charged C-terminus Reelin domain 5UTR3UTR AAAAAA mRNA (GGC) n IMGSAC families (Bonora et al, Mol Psych 2003) Ex 25 N1159K Ex 35 V1762I Ex 44 R2290HEx 51 T2718A Ex25Ex35Ex44Ex51 protein Trinucleotide (GGC): trasmissione preferenziale degli alleli lunghi (Persico et al, 2001)

28 The search for susceptibility genes…

29 Conclusioni (1) e prospettive Lidentificazione di fattori genetici di rischio: Permetterà di comprendere i meccanismi patofisiologici alla base dei disturbi dello spettro autistico e dei fattori che ne influenzano lespressività. Permetterà lidentificazione di target per interventi farmacologici Costiturà la base per lo sviluppo di nuovi approcci di diagnosi ed intervento, e forse anche di prevenzione e cura. Progressi nellidentificazione di regioni cromosomiche dove sono probabilmente localizzati fattori genetici di rischio per i disturbi dello spettro autistico La complessità genetica ha reso difficile lidentificazione di geni. Fino ad oggi, un significativo coinvolgimento nellautismo non è stato ancora dimostrato per nessun gene Meta-analisi Studio del broader phenotype nei parenti di individui affetti

30 Ricerca sui segni precoci di autismo Ricerca finanziata dal Comune di Novara basata sullanalisi di filmini familiari di 9 bambini normali e di 9 bambini risultati poi autistici ripresi fra i mesi

31 A mesi il bambino interagisce con laltro coordinando i propri sforzi con linterlocutore in modo complementare, può scambiare i ruoli o aiutare laltro nella sua azione Ad es. nel costruire una torre. Uno tiene ferma la torre e laltro aggiunge i cubetti, cè un noi, ma anche un io nella misura in cui i ruoli sono differenziati, ma intercambiabili Gli autistici nelle interazioni fanno le stesse cose, recitano lo stesso ruolo

32 Item che differenziavano i 2 gruppi Gesti referenziali ( fare ciao ciao con la mano, dito davanti alla bocca per indicare silenzio, mano alla fronte per manifestare scoramento) Pointing dichiarativo ( per condividere stati emotivi) Comunicazione non verbale ( utilizzo della gestualità per comunicare)

33 Commenti Utilizzo del corpo per comunicare: la gestualità non il numero di parole differenziavano i nostri due gruppi a 15 mesi Limiti delle teorie sulla patogenesi dellautismo, in particolare della visione dualistica computazionale del rapporto mente e cervello: - mente come software con sistemi operativi - cervello come hardware

34 Ulteriori differenze tra i due gruppi Guarda negli occhi Si diverte ridendo con Si volta se viene chiamato Imita Ricerca il contatto o baci o abbracci Vocalizza

35 Commenti Si tratta di comportamenti che fanno parte dellintersoggettività primaria (Trevarthen) Linsorgenza del disturbo autistico va forse retrodatata ad un periodo precedente allattenzione congiunta, anche se la diagnosi la si fa normalmente verso i due anni o dopo Nei primi 6-9 mesi di vita, nei bambini che diventeranno autistici si osserva scarsa iniziativa del bambino autistico allinterno della relazione (anche nei casi che presentano regressione)

36 I neuroni specchio Il modello classico del funzionamento cerebrale( aree sensoriali ben differenziate da quelle associative e motorie) sembra non essere molto daiuto per capire lautismo 15 anni fa sono stati scoperti neuroni motori che si attivano non solo quando lanimale esegue una certa azione, ma anche quando la vede eseguire da un altro

37 Scoperti da Giacomo Rizzolatti,Giacomo Rizzolatti direttore del Dipartimento di neuroscienze dell'Università di Parma, "i neuroni specchio saranno per la psicologia quello che il DNA è stato per la biologia".i neuroni specchio Si tratta di cellule del cervello che si attivano sia quando compiamo una determinata azione, sia quando vediamo qualcun altro che la compie. Ci permettono di capire al volo che cosa sta facendo chi ci sta di fronte, senza che sia necessario fare un ragionamento complesso. Inoltre, preparano il nostro sistema nervoso a imitare le azioni degli altri e a entrare in empatia con ci nostri interlocutori. Neuroni Specchio. Lo specchio dell'altro

38 Questo tipo di neuroni, è stato Individuato nei primati, (Lemuri, scimmie e uomo moderno) e in alcuni uccelli. Nelluomo è localizzato: nellarea di Broca e nella corteccia parietale inferiore del cervello.

39 Quando vedo una persona compiere unazione, inconsciamente simulo dentro di me quel movimento e così, riconducendola al mio repertorio motorio riesco a darle significato Nel sistema Mirror sensorialità e motricità operano sinergicamente in parallelo e non in successione temporale Il piacere che proviamo quando assistiamo a film o a rappresentazioni teatrali è riconducibile in parte ai nostri neuroni specchio

40 Funzioni dei Neuroni Specchio Aiutano a capire il significato di quanto laltro sta facendo Ci permettono di comprendere le sue intenzioni e quindi di prevederne i comportamenti Favoriscono limitazione e quindi lapprendimento Favoriscono la comunicazione

41 Neuroni specchio eco Quando giunge loro uno suono verbale lo traducono nel piano articolatorio necessario per produrlo La registrazione di potenziali motori dei muscoli linguali amplificati mentre il soggetto ascolta fonemi linguo-palatali ci aiuta a capire i rapporti tra sensorialità e motricità

42 Sviluppo del Sistema Mirror I neuroni specchio si svilupperebbero grazie al rapporto continuo di imitazione reciproca tra madre e bambino Il bambino cioè associa i propri piani motori con gli stimoli visivi grazie allazione di specchio esercitata dal caregiver Dapretto ha evidenziato una netta correlazione tra attività dei neuroni specchio e gravità della malattia autistica

43 Viso materno e sistema mirror Hanno funzioni speculari Il viso materno riflette al bambino il suo stato emotivo, la sua attività motoria, ripresenta dallesterno quanto il bambino vive allinterno I neuroni specchio ricostruiscono allinterno del bambino, attraverso la simulazione, quanto osserva allesterno In questo modo il bambino ha quasi sempre a disposizione due versioni della propria realtà interna o esterna

44 Deficit sistema mirror e autismo La disponibilità di una doppia versione della realtà favorisce i processi di simbolizzazione partendo dalla corporeità Nel bambino autistico maggior difficoltà nella comprensione della realtà esterna, ma anche difficoltà nellutilizzo del viso materno, poco leggibile Inoltre ricorrerà meno alla madre per difendersi dal sovraccarico esperienziale

45 Difficoltà per il raggiungimento dello stadio del noi che di solito accompagna quello dellindividuazione e che è alla base della socialità Il deficit dei Neuroni Specchio potrebbe essere causa, concausa o effetto secondario. Ad es. negli autistici precocemente si instaurano schemi anomali di fissazione visiva: guardano meno negli occhi, privilegiano la bocca o gli oggetti

46 Per queste ragioni ci pare che il deficit autistico sia sensoriale-motorio nella misura in cui lo stimolo sensoriale non può essere adeguatamente rivissuto attraverso la simulazione incarnata Per vicariare i suoi deficit il bambino autistico potenzia al massimo il canale visivo per controllare a posteriori ciò che non può anticipare Lesperienza sensoriale risulterà in mancanza di un baricentro frammentata, poco modulabile e categorizzabile, spesso bizzarra

47 Il deficit del sistema mirror altera la relazione del bambino con i suoi genitori. Diverse ricerche mostrano che in genere i genitori tendono a divenire più attivi, energici e a privilegiare stimolazioni fisiche altri potrebbero essere meno motivati alla relazione col loro piccolo A livello ipotetico possiamo affermare che prima ancora di interventi riabilitativi specifici occorre supportare i genitori nel potenziare lazione di intervento riflessivo sul bambino per cercare in parte di sostituire e in parte di stimolare il sistema mirror che diversamente potrebbe non essere stimolato a sufficienza.

48 Paradigma Biomedico (U.S.A.) risultato di osservazioni cliniche E una malattia organica ed è curabile ? Intervenire precocemente…fa la differenza!!!!

49 Sindromi autistiche Associate ad alterazioni Gastro- Intestinali Insufficienza digestiva,Malassorbimento Deficit nutrizionali( vit A,D,E,minerali, AA essenziali, precursori neurotrasmettitori) Carenze di processi biochimici (trans- sulfurazione,Trans-metilazione), maggior sensibilità allo stress ossidativo

50 Epidemia? Incidenza : nati v. Con picchi locali di 50: (U.S.A.) 2004 : 6 su 1000 nati vivi, 30 volte più di prima del 1985 ( Europa) Lombardia, da 15 : a 90 : (per intero spettro autistico,dati dellosservatorio regionale),mediamente 1 :166 ; ultimi dati USA 1: 150

51 Autismo Regressivo, 80 % Bambini normali alla nascita e sviluppo regolare,regressione brusca o insidiosa,sintomi riconosciuti dai genitori a15-18 mesi Assenza di specifiche alterazioni genetiche o di quadri sindromici ; Nessuna guarigione spontanea, porta a disabilità grave con ripercussioni tragiche su ragazzi e famiglia

52 Vecchi e Nuovi Paradigmi (Medicina Accademica) Mamma frigorifero (Bettleheim,1950) Non – malattia, modo di essere (NPI) Malattia genetica(tuttavia nessun riscontro di un gene per lautismo,bensì polimorfismi genici che potrebbero spiegare una maggior suscettibilità ) Aumento dellautismo non e reale ma apparente, dovuto a miglior diagnosi

53 Ma …Se lincidenza dellAutismo e sempre stata quella odierna, dove sono tutti gli adulti autistici che dovremmo avere, istituzionalizzati o meno ?

54 Vecchi e Nuovi Paradigmi (Medicina Accademica) Autismo non e guaribile né curabile psicoterapia,spesso alla famiglia, Psicofarmaci,antiepilettici anche senza epilessia; trattamento comportamentale TEACH Di autismo non si muore

55 Paradigma Biomedico (U.S.A.) risultato di osservazioni cliniche E una malattia organica ed è curabile

56 Sindromi autistiche Associate ad alterazioni Gastro- Intestinali Insufficienza digestiva,Malassorbimento Deficit nutrizionali( vit A,D,E,minerali, AA essenziali, precursori neurotrasmettitori) Carenze di processi biochimici (trans- sulfurazione,Trans-metilazione), maggior sensibilità allo stress ossidativo

57 Sindromi autistiche Basso livello di AA solforati e di solfati, GSH e cisteina nel plasma deficit taurina Basso livello sierico e cellulare di zinco,selenio ; Rame sierico elevato Elevato Cu/Zn Ammonio elevato Alterazione acidi grassi omega 3 e 6

58 Sindromi autistiche Omocisteina elevata ac. Formimmino glutamico elevato Ac. Metilmalonico elevato

59 Sindromi autistiche Squilibrio TH 1/ TH 2 Autoimmunita Infezioni frequenti ( otiti) Deficit Immunoglobuline

60 Sindromi autistiche Disbiosi grave Convulsioni farmacoresistenti, spesso EEG silente Alterazioni neurosensoriali

61 Malattia Genetica? Nessun riscontro di un gene per lautismo Sono stati trovati polimorfismi genici che potrebbero spiegare una maggior suscettibilità analogia con Alzheimer (Apo E 4 /ApoE2)

62 Nuovo paradigma Predisposizione Genetica Ambiente Spettro autistico

63 Nuovo paradigma

64 Sindroni autistiche lespressione neurologica dellimpatto che le tossine ambientali hanno su individui suscettibili

65 Inquinamento Ambientale

66 Ogni giorno.. Piu di additivi alimentari,solo alcuni sono testati nei loro effettio tossici Ftalati nella plastica Cosmetici, prodotti per ligiene intima Materiali per la pulizia della casa, mobili Pesticidi, bifenili, concimi.anti muffa su vegetali ; il caso del DDT

67 Ogni giorno.. centinaia di nuove molecole chimiche vengono immesse nellambiente senza essere controllate nei lor effetti sullorganismo animale e sul pianeta

68 Alimentazione sofisticata Manipolazioni industriali degli alimenti : Aggiunta di glutine alle farine per la panificazione Essicazione industriale Uso di sbiancanti Precucinati /surgelati Uova colorate Additivi e conservanti Coloranti Frutta e verdura doltreoceano

69 Metalli pesanti

70 Fattori ambientali Fattori di rischio prenatali »Esposizione in utero a talidomide o acido valproico »Infezione da virus rosolia Fattori di rischio ambientali »Infezioni (cytomegalovirus, herpes) »Mercurio »Fattori nutrizionali »Vaccino trivalente (MMR)

71 Vaccinazioni Vaccini antiinfettivi : Mercurio Alluminio,virus attenuati vaccinali, virus inquinanti,materiale biologico

72 Vaccini : altri ingredienti Alluminio,formaldeide,fenossietanolo, Polisorbati 20 e 80,siero di pollo, di bovino, cellule di rene di scimmia, di montone, Antibiotici,cellule umane diploidi Vaccini MMR non contengono Thiomersal,bensì virus vivi attenuati

73 Stressori ambientali Alimentazione : glutine e caseina/ DPPIV Infezioni subcliniche Autoimmunità :Ab anti-mielina e anti-glia Disfunzione metallotioneina

74 Infezioni / 1 alcuni bambini migliorano durante trattamenti antibiotici SBEA (Corea reumatica, PANDAS) Borrelia Burgdorferi (Spirocheta )e malattia di Lyme Beneficio con HBOT e terapie antibiotiche parenterali

75 Infezioni / 2 Virus neurotropi sono associati a alterazioni neurologiche quali convulsioni,demielinizzazione,ritardato sviluppo del linguaggio Sottogruppo di bambini autistici ha elevati titoli anticorpali antivirus ; taluni rispondono ai farmaci antivirali

76 .. tutto cio che porta a Cattivo stato nutrizionale dellorganismo in crescita Esposizione a tossici cerebrali che provengono sia dall ambiente che dal metabolismo perturbato del bambino stesso Attivazione infiammazione diffusa,specie a livello cerebrale e intestinale

77 Peptidi oppiati e neurolettici Gluteomorfine, Casomorfine HK 1,HK 2,P1,P2 Deltorfine e dermorfine ( lieviti ?) Tri-peptidi serotoninergici Molecole neurolettiche non peptidiche

78 Disfunzione mitocondriale (ammonio,lattato e piruvato alti,deficit Carnitina) Difetti di metilazione,sulfatazione,GSH Disbiosi grave Maldigestione,Malassorbimento Infiammazione gastrointestinale Effetto degli stressori sullorganismo

79 Alterazioni immunologiche alterazione Th1/Th2, aumento Citokine infiammatorie,attivazione microglia autoimmunita,diminuzione attivita LK Aumento dello stress ossidativo

80 Effetto degli stressori sullorganismo Meccanismo della eccitotossicita per alterata modulazione funzionale del glutamato

81 Suscettibilita individuali

82 Maschi e femmine M : F = 4:1 Testosterone Glutatione reduttasi

83 Suscettibilita individuale Insufficienze digestive primarie( DPPIV) Alterazioni della circolazione liquorale ( cisti aracnoidee, anomalie cranio- facciali e del giunto cranio-occipitale) Alterazioni del sistema delle fasce

84 Suscettibilita individuali Alterazioni immunitarie congenite Disfunzione congenita della metallotioneina

85 Suscettibilita individuale Maggior sensibilita primitiva ai tossici ambientali (deficit su base genetica metil-tetra-idrofolotoreduttasi ) Maggior fragilita costituzionale Difficolta primitiva ad eliminare tossine

86 Suscettibilita acquisite

87 Suscettibilita acquisita Sofferenza perinatale, prematurita,terapie antibiotiche perinatali terapie antibiotiche protratte nei primi due anni di vita, terapie cortisoniche ripetute e protratte Intolleranze alimentari multiple e persistenti, difficolta della alimentazione

88 Suscettibilita acquisita Infezioni ricorrenti Disbiosi grave, specie fungina Candidosi persistente o ricorrente Traumi cranici e del rachide nel primo anno di vita Esposizione a tossici ambientali prima della nascita e nei primi due anni di vita

89 Fattori di rischio Familiarita per la malattia Problemi gastroententerologici nel primo anno di vita Terapie antibiotiche protratte e/o ricorrenti nei primi due anni di vita Vaccinazioni multiple Sofferenza perinatale Anomalie craniofacciali, Arnold-Chiari

90 Fattori di rischio Traumi cranici e sacrali nel primo anno di vita Candidiasi gastrointestinale Infezioni ricorrenti /peristenti nei primo anno di vita Malnutrizione Mamme con molte amalgame Vivere in aree a forte inquinamento

91 Prevenzione/1 Ridurre I fattori di rischio Curarsi per non ammalarsi

92 Prevenzione/2 Proteggere fratellini /sorelline Proteggere nuove gravidanze

93 Prevenzione /1 Promuovere e sostenere lo sviluppo dellimmunità naturale e la detossificazione

94 Prevenzione /2 Sostenere le fragilità intrinseche della costituzione x ridurre impatto ambientale

95 Prevenzione /3 Sostenere organismo infantile durante la crescita, riducendo la suscettibilità secondaria a Infezioni ricorrenti,allergie,salute intestinale,traumi,terapie antibiotiche, steroidee, cattiva digestione

96

97 Terapia Biomedicadi base Nata in USA : dieta GF/CF/SF,diete prive di carboidrati, a basso contenuto di ossalati,fenoli;Supplementi nutrizionali (vitamine,minerali,AA,Proteine,enzimi digestivi,probiotici)farmaci antifungini, antibiotici,antivirali ;Chelazione dai metalli pesanti,orale o TD; di recente inserita HBOT I bambini migliorano ma è cè spazio per un recupero più consistente,specie per i più grandi e compromessi

98 Trattamenti avanzati Hyperbaric Oxigen Therapy, mild / high Miglioramenti consistenti,ma permane la tendenza a riacutizzare i sintomi comportamentali

99 Trattamenti avanzati Supplementi per via venosa Detossificazione per via venosa Chelazione per via venosa in associazione ( recente ) Sensory Learning Program ® intervento dietetico e nutrizionale di base Risultati ottimi e stabili ad ogni eta

100 Approccio olistico Considerare la specificita della persona e della espressione della sua malattia Considerare tutti gli ambiti della malattia (emozionale e familiare compresi) Il recupero educativo / cognitivo deve essere associato

101 Approccio olistico il bambino o ragazzo deve diventare partecipe del processo di cura Lambito emozionale familiare deve essere considerato

102 Trattamenti di recupero cognitivo e comportamentale,nei piei pz Bambino piccolo : il recupero precoce Bambino grandicello : recupero educativo + cognitivo Ragazzo : educativo q.b. + cognitivo Programma personalizzato Collaborazione tra medico e terapisti del recupero

103 Trattamenti comportamentali e cognitivi Assai diversi tra loro Non tutti hanno la stessa valenza Non devono essere il fine ma il mezzo per il miglioramento

104 Andare avanti.. Nelle lacrime abbiamo trovato il sentiero giusto Tanto è stato fatto ma ancora non tutte le strade ed i sentieri sono stati percorsi… Senza paura e senza angoscia bisogna andare oltre, studiando per aggiungere ogni giorno una tessera in piu al grande mosaico…

105


Scaricare ppt "AUTISMO Genetica molecolare Anomalie strutturali Ambiente Inquinamento Stress ossidativo."

Presentazioni simili


Annunci Google