La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Biologia Molecolare Caratterizzazione di un gene clonato.

Presentazioni simili


Presentazione sul tema: "Biologia Molecolare Caratterizzazione di un gene clonato."— Transcript della presentazione:

1 Biologia Molecolare Caratterizzazione di un gene clonato

2 Il sequenziamento Sequenziare significa determinare la successione dei monomeri che costituiscono un polimero biologico PROTEINE (sequenza di Aminoacidi) DNA (sequenza di nucleotidi) DNA Genomico cDNA

3 Principi del sequenziamento del DNA Molte tecniche di biologia molecolare si basano sulla possibilità di replicare molecole di DNA in vitro: -Molecola stampo -Nucleotidi trifosfato -DNA polimerasi -Primers -Appropriato buffer di reazione

4 La replicazione del DNA I Nucleotidi utilizzati durante questa sintesi non sono nucleotidi normali (cioè nucleosidi-fosfato) ma sono nucleosidi trifosfato. Questi legami fosfato sono legami ad alta energia, la loro rottura e la liberazione del pirofosfato fornisce energia più che sufficiente per la generazione del nuovo legame covalente tra un nucleotide e un altro

5 Metodo di Sanger

6

7 Sequenziamento automatico Stesso principio del metodo di Sanger Il primer o i ddNTP sono marcati con un marcatore fuorescente Lettura tramite laser della molecola appena questa esce dal gel Utilizzo di una sola corsia –Se si marca il primer? –Se si marcano i ddNTP Gel di poliacrillamide o capillare Dato di sequenza acquisito automaticamente e trasferito al computer

8 Interpretazione automatica del dato elettroferogramma

9 Allungare la sequenza Con i metodi automatici è possibile ottenere sequenze oltre il migliaio di basi Con lallungamento della sequenza diminuisce la risoluzione e lintensità del segnale Aumento probabilità che una struttura secondaria termini la sintesi Laffidabilità diminuisce allontanandosi dal primer

10 Walking

11 Sequenziamento shotgun Per sequenziare un frammento lungo la migliore stratgia è quella di dividerlo in framenti più piccoli. Il DNA può essere frammentato e clonato in una librerie M13 o in plasmidi. La libreria deve contenere frammenti parzialmente sovrapposti Dalla libreria si prelevano cloni a caso e si sequenziano

12 Sequenziamento shotgun

13 Diminuzione della produttività Una accurata determinazione del 90% della sequenza può essere ottenuta molto rapidamente Per ottenere un ulteriore 9% sarà necessario un tempo paragonabile a quello utilizzato per ottenere il 90% Una quantità simile di lavoro sarà necessaria per ottenere un ulteriore 0,9%

14 Effettuata da alcuni virus a RNA chiamati retrovirus Il flusso dellinformazione genica Il dogma centrale della biologia Linformazione genica è contenuta nel DNA Questa informazione è perpetuata nelle generazioni future tramite il processo semiconservativo chiamato duplicazione del DNA Lespressione della informazione genica è invece un processo che passa attraverso un intermediario transitorio: lRNA messaggero. Questa molecola è sintetizzata sulla base di uno STAMPO sul DNA e linformazione in esso contenuta serve per dirigere la sintesi di proteine. Linformazione passa (quasi) sempre dal DNA allRNA e da questo alle proteine. DNARNAProteina TrascrizioneTraduzione Mantenimento dellinformazione Trasferimento dellinformazioneRuolo funzionale Informazione contenuta nella sequenza Informazione contenuta nella sequenza e nella quantità Informazione contenuta nella struttura e nella quantità Retrotrascrizione

15 IL DNA: natura ed informazione Contenuto informativo del DNA La struttura del DNA è costante. Il DNA è sempre una doppia elica INDIPENDENTEMENTE dalla sequenza di nucleotidi che lo compone. Lossatura di zucchero e fosfato è costante. La parte variabile, e quindi più informativa, è rappresentata dalla sequenza di BASI AZOTATE. Per questo motivo, in bioinformatica, linformazione contenuta nel DNA è rappresentata da una stringa composta da un alternanza 4 caratteri che rappresentano le basi azotate del DNA. GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGG AGCTGAGGAGCGGGGCCCGGCCAGGGCTGGAGACTTTGCGCCCGGGGGCACCGGGGCTGCGCGCGG TCGCACACATCCACCGGCGCGGCTTCCCTCGGCGGCCCGGGCTCCGCTCATCCTGCGGCGGGCGGCG CCGCTCAGGGGCGGGAAGAGGAGGCGGTAGACGCGACCACAGAAGATGTCGGGCCAAACGCTCACGG ATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCTCTGCTGTAGCAAGAGCGGTCTGCAAAGCCACTA CTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGATCCAGGCTACCAACGAGACCAATGT TAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGGGTGGTTGTGTTTAAG GCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTCTAGAAATA CACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAA

16 I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La maggior parte dei geni codifica proteine, che sono le macromolecole maggiormente coinvolte nei processi biochimici e metabolici della cellula. Altri geni non codificano proteine, ma producono RNA non codificante, che può giocare un ruolo fondamentale nella sintesi delle proteine e nell'espressione genica (La trascrizione del DNA in RNA e la traduzione dell'RNA in proteina). Parte del contenuto dei geni non viene trascritto, ma può coordinare la stessa espressione genica. Tra queste regioni figurano i promotori, i terminatori e gli introni.

17 Struttura del gene

18 Non tutti gli esoni codificano Gli esoni sono normalmente codificanti, ad eccezione di quelli alle estremità 5' e 3' del gene. Tali esoni prendono il nome di UTR (UnTranslated Region). In questo caso il 5' UTR è costituito da tutto il 1° esone e da parte del 2° esone (regione arancione). La regione codificante è indicata in blu, inizia nel 2° esone e termina nell'ultimo esone. Il 3' UTR è costituito da parte dell'ultimo esone (regione gialla). Introni Esoni

19 I Geni Il gene è lunità ereditaria e funzionale degli organismi viventi; ad esso sono associate molteplici informazioni: Gene Sequenze omologhe in altri genomi Analisi Filogenetica Sequenza Localizzazione genomica Struttura Proteina (Funzione)

20 Le sequenze biologiche Le sequenze nucleotidiche vengono rappresentate mediante stringhe su un alfabeto di 4 caratteri (A, C, G, T), nelle quali ciascun carattere rappresenta un singolo nucleotide. Analogamente le sequenze proteiche (o aminoacidiche) vengono rappresentate mediante stringhe su un alfabeto di 20 caratteri, ciascuno dei quali rappresenta un singolo aminoacido.

21 Lo Standard IUB/IUPAC Aminoacidi AAlaninaBAcido Aspartico o AsparaginaCCisteina DAcido AsparticoEAcido GlutammicoFFenilalanina GGlicinaHIstidinaIIsoleucina KLisinaLLeucinaMMetionina NAsparaginaPProlinaQGlutammina RArgininaSSerinaTTreonina USelenocisteinaVValinaWTriptofano YTirosinaZAcido Glutammico o GlutamminaXQualsiasi (Any) *Stop traduzione-Gap Acidi Nucleici AAdeninaRG o A (Purine)BG T C CCitosinaYT o C (Pirimidine)DG A T GGuaninaKG o THA C T TTiminaMA o CVG C A UUracileWA o TNA C G T (Any) -Gap

22 NCBINCBI NCBI (National Center for Biotechnology Information) è listituto americano che ospita GenBank, una delle tre banche dati primarie di sequenze nucleotidiche (http://www.ncbi.nlm.nih.gov). Oltre a GenBank in NCBI sono disponibili numerosi altri Database tra cui: –GenPept: Database di sequenze proteiche –Gene: Database di geni –Pubmed: Database di letteratura biomedica (Abstract, articoli e citazioni) NCBI offre anche svariati strumenti per lanalisi di dati biologici tra cui BLAST, un tool che permette di effettuare ricerche per similarità nei database di sequenze.

23 EntrezEntrez I vari database di NCBI sono accessibili mediante un unico motore di ricerca che prende il nome di Entrez:

24 Esempio di ricerca: BAX (1) Ricerchiamo i dati relativi al gene BAX utilizzando Entrez: Otterremo i risultati suddivisi per categoria:

25 Esempio: BAX (2) Nella pagina dei risultati relativi alle sequenze nucleotidiche clicchiamo sul link alla sequenza cercata: A questo punto otterremo la pagina coi risultati (formato GenBank), che andiamo a vedere nel dettaglio nella prossima slide.

26 Esempio: BAX (3) Lunghezza della sequenza Tipo di sequenza Accession Number Organismo Riferimenti bibliografici

27 Esempio: BAX (4) Link alla regione codificante Estremi della CDS Link alla proteina corrispondente

28 Esempio: BAX (5) Cliccando su CDS otteniamo la regione codificante della sequenza:

29 Il formato FASTA E possibile scegliere il formato di visualizzazione della sequenza; scegliamo il formato più utilizzato, il FASTA. E anche possibile inviare la sequenza nel formato prescelto direttamente su file (Send to -> File).

30 Esempio: BAX (6) A questo punto andiamo a visualizzare la proteina codificata cliccando sul link relativo; si aprirà una pagina simile a quella vista per la sequenza nucleotidica (formato GenPept):A questo punto andiamo a visualizzare la proteina codificata cliccando sul link relativo; si aprirà una pagina simile a quella vista per la sequenza nucleotidica (formato GenPept):

31 Esempio: BAX (7) Facciamo adesso un passo indietro tornando alla schermata di Entrez. Clicchiamo su Gene:

32 Esempio: BAX (8) Verrà visualizzata una pagina con informazioni dettagliate sul gene: Nome del gene e specie di appartenenza Informazioni varie sul gene, tassonomia, tipo, breve descrizione Accession Number della entry di Gene

33 Esempio: BAX (9) Scorrendo la pagina si trovano le informazioni strutturali: Accession number della sequenza del gene Struttura delle isoforme del gene (in blu la regione non tradotta, in rosso la regione codificante) Accession numbers dei rispettivi geni (GenBank) Accession number delle rispettive proteine (GenPept)

34 Esempio: BAX (10) Informazioni sulla localizzazione genomica Cromosoma Coordinate posizionali BAX e suo orientamento Geni limitrofi e relativo orientamento

35 Esempio: BAX (11) In fondo alla pagina troviamo ulteriori inf. : Informazioni generali sulla funzione e sui processi biologici interessati. Omologhi del gene in altre specie Fenotipo (modo in cui si manifesta la funzione della proteina codificata) Pathways: cascate di reazioni allinterno delle quali è coinvolta la proteina codificata Varianti del gene Sequenze correlate

36 La Gene Table E possibile scegliere dalla tendina in alto a sinistra, di visualizzare la Gene Table: La Gene Table mostra i confini di esoni ed introni del gene:


Scaricare ppt "Biologia Molecolare Caratterizzazione di un gene clonato."

Presentazioni simili


Annunci Google