La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Caratterizzazione di un gene clonato

Presentazioni simili


Presentazione sul tema: "Caratterizzazione di un gene clonato"— Transcript della presentazione:

1 Caratterizzazione di un gene clonato
Biologia Molecolare Caratterizzazione di un gene clonato

2 Il sequenziamento Sequenziare significa determinare la successione dei monomeri che costituiscono un polimero biologico PROTEINE (sequenza di Aminoacidi) DNA (sequenza di nucleotidi) DNA Genomico cDNA

3 Principi del sequenziamento del DNA
Molte tecniche di biologia molecolare si basano sulla possibilità di replicare molecole di DNA in vitro: Molecola stampo Nucleotidi trifosfato DNA polimerasi Primers Appropriato buffer di reazione

4 La replicazione del DNA
I Nucleotidi utilizzati durante questa sintesi non sono nucleotidi normali (cioè nucleosidi-fosfato) ma sono nucleosidi trifosfato. Questi legami fosfato sono legami ad alta energia, la loro rottura e la liberazione del pirofosfato fornisce energia più che sufficiente per la generazione del nuovo legame covalente tra un nucleotide e un altro

5 Metodo di Sanger

6 Metodo di Sanger

7 Sequenziamento automatico
Stesso principio del metodo di Sanger Il primer o i ddNTP sono marcati con un marcatore fuorescente Lettura tramite laser della molecola appena questa esce dal gel Utilizzo di una sola corsia Se si marca il primer? Se si marcano i ddNTP Gel di poliacrillamide o capillare Dato di sequenza acquisito automaticamente e trasferito al computer

8 Interpretazione automatica del dato
elettroferogramma

9 Allungare la sequenza Con i metodi automatici è possibile ottenere sequenze oltre il migliaio di basi Con l’allungamento della sequenza diminuisce la risoluzione e l’intensità del segnale Aumento probabilità che una struttura secondaria termini la sintesi L’affidabilità diminuisce allontanandosi dal primer

10 Walking

11 Sequenziamento shotgun
Per sequenziare un frammento lungo la migliore stratgia è quella di dividerlo in framenti più piccoli. Il DNA può essere frammentato e clonato in una librerie M13 o in plasmidi. La libreria deve contenere frammenti parzialmente sovrapposti Dalla libreria si prelevano cloni a caso e si sequenziano

12 Sequenziamento shotgun

13 Diminuzione della produttività
Una accurata determinazione del 90% della sequenza può essere ottenuta molto rapidamente Per ottenere un ulteriore 9% sarà necessario un tempo paragonabile a quello utilizzato per ottenere il 90% Una quantità simile di lavoro sarà necessaria per ottenere un ulteriore 0,9%

14 Il flusso dell’informazione genica
Il dogma centrale della biologia L’informazione genica è contenuta nel DNA Questa informazione è perpetuata nelle generazioni future tramite il processo semiconservativo chiamato duplicazione del DNA L’espressione della informazione genica è invece un processo che passa attraverso un intermediario transitorio: l’RNA messaggero. Questa molecola è sintetizzata sulla base di uno STAMPO sul DNA e l’informazione in esso contenuta serve per dirigere la sintesi di proteine. L’informazione passa (quasi) sempre dal DNA all’RNA e da questo alle proteine. Mantenimento dell’informazione Trasferimento dell’informazione Ruolo funzionale Trascrizione Traduzione DNA RNA Proteina Retrotrascrizione Informazione contenuta nella sequenza Informazione contenuta nella sequenza e nella quantità Informazione contenuta nella struttura e nella quantità Effettuata da alcuni virus a RNA chiamati retrovirus

15 IL DNA: natura ed informazione
Contenuto informativo del DNA La struttura del DNA è costante. Il DNA è sempre una doppia elica INDIPENDENTEMENTE dalla sequenza di nucleotidi che lo compone. L’ossatura di zucchero e fosfato è costante. La parte variabile, e quindi più informativa, è rappresentata dalla sequenza di BASI AZOTATE. Per questo motivo, in bioinformatica, l’informazione contenuta nel DNA è rappresentata da una stringa composta da un alternanza 4 caratteri che rappresentano le basi azotate del DNA. GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGGAGCTGAGGAGCGGGGCCCGGCCAGGGCTGGAGACTTTGCGCCCGGGGGCACCGGGGCTGCGCGCGGTCGCACACATCCACCGGCGCGGCTTCCCTCGGCGGCCCGGGCTCCGCTCATCCTGCGGCGGGCGGCGCCGCTCAGGGGCGGGAAGAGGAGGCGGTAGACGCGACCACAGAAGATGTCGGGCCAAACGCTCACGGATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCTCTGCTGTAGCAAGAGCGGTCTGCAAAGCCACTACTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGATCCAGGCTACCAACGAGACCAATGTTAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGGGTGGTTGTGTTTAAGGCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTCTAGAAATACACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAA

16 I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La maggior parte dei geni codifica proteine, che sono le macromolecole maggiormente coinvolte nei processi biochimici e metabolici della cellula. Altri geni non codificano proteine, ma producono RNA non codificante, che può giocare un ruolo fondamentale nella sintesi delle proteine e nell'espressione genica (La trascrizione del DNA in RNA e la traduzione dell'RNA in proteina). Parte del contenuto dei geni non viene trascritto, ma può coordinare la stessa espressione genica. Tra queste regioni figurano i promotori, i terminatori e gli introni .

17 Struttura del gene

18 Non tutti gli esoni codificano
Gli esoni sono normalmente codificanti, ad eccezione di quelli alle estremità 5' e 3' del gene. Tali esoni prendono il nome di UTR (UnTranslated Region). In questo caso il 5' UTR è costituito da tutto il 1° esone e da parte del 2° esone (regione arancione). La regione codificante è indicata in blu, inizia nel 2° esone e termina nell'ultimo esone. Il 3' UTR è costituito da parte dell'ultimo esone (regione gialla). Introni Esoni

19 I Geni Il gene è l’unità ereditaria e funzionale degli organismi viventi; ad esso sono associate molteplici informazioni: Analisi Filogenetica Struttura Proteina (Funzione) Sequenze omologhe in altri genomi Gene Sequenza Localizzazione genomica

20 Le sequenze biologiche
Le sequenze nucleotidiche vengono rappresentate mediante stringhe su un alfabeto di 4 caratteri (A, C, G, T), nelle quali ciascun carattere rappresenta un singolo nucleotide. Analogamente le sequenze proteiche (o aminoacidiche) vengono rappresentate mediante stringhe su un alfabeto di 20 caratteri, ciascuno dei quali rappresenta un singolo aminoacido.

21 Lo Standard IUB/IUPAC Acidi Nucleici A Adenina R G o A (Purine) B
G T C C Citosina Y T o C (Pirimidine) D G A T G Guanina K G o T H A C T T Timina M A o C V G C A U Uracile W A o T N A C G T (Any) - Gap Aminoacidi A Alanina B Acido Aspartico o Asparagina C Cisteina D Acido Aspartico E Acido Glutammico F Fenilalanina G Glicina H Istidina I Isoleucina K Lisina L Leucina M Metionina N Asparagina P Prolina Q Glutammina R Arginina S Serina T Treonina U Selenocisteina V Valina W Triptofano Y Tirosina Z Acido Glutammico o Glutammina X Qualsiasi (Any) * Stop traduzione - Gap

22 NCBI NCBI (National Center for Biotechnology Information) è l’istituto americano che ospita GenBank, una delle tre banche dati primarie di sequenze nucleotidiche (http://www.ncbi.nlm.nih.gov). Oltre a GenBank in NCBI sono disponibili numerosi altri Database tra cui: GenPept: Database di sequenze proteiche Gene: Database di geni Pubmed: Database di letteratura biomedica (Abstract, articoli e citazioni) NCBI offre anche svariati strumenti per l’analisi di dati biologici tra cui BLAST, un tool che permette di effettuare ricerche per similarità nei database di sequenze.

23 Entrez I vari database di NCBI sono accessibili mediante un unico motore di ricerca che prende il nome di Entrez:

24 Esempio di ricerca: BAX (1)
Ricerchiamo i dati relativi al gene BAX utilizzando Entrez: Otterremo i risultati suddivisi per categoria:

25 Esempio: BAX (2) Nella pagina dei risultati relativi alle sequenze nucleotidiche clicchiamo sul link alla sequenza cercata: A questo punto otterremo la pagina coi risultati (formato GenBank), che andiamo a vedere nel dettaglio nella prossima slide.

26 Esempio: BAX (3) Tipo di sequenza Lunghezza della sequenza
Accession Number Organismo Riferimenti bibliografici

27 Esempio: BAX (4) Link alla regione codificante Estremi della CDS
Link alla proteina corrispondente

28 Esempio: BAX (5) Cliccando su “CDS” otteniamo la regione codificante della sequenza:

29 Il formato FASTA E’ possibile scegliere il formato di visualizzazione della sequenza; scegliamo il formato più utilizzato, il FASTA. E’ anche possibile inviare la sequenza nel formato prescelto direttamente su file (Send to -> File).

30 Esempio: BAX (6) A questo punto andiamo a visualizzare la proteina codificata cliccando sul link relativo; si aprirà una pagina simile a quella vista per la sequenza nucleotidica (formato GenPept):

31 Esempio: BAX (7) Facciamo adesso un passo indietro tornando alla schermata di Entrez. Clicchiamo su Gene:

32 Esempio: BAX (8) Verrà visualizzata una pagina con informazioni dettagliate sul gene: Accession Number della entry di Gene Informazioni varie sul gene, tassonomia, tipo, breve descrizione Nome del gene e specie di appartenenza

33 Accession number della sequenza del gene
Esempio: BAX (9) Scorrendo la pagina si trovano le informazioni strutturali: Accession number della sequenza del gene Struttura delle isoforme del gene (in blu la regione non tradotta, in rosso la regione codificante) Accession numbers dei rispettivi geni (GenBank) Accession number delle rispettive proteine (GenPept)

34 Esempio: BAX (10) Informazioni sulla localizzazione genomica
Coordinate posizionali Cromosoma BAX e suo orientamento Geni limitrofi e relativo orientamento

35 Esempio: BAX (11) In fondo alla pagina troviamo ulteriori inf. : Pathways: cascate di reazioni all’interno delle quali è coinvolta la proteina codificata Fenotipo (modo in cui si manifesta la funzione della proteina codificata) Informazioni generali sulla funzione e sui processi biologici interessati. Omologhi del gene in altre specie Sequenze correlate Varianti del gene

36 La Gene Table E’ possibile scegliere dalla tendina in alto a sinistra, di visualizzare la Gene Table: La Gene Table mostra i confini di esoni ed introni del gene:


Scaricare ppt "Caratterizzazione di un gene clonato"

Presentazioni simili


Annunci Google