La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

U2BP 3 5 AAG GCA 47 51 52 A AAGGCA 47 52 AAAAA. AAG GCA 51 47 52 AAGGCA 47 52 AAAAA U1 or U7 Double 3 5.

Presentazioni simili


Presentazione sul tema: "U2BP 3 5 AAG GCA 47 51 52 A AAGGCA 47 52 AAAAA. AAG GCA 51 47 52 AAGGCA 47 52 AAAAA U1 or U7 Double 3 5."— Transcript della presentazione:

1 U2BP 3 5 AAG GCA A AAGGCA AAAAA

2 AAG GCA AAGGCA AAAAA U1 or U7 Double 3 5

3 LTR gag SV40 puro LTR pBabe puro LTR gag SV40 puro LTR U1/U2 /U7 pantis

4 Muscular biopsy from a patient Immortalization with Large T Antigen Infection with retroviral vectors containing the different therapeutic RNAs Puromycin selection Analysis of the expression of the transgene RT-PCR and western analysis CELLULAR SYSTEM

5 MU1-5 5'AAUUUUUCUCAUACCUUCUGCUUGAU 3' probe MU2BP AAAAAGAAGAAAAAGAAAAAUUAGAAAC 3 ' 5 ' probe U2BP C In vivo expression of antisense RNAs C

6 RT-PCR (single antisense) RT U1-5 Duch +- U2BP Duch U7d U1-5 M 51

7 RT-PCR (double antisense) RT AAGGCA Duchenne 5-3 dBP 5BP C M

8 5-3 dBP 5BP SMC dyst Duchenne kDa - Western analysis 100 g of total proteins

9 In mioblasti DMD si ha ripristino di sintesi di distrofina e del complesso del sarcoglicano

10 Verso un approccio di terapia genica

11 STOP degradazione STOP Splicing STOP mRNA STOP pre-mRNA della distrofina Modello animale del topo mdx AAAAA traduzione

12 -Iniezione intramuscolo -Somministrazione sistemica mediante iniezione nella vena caudale Trasduzione in vivo di molecole antisenso:uso di vettori AAV I muscoli iniettati vengono analizzati per: - analisi molecolare, (RT-PCR, Western) - immunoistochimica - saggi funzionali U1/U7 promoter Antisense CMV promoter Wpre GFP 5-ITR 3-ITR SV40 misc intron BGH pA Il virus AAV ha unalta efficienza di trasduzione nei muscoli e non è patogenico

13 La distrofina localizza correttamente alla periferia delle fibre e lespressione è mantenuta per diversi mesi Iniezione intramuscolo

14 Anche il complesso distrofina-sarcoglicano è ripristinato

15 * cuore quadricipite tricipite dorso * diaframma estensore Gluteo Gastrocnemio tibiale Iniezione sistemica di AAV-U1

16 Localizzazione di distrofina e complesso sarcoglicano

17 Saggi funzionali - Creatin kinasi I topi iniettati hanno livelli serici più bassi di CK /bl6mdxU wt mdx U1

18 Saggi funzionali - Forza I topi iniettati mostrano recupero della forza muscolare wt mdx GFP+ GFP- singole fibre c57/bl6mdxU7U k N / m 2 wt mdx U1 U7

19 Saggi funzionali - Treadmill exhaustion test I topi iniettati mostrano aumento della resistenza allo sforzo Wt mdx AAV-U1

20 Settembre Stato dell arte per una sperimentazione di terapia genica della DMD basata sull approccio dell exon skipping mediato da AAV-U1 Vettore AAV9 in sostituzione di AAV1 (tale vettore risulta avere un tropismo per il muscolo molto maggiore di AAV1 e in particolare per il muscolo cardiaco) Collaborazione con il gruppo del Prof. Barry Byrne (Florida) capo del National Gene Vector Laboratories (NGVL) per la produzione di virus ricombinanti di purezza GMP e per analisi tossicologica Registrazione di AAV9-U1 come farmaco orfano. Elaborazione di un CTD (Common Technical Document) da sottoporre all ISS, e successivamente all EMEA, per la richiesta di autorizzazione a sperimentazione clinica e registrazione del farmaco

21

22 Stato dellarte della sperimentazione clinica su DMD PTC124 (PTC therapeutics) Plasmide codificante distrofina full-length (Transgene e Mirus) Intramuscolare (completato) Intravena (comincia inizio 2007) AAV1 codificante microdistrofina (AskBio) Exon skipping con oligonucleotidi: 2-O-metil fosforotioato contro esone 51, (intramuscolo, cominciato; intravena pianificato per 2007, Universita di Leiden e Prosensa) Morfolino contro esone 51, (intramuscolo, cominciato; intravena pianificato per 2007; UK MDEX Consortium) Fosforotioati contro esone 19, 1 soggetto (intravena, completato, Dr. Takeshima) Exon skipping con U7 snRNA : Fase di preparazione di un AAV2/1 (Danos - Genethon)

23

24

25 Strategia generale per la costruzione di un vettore virale I genomi virali contengono sia geni che sequenze regolatorie che agiscono in cis –sequenze responsabili della replicazione e della incapsidazione La maggior parte delle sequenze che agiscono in cis si trovano al di fuori dei geni virali –si sfrutta questa segragazione per progettare vettori virali ricombinanti. I geni virali e le sequenze che agiscono in cis sono separate su diverse molecole –i prodotti dei geni virali agiscono in trans i geni virali possono essere forniti in un virus helper, in un plasmide o essere stabilmente integrati nel DNA della cellula packaging –le sequenze cis sono associate al gene terapeutico ed introdotte nella stessa cellula produzione di particelle trasducenti difettive nella replicazione

26 Ciclo vitale di un retrovirus RNA genomico, 2 copie. Lenzima trascrittasi inversa converte lRNA in DNA a doppio filamento nel citoplasma della cellula infetta. (Il DNA è anche convertito in forma circolare, che però non sembra essere un intermedio della replicazione). Il DNA lineare migra nel nucleo e viene integrato nel DNA della cellula ospite. Il DNA integrato è chiamato provirus. Lapparato della cellula ospite trascive il provirus producendo RNA virali che fungono sia da mRNA che da genomi che saranno impaccati nei nuovi virioni. 2 copie di RNA genomico vengono incapsidate in ogni virione

27 Struttura genomica ed espressione genica dei retrovirus Il genoma tipico contiene 3 geni –gene regione codificante che dà origine a più di una proteina I tre geni sono –gag (componenti del core nucleoproteico) –pol (replicazione e ricombinazione) –env (componente della membrana esterna) Per lespressione di pol deve essere ignorato un codone di stop –soppressione da parte di un glutamil-tRNA se la fase di lettura è la stessa di gag –slittamento del ribosoma se la fase di lettura è diversa da gag Lefficienza del processo è del 5% –la quantità di gag prodotta è 20 volte superiore a quella di pol

28 Vettori retrovirali U3RU5U3RU5 Gag-Pol Env Componenti separate U3RU5U3RU5 Gene terapeutico Gag-Pol p p Env 3 p VSV-G 3 oppure Titoli di 10 7 unità trasducenti (t.u.)/ml Titoli di unità trasducenti (t.u.)/ml

29 Vettori Retrovirali: situazione attuale e prospettive future Pro –efficiente trasduzione ex vivo di cellule in attiva replicazione linfociti e precursori delle linee ematopoietiche –notevole esperienza clinica ex vivo efficace terapia genica di due bambini affetti da imunodeficienza –integra garantendo espressione prolungata, ma a basso livello Contro –integrazione random attivazione di oncogeni shut-off trascrizionale dipendente dal sito di integrazione –capacità di impaccamento limitate (max. 7 kb) Sviluppi futuri: vettori lentivirali

30 Vettori lentivirali I lentivirus hanno un genoma più complesso –oltre ai geni gag, pol ed env, il genoma contiene due geni regolatori, tat e rev essenziali per il controllo dellespressione genica, ed un numero variabile di geni accessori. Originariamente derivati da HIV-1 per trasdurre linfociti –pseudotipizzazione con VSV-G espande il trofismo –vettori pseudotipizzati con VSV-G possono essere somministrati direttamente in vivo efficiente trasduzione di neuroni e cellule della glia del sistema nervoso centrale di roditori e primati Vettori ibridi derivati da lentivirus non umani (SIV, FIV) –virus originale non infettivo per gli esseri umani la reale efficacia in vivo deve essere ancora dimostrata

31 Vettori lentivirali Trasporto attivo del complesso di pre-integrazione attraverso i pori nucleari –possibilità di trasdurre anche cellule quiescenti efficaci nel trasdurre cellule quiescenti ex vivo trasduzione diretta in vivo potrebbe soffrire di alcune limitazioni –barriere tissutali nel caso della mucosa resporatoria –condizione intracellulare (necessità di replicazione) nel caso degli epatociti –devono ancora essere definiti il potenziale reale ed i limiti della trasduzione diretta in vivo mediata da vettori lentivirali Limite comune a vettori retro- e lentivirali –la fase a RNA obbligatoria nel ciclo vitale impone determinati limiti nella cassetta di espressione, tra cui la mancanza di introni e di segnali di poliadenilazione.

32 Virus Adeno Associati (AAV) Parvovirus, inizialmente scoperti come contaminanti di preparazioni di Adeno, richiedono la presenza di un virus helper (per esempio, Adenovirus) per linfezione produttiva –ad oggi sono stati caratterizzati 6 sierotipi la maggior parte deli studi si è concentrata su AAV-2 Ad oggi non sono stati associati a nessuna patologia –caratteristica ideale per derivare un vettore di terapia genica Il genoma del virus naturale integra preferenzialmente in un sito specifico del genoma umano (AAVS1 nel cromosoma 19 q13.3-qter)

33 Struttura genomica dei Virus Adeno Associati Cap ITRITR (145 nt) Rep Replicazione del DNA Integrazione Rescue Proteine del capside: VP1, VP2, VP3 Integrazione Incapsidazione Rescue

34 Ciclo vitale dei Virus Adeno Associati Integrazione sito-specifica Fase di latenza Ad Rescue Fase litica Replicazione Ad

35 Vettori AAV: struttura e produzione 1) Plasmide esprimente i geni rep e cap 2) Adenovirus helper oppure 2bis) Plasmide esprimente i geni di Adenovirus con funzione helper ITRITR (145 nt) Promotore-Transgene (max 4.5 kb)

36 Vettori AAV: situazione attuale e prospettive future Pro –efficiente trasduzione in vivo di cellule sia quiescenti che in attiva replicazione –espressione prolungata del transgene descritte sia forme episomali che integrate –bassa immunogenicità Contro –la massima capacità di impaccamento è 4,5 kb –con il sistema di produzione attuale si ottengono preparazioni a titolo relativamente basso e contaminate da virus Sviluppi futuri: –miglioramento dei sistemi di produzione –aumento dellefficienza di integrazione sito-specifica


Scaricare ppt "U2BP 3 5 AAG GCA 47 51 52 A AAGGCA 47 52 AAAAA. AAG GCA 51 47 52 AAGGCA 47 52 AAAAA U1 or U7 Double 3 5."

Presentazioni simili


Annunci Google