La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

I RISCHI DELLA PROCREAZIONE MEDICALMENTE ASSISTITA Dottoranda: Dr.ssa C. Pozzobon Tutor: Prof. G. Ricci.

Presentazioni simili


Presentazione sul tema: "I RISCHI DELLA PROCREAZIONE MEDICALMENTE ASSISTITA Dottoranda: Dr.ssa C. Pozzobon Tutor: Prof. G. Ricci."— Transcript della presentazione:

1 I RISCHI DELLA PROCREAZIONE MEDICALMENTE ASSISTITA Dottoranda: Dr.ssa C. Pozzobon Tutor: Prof. G. Ricci

2 Razionale amplissima diffusione delle procedure di PMA negli ultimi anni 10 % delle coppie si troverà ad affrontare un problema di infertilità 3,4% dei nati al Burlo Garofolo nasce da tecniche di PMA

3 Razionale Complicanze a breve termine Complicanze della somministrazione dei farmaci Complicanze delle procedure chirurgiche Trasmissione di malattie virali

4 Razionale Complicanze a medio termine Complicanze della gestazione (aborto, preeclampsia) Problematiche neonatali (parto pretermine, basso peso alla nascita, outcome perinatale negativo, cromosomopatie, malformazioni)

5 Razionale Complicanze a lungo termine Effetti nel tempo delle terapie cui si sottopongono le donne Problematiche psicologiche Problematiche sviluppo psico-fisico dei bambini, sviluppo di sindromi rare o neoplasie

6 Obiettivi I OBIETTIVO = INDIVIDUARE FATTORI PREDITTIVI E FATTORI DI RISCHIO II OBIETTIVO = RILEVAMENTO E MONITORAGGIO

7 Materiali e Metodi I OBIETTIVO = RICERCA II OBIETTIVO = SCHEDE DI MONITORAGGIO

8 Materiali e Metodi II OBIETTIVO = SCHEDE DI MONITORAGGIO I FASE: messa a punto II FASE: periodo di prova III FASE: campagna promozione raccolta dati

9 Risultati I obiettivo In collaborazione con CRG AZ.VUB In collaborazione con Genetica Medica del Burlo Garofolo In collaborazione con IVI

10 Risultati I obiettivo

11 Progetto di ricerca in collaborazione con la S.C. Genetica Medica e la S.C. Neuropsichiatria Infantile del Burlo Garofolo Ricerca e quantificazione di sequenze mitocondriali paterne in amniociti di pazienti sottoposte a trattamento di fertilizzazione con ICSI

12 valutare lefficacia del meccanismo di selezione in questo stadio di sviluppo fetale valutare il rischio di una possibile trasmissione paterna di anomalie a carico del mtDNA. Lo scopo del nostro studio è quello di verificare la presenza di sequenze di mtDNA paterno e leventuale percentuale di eteroplasmia negli amniociti di pazienti sottoposte a trattamento ICSI, con i seguenti obiettivi:

13 Metodi Estrazione mtDNA da leucociti sangue periferico dei genitori ed amplificazione regione polimorfica + estrazione mtDNA spermatozoi Costruzione di oligonucleotidi allele specifici in grado di ampliare in maniera selettiva il mtDNA paterno o materno Estrazione del mtDNA da amniociti seguita da una PCR allele specifica + ev. quantificazione del mtDNA paterno mediante real-time PCR allele- specifica.

14 Metodi I FASE: messa a punto delle metodiche II FASE: coordinazione gruppo multidisciplinare per il reclutamento III FASE: analisi dei dati

15 Risultati reclutamento 26 famiglie analisi dati di 10 famiglie in nessun campione sono state rilevate sequenze di mt-DNA

16 Discriminanti scelte per la PCR allele specifica: polimorfismo 215 A/G in padre Primer reverse padre: 5- TATTATTATGTCCTACAAGCATTTTC -3 Primer reverse madre: 5- TATTATTATGTCCTACAAGCATTTTT -3 Primer forward: 5-ACCCTATGTCGCAGTATCTGT -3 Lunghezza amplificato: 130 bp PadreMadre 73 A/G 195 T/C150 C/T 215 A/G152 T/C 263 A/G 309 insC 311 insC 499 G/A delCA T/C16189 T/C T/C16194 insC T/C16270 C/T PadreMadre 72 T/C73 A/G 263 A/G185 G/A 309 insC188 A/G etpl 309 insCC228 G/A 311 insC263 A/G C/T295 C/T T/C462 C/T C/T T/C T/C Discriminanti scelte per la PCR allele specifica: polimorfismo 72 T/C in padre polimorfismo 73 A/G in madre Primer reverse padre: 5- GCAATGCTATCGCGTGCATG -3 Primer reverse madre: 5- GCAATGCTATCGCGTGCACA -3 Primer forward: 5- GAAATCAATATCCCGCACAAGAGTG-3 Lunghezza amplificato: 248 bp Famiglia 11 Famiglia 14

17 Risultati I obiettivo Prevenzione farmacologica OHSS con chinagolina RCT multicentrico 7 centri Instituto Valenciano de Infertilidad 200 pz - 18 mesi Inizio ottobre 2006

18 Risultati I obiettivo Prevenzione farmacologica OHSS con chinagolina marzo pz randomizzati Allungamento del reclutamento a 24 mesi

19 Risultati II obiettivo I LIVELLO = Interno al SSD PMA Burlo Garofolo II LIVELLO = In collaborazione con ISS

20 Risultati II obiettivo Elaborazione e distribuzione di 2 SCHEDE per il MONITORAGGIO delle GRAVIDANZE da tecniche PMA

21 GRAV 97 SCHEDE VANISHING TWINS

22

23

24 SCHEDA PER IL FOLLOW-UP DI GRAVIDANZA DA PROCREAZIONE MEDICALMENTE ASSISTITA PROPOSTA, DISCUSSA E PROMOSSA A LIVELLO REGIONALE

25 Risultati II obiettivo Collaborazione col lISS per lelaborazione di un REGISTRO NAZIONALE

26 FINALITA DEL REGISTRO censire i centri del territorio nazionale rendere omogenei i requisiti tecnici-organizzativi raccogliere dati efficacia ed esiti delle tecniche censire embrioni prodotti e criopreservati banca dati per analisi epidemiologiche e confronti con altri Paesi Risultati II obiettivo

27 STRUTTURA DEL REGISTRO RACCOLTA PER DATI AGGREGATI risponde ad esigenze più immediate RACCOLTA PER RECORDS INDIVIDUALI permette di ottenere informazioni più complesse Risultati II obiettivo Cartella medica elettronica

28 RACCOLTA PER RECORDS AGGREGATI I criterio accreditamento dei centri presso le regioni invio degli elenchi dei centri accreditati dalle regioni allISS consegna ai centri degli accessi al sito registrazione dei centri al registro nazionale inserimento periodico dei dati dellattività da parte dei centri

29

30

31

32 RACCOLTA PER RECORDS INDIVIDUALI II criterio Cartella medica elettronica

33 BANCA DATI CENTRI BANCA DATI PAZIENTI BANCA DATI CICLI BANCA DATI EMBRIONI BANCA DATI NATI BANCA DATI GRAVIDANZE

34 377 CENTRI CICLI OPU ET REGISTRO NAZIONALE 2005

35 REGISTRO NAZIONALE 2005

36 PR/ET 96 CENTRI

37 PERDITA IPOTETICA GRAV ,6 gravidanze in meno

38 RISULTATI BURLO cicli 225 pz 79 grav

39 CLASSI DI ETA %

40 RISULTATI BURLO OPU 2390 OVOCITI PRELEVATI 749 OVOCITI INSEMINATI 277 ET

41 RISULTATI BURLO 2003 vs 2006

42 COMPLICANZE 1 sanguinamento 1 OHSS severa 0 infezioni 0 morti materne

43 ESITI NEGATIVI %

44 %

45 PARTI %

46 %

47 NATI LBW %

48 NATI PRETERMINE %

49 RISULTATI BURLO NATI VIVI 2,82% MALFORMAZIONI


Scaricare ppt "I RISCHI DELLA PROCREAZIONE MEDICALMENTE ASSISTITA Dottoranda: Dr.ssa C. Pozzobon Tutor: Prof. G. Ricci."

Presentazioni simili


Annunci Google