La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006.

Presentazioni simili


Presentazione sul tema: "Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006."— Transcript della presentazione:

1 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

2

3

4

5

6 LRNA polimerasi di E. coli

7 Le RNA polimerasi batteriche hanno quattro tipi di subunità

8 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

9

10 InibitoreEnzima bersaglioAzione dell'inibitore Rifamicina Streptolidigina Actinomicina D a -Amanitina oloenzima proc. nucleo enz. proc. pol I eucariotica pol II eucariotica lega e inibisce inizio lega e inibisce allungamento lega il DNA e inibisce allungamento lega la RNA polimerasi II

11 La trascrizione può essere divisa in quattro stadi: 1.Riconoscimento 2.Inizio 3.Allungamento 4.Terminazione

12 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

13

14

15

16

17

18

19 I promotori procariotici

20 fd T7 A3 T7 A2 Lac-UV-5 P R P L Tyr tRNA Lac w.t. Consenso..TGCTTCTGACTATAATAGACAGGGTAAAGACCTGATTTTTGA AAGTAAACACGGTACGATGTACCACATGAAACGACAGTGAGTCA AGTAACATGCAGTAAGATACAAATCGCTAGGTAACACTAGCAG. GCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAA. ACCTCTGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTG... ACCACTGGCGGTGATACTGAGCACATCAGCAGGACGCACTGAC...CGTCATTTGATATGATGCGCCCCGCTTCCCGATAAGGGAGCA GCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAA. T 80 A 95 T 45 A 60 A 50 T 96 A/G Identificazione della Pribnow box presente nella maggiorparte dei promotori di E.coli 5-9 bp

21 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006

22

23

24 TATAATTTGACA 5-9 basi16-19 basi Sequenza -35Pribnow box Sito di inizio della trascrizione +1 Un tipico promotore di E.coli è costituito da tre componenti: le sequenze consenso -35 e -10, e il sito dinizio

25 Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006


Scaricare ppt "Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright © 2006."

Presentazioni simili


Annunci Google