La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

STN UsersMeeting CNR Bologna 6 Dicembre 2006. Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00.

Presentazioni simili

Presentazione sul tema: "STN UsersMeeting CNR Bologna 6 Dicembre 2006. Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00."— Transcript della presentazione:

1 STN UsersMeeting CNR Bologna 6 Dicembre 2006

2 Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00 Novità in STN (Altri STN Files) Dr. U. Klemm STN 11.00 - 11.30 Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS 11.30 - 11.45 Coffee Break 11.45 - 12.30 La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo 12.30 - 14.00 Lunch 14.00 - 14.30 Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei 14.30 - 15.15 Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS 15.15 - 15.30 Coffee Break 15.30 - 16.00 Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

3 Whats New on STN Ursula Klemm, FIZ Karlsruhe Heidrun Waldhoff, CAS STN User Meeting Bologna December 6, 2006

4 Agenda STN System enhancements and changes Whats new from FIZ Karlsruhe Whats new from CAS

5 LOGOFF HOLD enhanced Frequently requested enhancement Now 120 minutes


7 STN is keeping pace with IPC Reform Almost all patent files include IPC8 codes for all new patent publications from 2006 onwards Consistent implementation of IPC Reform features across the system Backfile reclassification data have been added to - INPADOC, CAPLUS, USPATFULL/USPAT2, WPINDEX IPC 8 thesaurus implemented in numerous STN patent databases Planning underway to implement first IPC 8 thesaurus revisions (effective 2007)

8 E-mail messages alerting you to SDI results availability enhanced Number of Answers in SDI run, SDI Run Number and SDI Run Date are new elements

9 Full-text files now provide KWIC display at no charge KWIC-format is free when displaying basic index search results in: EPFULL, PCTFULL, FRFULL, GBFULL, PATDPAFULL, USPATFULL, USPAT2, RDISCLOSURE Use TRIAL KWIC for pre-selections –Titles (multiple languages) –Covered publication types –Available fields and images –Language information –KWIC provides a large amount of text information

10 STN Express ®, Version 8.01c, now available 8.01c launched on November 10 –Post-processing enhanced to handles changes introduced with the Derwent World Patents Index reload Recent STN Express enhancements include: –Increased security via SSL VPN –Enhanced structure search results analysis in Variable Group Analysis Tool –Access to Questel-Orbits Merged Markush Service

11 STN ® AnaVist, Version 1.1, enhances the ability to share visualization projects Share copies of visualization projects with others Create project reports as either.rtf or.pdf documents No charge for software or upgrades Subset visualizations are now free Article in World Patent Information recently published Case study from MeadWestvaco

12 Agenda STN System enhancements and changes Whats new from FIZ Karlsruhe Whats new from CAS

13 Derwent World Patents Index ® - Reloaded & Enhanced New first level content –original titles and abstracts –main claim –USPTO classes –full inventor names New value-add content –Documentation Abstract backfile –Derwent Chemistry Resource (DCR) backfile IPC Reform (IPC8 / IPC2006) compliance – including the enhanced STN IPC thesaurus Many technical improvements –simultaneous left and right truncation in more fields –no stop words –much faster date search

14 New DWPI SM database record structure DWPI database records now have a new two part structure - invention and members The invention part comprises traditional DWPI content – patent family, enhanced abstract, etc The members part provides new additional data from each of the members (publications) listed in the invention (patent family) part of the record Invention and members parts are searchable and displayable separately or in combination

15 New DWPI database record structure L1 ANSWER 1 OF 1 WPIX COPYRIGHT 2006 THE THOMSON CORP on STN AN 2003-492242 [46] WPIX CR 2003-851224 TI Optical fiber cable for use as transmission media has strength component system comprising dielectric rods surrounded by frictional adhesion coating which enables movement in response to compressive/flexural stress DC A17; A28; A89; P81; V07 IN NORRIS R H; SMALL R D; THOMAS P M; WEIMANN P A PA (FITE-N) FITEL USA CORP; (NORR-I) NORRIS R H; (SMAL-I) SMALL R D; (THOM-I) THOMAS P M; (WEIM-I) WEIMANN P A PI US 2003044139 A1 20030306 (200346)* 9 G02B006-44 EP 1403671 A1 20040331 (200424) EN G02B006-44 US 6778744 B2 20040817 (200454) G02B006-44 EP 1403671 B1 20050803 (200551) EN G02B006-44 ADT US 20030044139 A1 CIP of US 1999-415881 19991008 US 20030044139 A1 US 2002-255852 20020925 US 6778744 B2 CIP of US 1999-415881 19991008 US 6778744 B2 US 2002-255852 20020925 EP 1403671 A1 EP 2003-5730 20030313 EP 1403671 B1 EP 2003-5730 20030313 FDT US 6778744 B2 CIP of US 6611646 B PRAI US 2002-255852 20020925 US 1999-415881 19991008 IC ICM G02B006-44 AB US 20030044139 A1 NOVELTY - An optical fiber cable (10) has plastic tube(s) (120), a jacket (160), and a strength component system. The system has diametrically opposed dielectric rods (300-1, 300-2) which extend parallel to longitudinal axis, at least partially embedded in the jacket. Each rod is surrounded by frictional adhesion coating which enables local movement within the jacket in response to compressive/flexural stress. DETAILED DESCRIPTION - An optical fiber cable (10) having a longitudinal axis, comprises at least one plastic tube (120), a jacket (160), and a strength component system. The plastic tube extends parallel to the longitudinal axis and encloses several optical fibers (101). The.... MC CPI: A12-L03A EPI: V07-F01B4 Members (publications) Invention (patent family) Member(0001) PI US 20030044139 A1 20030306 (200346)* EN 9[6] G02B006-44 TIEN Dielectric optical fiber cable having reduced preferential bending AG Michael A. Morra, Fitel USA Corp. Suite F020, 2000 Northeast Expressway, Norcross, GA, US IN NORRIS R H INO: Norris, Richard Hartford INA: Powder Springs, GA, US.... PA (NORR-I) NORRIS R H PAO: Norris, Richard Hartford PAA: Powder Springs, GA, US.... ADT US20030044139 A1 CIP of US1999-415881 19991008; US20030044139 A1 US2002-255852 20020925 APTS US1999-000415881; US2002-000255852 IC ICM G02B006-44 IIC IICM G02B006-44 INCL INCLM 385113 ABEN An optical cable (10) includes one or more tubes (120), each containing a number of optical fibers (101), and a plastic jacket (160) that encloses the tube(s). A pair of diametrically opposed rods (300-1, 300-2) are at least partially embedded in the polyethylene jacket and are made from continuous-filament glass fibers that are embedded in epoxy. Each rod has a compressive stiffness that is effective to inhibit substantial contraction of the cable, and a tensile stiffness that is effective to receive tensile loads without substantial transfer of such loads to the glass fibers. Each dielectric rod.... CLMEN 1. An optical fiber cable having a longitudinal axis, the cable comprising: at least one plastic tube that extends parallel to the longitudinal axis and encloses a plurality of optical fibers; a jacket, which is made of a plastic material and which encloses the plastic tube; a strength member system comprising two diametrically opposed dielectric rods that extend parallel to the longitudinal axis and are at least partially embedded in the jacket, said rods having a compressive stiffness that is effective to inhibit substantial contraction of the cable and a tensile stiffness that is effective to receive a tensile load without substantial transfer of the tensile load to the optical fibers; wherein each rod is surrounded by a frictional adhesion coating that enables it to move locally within the jacket in response to compressive or flexural stress applied to the cable. Member(0002) PI EP 1403671 A1 20040331 (200424) EN G02B006-44 TIDE Dielektrisches faseroptisches Kabel mit reduzierter bevorzugter Biegerichtung TIEN Dielectric optical fiber cable having reduced preferential bending TIFR Cable a fibers optiques avec une direction de flexion reduite privilegiee AG Schoppe, Fritz, Dipl.-Ing. Patentanwaelte Schoppe, Zimmermann, Stoeckeler & Zinkler, P.O. Box 246, 82043 Pullach bei Muenchen, DE IN NORRIS R H INO: Norris, Richard Hartford INA: 3362 Chatsworth Way, Powder Springs, GA 30127, US.... PA (FITE-N) FITEL USA CORP PAO: FITEL USA CORPORATION PAA: 2000 Northeast Expressway, Suite F020, Norcross, Georgia 30071, US ADT EP1403671 A1 EP2003-005730 20030313 APTS EP2003-000005730 PRAI US2002-255852 20020925 PRTS US2002-000255852 IC ICM G02B006-44 IIC IICM G02B006-44 ABEN An optical cable (10) includes one or more tubes (120), each containing a number of optical fibers (101), and a plastic jacket (160) that encloses the tube(s). A pair of diametrically opposed rods (300-1, 300-2) are at least partially embedded in the polyethylene jacket and are made from continuous-filament glass fibers that are embedded in epoxy. Each rod has a compressive stiffness that is effective to inhibit substantial contraction of the cable, and a tensile stiffness that is effective to receive tensile loads without substantial transfer of such loads to the glass fibers. Each dielectric rod.... CLMEN An optical fiber cable (10) having a longitudinal axis (105-105), the cable comprising: at least one plastic tube (120) that extends parallel to the longitudinal axis and encloses a plurality of optical fibers (101); a jacket (160), which is made of a plastic material and which encloses the plastic tube; a strength member system comprising two diametrically opposed dielectric rods (300-1, 300-2) that extend parallel to the longitudinal axis and are at least partially embedded in the jacket, said rods having a compressive stiffness that is effective to inhibit substantial contraction of the cable and a tensile stiffness that is effective to receive a tensile load without substantial transfer of the tensile load to the optical fibers; X2003X2003X2003wherein each rod is surrounded by a frictional adhesion coating (330) that enables it to move locally within the jacket in response to compressive or flexural stress applied to the cable. Member(0003) PI US 6778744 B2 20040817 (200454) EN G02B006-44 TIEN Dielectric optical fiber cable having reduced preferential bending IN NORRIS R H INO: Norris, Richard Hartford INA: Powder Springs, GA, US.... PA (FITE-N) FITEL USA CORP PAO: Fitel USA Corp. PAA: Norcross, GA, US ADT US6778744 B2 CIP of US1999-415881 19991008; US6778744 B2 US2002-255852 20020925 APTS US1999-000415881; US2002-000255852 FDT US6778744 B2 CIP of US6611646 B IC ICM G02B006-44 IIC IICM G02B006-44 INCL INCLM 385113 INCLS 385111; 385112 ABEN An optical cable (10) includes one or more tubes (120), each containing a number of optical fibers (101), and a plastic jacket (160) that encloses the tube(s). A pair of diametrically opposed rods (300-1, 300-2) are at least partially embedded in the polyethylene jacket and are made from continuous-filament glass fibers that are embedded in epoxy. Each rod has a compressive stiffness that is effective to inhibit substantial contraction of the cable, and a tensile stiffness that is effective to receive tensile loads without substantial transfer of such loads to the glass fibers. Each dielectric rod includes.... CLMEN What is claimed is: 1. An optical fiber cable having a longitudinal axis, the cable comprising: at least one plastic tube that extends parallel to the longitudinal axis and encloses a plurality of optical fibers; a jacket, which is made of a plastic material and which encloses the plastic tube; a strength member system comprising two diametrically opposed dielectric rods that extend parallel to the longitudinal axis and are at least partially embedded in the jacket, said rods having a compressive stiffness that is effective to inhibit substantial contraction of the cable and a tensile stiffness that is effective to receive a tensile load without substantial transfer of the tensile load to the optical fibers; wherein each rod is surrounded by a frictional adhesion coating that enables it to move locally within the jacket in response to compressive or flexural stress applied to the cable. Member(0004) PI EP 1403671 B1 20050803 (200551) EN G02B006-44 TIDE Dielektrisches faseroptisches Kabel mit reduzierter bevorzugter Biegerichtung TIEN Dielectric optical fiber cable having reduced preferential bending TIFR Cable a fibres optiques ayant une direction de flexion reduite privilegiee AG Schoppe, Fritz, Dipl.-Ing. Patentanwaelte, Schoppe, Zimmermann, Stoeckeler & Zinkler, P.O. Box 246, 82043 Pullach bei Muenchen, DE IN NORRIS R H INO: Norris, Richard Hartford INA: 3362 Chatsworth Way, Powder Springs, GA 30127, US.... PA (FITE-N) FITEL USA CORP PAO: FITEL USA CORPORATION PAA: 2000 Northeast Expressway, Suite F020, Norcross, Georgia 30071, US ADT EP1403671 B1 EP2003-005730 20030313 APTS EP2003-000005730 PRAI US2002-255852 20020925 PRTS US2002-000255852 IC ICM G02B006-44 IIC IICM G02B006-44 CLMEN An optical fiber cable (10) having a longitudinal axis (105-105), the cable comprising: at least one plastic tube (120) that extends parallel to the longitudinal axis and encloses a plurality of optical fibers (101); a jacket (160), which is made of a plastic material and which encloses the plastic tube; a strength member system comprising two diametrically opposed dielectric rods (300-1, 300-2) that extend parallel to the longitudinal axis and are at least partially embedded in the jacket, said rods having a compressive stiffness that is effective to inhibit substantial contraction of the cable and a tensile stiffness that is effective to receive a tensile load without substantial transfer of the tensile load to the optical fibers; X2003X2003X2003wherein each rod is surrounded by a frictional adhesion coating (330) that enables it to move locally within the jacket in response to compressive or flexural stress applied to the cable characterized in that the frictional adhesion coating material (330) is selected from the group consisting of: (i) thermoplastic elastomers; (ii) thermally crosslinkable rubbers; and (iii) UV-curable crosslinkable rubbers. New !

16 => D BIB MEMB L1 ANSWER 1 OF 1 WPINDEX COPYRIGHT 2006 THE THOMSON CORP on STN AN 2005-657672 [67] WPIXML TI New nucleic acid molecule comprising at least one junction nucleotide sequence of corn event MIR604, useful for producing a corn plant that is resistant to at least corn rootworm (en) DC C06; D16; P13 IN CHEN E; MEGHIJI M; MEGHJI M; STEINER H PA (SYGN-C) SYNGENTA PARTICIPATIONS AG PI US 20050216970 A1 20050929 (200567)* EN 37[2] WO 2005103301 A2 20051103 (200572) EN ADT US20050216970 A1 Provisional US2004-556260P 20040325; US20050216970 A1 US2005-059262 20050216; WO2005103301 A2 WO2005-US004790 20050216 PRAI US2005-059262 20050216; US2004-556260P 20040325 Member(0001) PI US 20050216970 A1 20050929 (200567)* EN 37[2] C12Q-1/68 TIEN Corn event MIR604 AG SYNGENTA BIOTECHNOLOGY, INC., PATENT DEPARTMENT 3054 CORNWALLIS ROAD, P.O. BOX 12257, RESEARCH TRIANGLE PARK, NC, US IN STEINER H INO: Steiner, Henry-Yorkd INA: Durham, NC, US..... PA (SYGN-C) SYNGENTA PARTICIPATIONS AG..... INCL INCLM 800279 INCLS 800320.1; 4356 ABEN A novel transgenic corn event designated MIR604, is disclosed. The invention relates to DNA sequences of the recombinant constructs inserted into the corn genome and... CLMEN 1. An isolated nucleic acid molecule comprising at least one junction nucleotide sequence of corn event MIR604 selected …. invention level publication level display format: MEMB DWPI - Sample Record

17 New EPO Legal Status in EPFULL EPFULL is the European Patent Office (EPO) full-text patent database on STN EPFULL has been enhanced with all new EPO Patent Register Legal Status data, incl. history Data includes up-to-date detail unavailable in the INPADOC Legal Status (PRS) service Data is fully searchable - including details of "intention to grant", opposition, licence & reassignment Allows for precision Legal Status Alerts/SDIs!

18 EPO Legal Status including history LEGAL STATUS INCLUDING HISTORY AN 1996:66709 EPFULL 19980909 EPB241 Request for examination 19980615 19980909 EPB430 Unexamined document without grant, (first publication) 19980909 19980909 WOB870 PCT publication data 19970522 19980909 EPB840 Designated contracting states AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE EP 862831 A1 19980909 19981021 EPB840R Designated contracting states (correction) BE DE ES FR GB IT 19981202 EPB300R Priority data (correction) OLD: US 1995-662P P 19951113 NEW: US 1995-6629P P 19951113 19991020 EPB565EP Drawing up and dispatch of supplementary search report (EPA4) 19990902 20000112 EPB840R Designated contracting states (correction) AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE 20030102 EPB242 Dispatch of the first examination report 20021120 20040616 EPB452EP Intention to grant 20031209 20040616 EPB840R Designated contracting states (correction) BE DE ES FR GB IT 20040616 EPB450 Document with grant, second publication 20040616... D BIB.M LSEP.M format (cont.). Details in RED are not available in INPADOC. Historical data, e.g. old priority numbers. Use (P) proximity to combine terms within single Legal Status events, e.g. code (LSC) and date (LSD).

19 Monitor Intention to Grant in EPFULL => FILE EPFULL => S HITACHI/PA L1 13824 HITACHI/PA => E EPB452EP/LSC E276 662702 EPB451EP ANNOUNCEMENT OF INTENTION TO GRANT/LSC E277 317928 --> EPB452EP/LSC E278 317928 EPB452EP INTENTION TO GRANT/LSC E279 478 EPB452EPD/LSC E280 478 EPB452EPD INTENTION TO GRANT (DELETED)/LSC E281 1754 EPB452EPR/LSC E282 1754 EPB452EPR INTENTION TO GRANT (CORRECTION)/LSC E283 377978 EPB475/LSC E284 377978 EPB475 LAPSE OF PATENT/LSC E285 192 EPB475D/LSC E286 192 EPB475D LAPSE OF PATENT (DELETED)/LSC => S L1 AND EPB452EP/LSC(P)UPLS=20061108 L2 8 L1 AND EPB452EP/LSC(P)UPLS=20061108 Unique to STN: searchable EPO Legal Status Codes. Identify the relevant Legal Status Codes. Use (P)-operator to combine LSC with LSUP New: Complete list of Legal Status Codes:

20 => D BIB.M HIT L2 ANSWER 1 OF 8 EPFULL COPYRIGHT 2006 EPO/FIZ KA on STN AN 2004:150498 EPFULL EDP 20050928 ED 20050928 UP 20061108 DUPD 20061108 DUPW 200645 TIEN Storage apparatus for asynchronous remote copying. TIFR Dispositif de stockage de donnees permettant le miroitage asynchrone de donnees a distance. TIDE Speichervorrichtung fuer asynchrone entfernte Datenspiegelung. IN Muto, Yoshiakic/o Hitachi Ltd, Intel Prop Group6-1, Marunouchi 1-chome, Chiyoda-kuTokyo 100-8220, JP;... PA Hitachi, Ltd., 6-6, Marunouchi 1-chome Chiyoda-ku, Tokyo, JP PIT EPA1 Application published with search report PI EP 1580662 A1 20050928 DS DE FR GB AI EP 2004-256190 A 20041006 PRAI JP 2004-85032 A 20040323 PA Hitachi, Ltd., 6-6, Marunouchi 1-chome Chiyoda-ku, Tokyo, JP Monitor Intention to Grant in EPFULL


22 coming soon…! USGENE is The USPTO Genetic Sequence Database – a completely new resource for comprehensive patent sequence searches Producer: SequenceBase Corporation Coverage: USPTO published application & issued patent sequences, 1982 to present Text: original title, abstract & claims Includes: SEQ ID NOs, full patent assignee & inventor names, numbers and dates

23 A typical record from USGENE on STN L1 ANSWER 1 OF 347 USGENE COPYRIGHT 2006 SEQUENCEBASE CORP on STN ACCESSION NUMBER: 6825322.1 cDNA USGENE TITLE: Human N-methyl-D-aspartate receptor subunits, nucleic acids encoding same and uses therefor (Patent) INVENTOR: Daggett Lorrie P. (San Diego, CA); Lu Chin-Chun (San Diego, CA) PATENT ASSIGNEE: Merck & Co Inc (Rahway NJ) PATENT INFO: US6825322 B2 20041130 APPLICATION INFO:US 2002-038937 20020104 DOCUMENT TYPE: Patent ORGANISM: Not provided ABSTRACT: In accordance with the present invention, there are provided nucleic acids encoding human NMDA receptor protein subunits and... CLAIMS: US6825322 B2: What is claimed: 1. An isolated and substantially pure N-methyl-D-aspartate receptor subunit comprising an amino acid sequence as set forth in SEQ ID NO:56,... BLASTALIGN Query = 4298 letters Length = 4298 Score = 8520 bits (4298), Expect = 0.0 Identities = 4298/4298 (100%) Strand = Plus / Plus Query: 1 caagccgggcgttcggagctgtgcccggccccgcttcagcaccgcggacagcgccggccg |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 caagccgggcgttcggagctgtgcccggccccgcttcagcaccgcggacagcgccggccg USGENE features original title, abstract and claims.

24 DGENE and PCTGEN have been enhanced Two new features have been provided with the release of STN Express, Version 8.0+ –Query Upload Wizard for uploading sequence query text files for use with the RUN BLAST or RUN GETSIM commands –Post-processing tools now work with the BLAST and GETSIM SCORE field, e.g., for inclusion into tables using the Table Tool

25 INSPEC has been reloaded All former stop words have been eliminated Simultaneous left and right truncation (SLART) is now available in TI, AB, and BI New search and display fields: –Abstract (/AB) –Availability (/AV) – original documents, mainly for reports, dissertations, and conference proceedings –Controlled Word (/CW) – additional to the bound phrase index Controlled Term (/CT) –Specific source information search fields additional to Source field (/SO), such as ISSN, Publisher, URL

26 INSPEC Archive The Inspec Archive has been digitised from the Science Abstracts journal series, in particular: Science Abstracts (1898 - 1902) Science Abstracts: A - Physics Abstracts (1903 - 1968) Science Abstracts: B - Electrical Engineering (1903 - 1965) Science Abstracts: B - Electrical & Electronics Abstracts (1966 - 1968) Science Abstracts: C - Control Abstracts (1966 - 1968) The archive comprises 873,699 records INSPEC now contains more than 9.8 million records in total

27 WTEXTILES (World Textiles) Enhanced with new coverage on the use of textiles in medical field. Over 9800 records added from 2003 to the present). They relate to subjects such as protective materials, dressings, medical equipment, textiles finishing and washing, etc. WTEXTILES now contains 338,746 records from 1970 to date. (9/2006)

28 FSTA - JAPANESE PATENTS NOW INCLUDED Covers all scientific and technological aspects of the processing and manufacturing of human food products Up to one hundred Japanese Patent records are being added each week. The target is to achieve some 2500 records by the end of the year Approx. 730.000 records in total (10/2006)

29 FIZ AutoDoc – Release 11/2006 The FIZ AutoDoc Standard version is now available for STN users as well Highlights: Optimized user interaction Order capabilities for all types of literature (> 120.000 Journals) … Checking and verification of entered data ISSN identification by journal title Various delivery formats and speeds Automatic supplier selection according to selected options Extended history function Detailed cost display during the order process Billing via STN account

30 FIZ AutoDoc – Release 11/2006 What does it mean for STN Users ? OLD NEW

31 FIZ AutoDoc – The new Order Form 1.Navigation Bar 2.Order Form 3.Address Data 4.Last three Orders 5.Notification e-mail 2 4 3 5 1

32 FIZ AutoDoc – More Delivery Formats DRM Formats ! < 48 hours < 24 hours < 3 hours Confirmation / Access to Order History

33 The Order Details page sumarizes your order: Document Details Format / Speed Automatically selected Supplier Pocessing Mode Estimated Costs Additional Information Use the Submit Order button to submit your order Use the Edit to return to the order form and make new selections FIZ AutoDoc – New Order Details Page

34 FIZ AutoDoc Document Suppliers (11/2006) Document suppliers - Journal Full-text: Technische Informationsbibliothek (TIB) Deutsche Zentralbibliothek für Medizin (ZBMED) Deutsche Zentralbibliothek für Medizin Bereichsbibliothek für Ernährung, Umwelt und Agrarwissenschaften Bayerische Staatsbibliothek (BSB) Senckenbergische Bibliothek (SeB) / Universitätsbibliothek Frankfurt British Library Document Supply Centre (BLDSC) Canada Institute for Scientific and Technical Information (CISTI), Ottawa Institut d'Information Scientifique et Technique (INIST) Rapra Technology Ltd. (RAPRA) Document suppliers - Patents: Thomson Patent Store Pay-per-View Option - Journal Articles: Karger Thieme Springer (in preparation)

35 Agenda STN System enhancements and changes Whats new from FIZ Karlsruhe Whats new from CAS

36 CA SM /CAplus SM continue to be significantly enhanced CAplus now contains over 166 million citations Power of the Company Name Thesaurus increased with a reload including almost 90,000 unique names and over 36,000 name families More pre-1907 records added to CA/CAplus –Data from the 1878-1906 issues of the Journal of the Chemical Society-Transactions (over 2,600 records) –U.S. patent records from 1890 to 1906 (over 8,700 records)

37 Enhanced patent information in CA SM /CAplus SM continues to be a focus CAS sets new timeliness standard by making Chinese patent records available by approximately 120 days before competitive services F-Term Thesaurus (Japanese patent classification codes) enhanced with hierarchical displays and more searching options Korean patent data for 2004-2006 added to CA/CAplus

38 Pre-1967 chemical substance information in CA/CAplus enhanced with preparation role Simplifies retrieval of information on preparations and syntheses Applies to references from 1907-1966 Almost 4 million index entries enhanced

39 Patent Kind Code data updated in CA/CAplus Effective late 2006, patent kind codes will now always match the kind code data published on the patent document New patent kind codes will be used beginning in December 2006 Backfile will be updated, starting in December 2006, to ensure searching consistency across the files Old patent kind code data will now appear in the PK.OLD and PK.B.OLD fields SDIs and saved search queries should be updated List of kind code changes available on the web

40 The number of substances added to CAS REGISTRY SM is projected to reach record level in 2006 Continued growth of new substances from patents Additional substances from Chemical Catalogs Other substance collections such as NCI Cancer Screened databases REGISTRY has been updated to include the amino acid code for pyrrolysine. By the end of 2006, REGISTRY will have over 30 million small molecules, with over 3 million new small molecule registrations in 2006

41 CAS REGISTRY property data enhanced and growing Over 1.4 billion predicted and experimental properties, tags, and spectra in REGISTRY for over 22 million CAS Registry Numbers ® Enhanced with the addition of experimental NMR and IR spectra

42 CASREACT ® now contains over 11 million reactions Includes over 4.6 million single-step reactions and more than 6.6 million multi-step reactions Additional reactions from 1992-1998 to be loaded later this year CASREACT–answers your chemical reaction questions

43 Processing efficiencies and new data added to MARPAT ® Daily updates coming soon Improved highlighting in display formats –A new SET option in MARPAT, SET MARHIGHLIGHT ON/OFF, allows you to turn highlighting improvements introduced in 2005 ON and OFF Coverage in MARPAT extended back to 1961 with addition of more Markush structures

44 Several databases on STN have been enhanced recently TULSA/TULSA2 (Petroleum Abstracts) –Reloaded and enhanced with new search and display fields. IPC thesauri added. ADISCTI (ADIS Clinical Trials Insight) –Reloaded and enhanced

45 IFI database enhancements are on the way Reload of IFIPAT/IFIUDB/IFICDB –IPC 8-compliant –IPC 8 Thesaurus to be added

46 Questions? Ursula Klemm, FIZ Karlsruhe Heidrun Waldhoff, CAS STN User Meeting Bologna December 6, 2006

47 Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00 Novità in STN (Altri STN Files) Dr. U. Klemm STN 11.00 - 11.30 Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS 11.30 - 11.45 Coffee Break 11.45 - 12.30 La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo 12.30 - 14.00 Lunch 14.00 - 14.30 Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei 14.30 - 15.15 Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS 15.15 - 15.30 Coffee Break 15.30 - 16.00 Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

48 Le proprietà chimico-fisiche in Registry Guglielmo Rucci

49 StructureCAS Registry Number CAS Index Name Molecular Formula Calculated Properties Experimental Properties Properties in Registry

50 UNITS in Registry => help unit The following are the default search units for the property search fields in the REGISTRY File: Property Search Field Default Unit ---------- ------------- ------------ Bioconcentration Factor /BCF none Bioconcentration Factor pH /BCF.PH none Boiling Point /BP deg C Boiling Point Pressure /BP.P deg C Density /DEN g/cm**3 Density Pressure /DEN.P Torr Density Temperature /DEN.T deg C Electric Conductance /ECON Siemens Electric Conductance Temperature /ECON.T deg C Electric Conductivity /ECND S/cm Electric Conductivity Temperature /ECND.T deg C Electric Resistance /ERES ohm Electric Resistance Temperature /ERES.T deg C Electric Resistivity /EREST ohm*cm...................................

51 UNITS in Registry => help set unit The unit systems available are: SI, MKS, CGS, STN (commonly used metric units), FPS, and ENG (commonly used U.S. Engineering units). The default units for numeric fields in a file are the units in which the file was loaded. You may change the unit for a numeric field by entering "SET UNIT" at an arrow prompt (=>). You will be prompted for the field codes and units that you want to change. The equal sign (=) is required and unit designations may have no intervening spaces. Examples: => SET UNIT ENTER FIELD CODES AND UNITS OR (END):BP=K => SET UNIT ENTER FIELD CODES AND UNITS OR (END):BP=F DEN=LB/FT**3 => SET UNIT BP=F DEN=LB/FT**3 => set unit all=cgs SET COMMAND COMPLETED => set unit all=stn SET COMMAND COMPLETED

52 Properties in Registry => e property data/fa E1 1278 PR/FA E2 1278 PREFERRED REGISTRY NUMBER/FA E3 22.110832 --> PROPERTY DATA/FA E4 1.854687 PROPERTY TAGS/FA E5 21508929 PSA/FA E6 52711311 REF.CA/FA E7 646085 REF.CAD/FA E8 1448140 REF.CAOLD/FA E9 52755909 REF.CAPLUS/FA E10 65579 REFRACTIVE INDEX/FA E11 162710 RELATED POLYMERS/FA E12 522144 REPLACED REGISTRY NUMBER/FA

53 Calculated data Experimental data Properties in Registry

54 Calculated data Values for the calculated physical properties in the REGISTRY file were determined using CAS connection tables and software developed by Advanced Chemistry Development, Inc. Properties in Registry

55 Calculated data pKa for the most acidic and most basic centers in the molecule Number of Hydrogen Donors / Acceptors Number of Rotatable Bonds Molecular Weight Molar Solubility in water at various pHs logP/logD (water-octanol partition coefficients) Properties in Registry

56 Lipinski The Lipinski, calculated properties, are the important characteristics for successful drug candidates. <=5 Hydrogen-bond donors <=10 Hydrogen-bond acceptors <=500 Molecular weight <=5 Calculated logP Properties in Registry

57 Calculated data Bioconcentration factor Boiling point Enthalpy of Vaporization Flash point Organic Carbon Adsorption Coefficient (Koc) Vapor pressure Properties in Registry

58 * Bioconcentration Factor - provides an indication of how readily a substance accumulates in organisms, living in an environment polluted by that substance (applies primarily, but is not limited to, aquatic environments) * Boiling Point - provides an indication of the temperature at which a compound goes from the liquid to gaseous state * Enthalpy of Vaporization - provides an indication of the volatilization characteristics of a compound and is useful in remediation studies involving organic compounds * Flash Point - provides an indication of the temperature at which a substance ignites and is useful in predicting explosive atmospheres in chemical manufacturing and processing applications * Organic Carbon Adsorption Coefficient (Koc) - provides an indication of how readily a substance accumulates in the organic component of soils and other particulate matter vs. migrating with the aqueous environment surrounding soil particles and is especially important in remediation and bioavailability studies * Vapor pressure - provides an indication of a compound's tendency to evaporate Properties in Registry

59 Calculated data Property Search Example Units ---------- ----------------- ------- Freely Rotatable Bonds S 2-5/FRB --- Hydrogen Donors S HD<=5 --- Hydrogen Acceptors S 1-3/HAC --- LogD S 2.21/LOGD --- LogP S LOGP<=3 --- Molar Solubility S SLB.MOL>=1 MOL/L Molecular Weight S MW<200 --- pKa S PKA<=-0.62 --- Properties in Registry

60 Experimental data The source of experimental property data in the REGISTRY file is the SPRESI database produced by ZIC/VINITI and offered by Infochem. The data added to the REGISTRY file are from the journal and patent literature in the time period 1975-. Properties in Registry

61 Experimental data Definitions: Boiling Point - the temperature at which.... Density - mass per unit volume of.... Melting Point - the temperature at which.... Some melting point temperatures may be flagged... Polymorph - indicates the melting point... Sublm - indicates the temperature.... Decomp - indicates the temperature.... Optical Rotatory Power - the degree of rotation.... Refractive Index - the ratio of the.... Properties in Registry

62 Experimental data Experimental Properties (EPROP) PROPERTY (CODE) | VALUE | CONDITION | NOTE =====================+===================+=================+========== Boiling Point (BP) |110.63 deg C | | (1) CAS (1)Broholm, Mette M.; Environmental Science and Technology 2005 V39(21) P8251-8263 CAPLUS Properties in Registry

63 Spectra


65 Properties in Registry => e6 L1 125424 "CARBON-13 NMR SPECTRA"/SPEC => help dfields................. SPEC Spectra SPEC.C13NMR Carbon-13 NMR Spectra SPEC.IR IR Absorption Spectra => d spec

66 Properties in Registry

67 => d eprops L1 ANSWER 1 OF 80227 REGISTRY COPYRIGHT 2006 ACS on STN Experimental Properties (EPROP) PROPERTY (CODE) | VALUE | NOTE =====================+========+========== Carbon-13 NMR Spectra|Spectrum|(1) WSS (1) Spectral data were obtained from Wiley Subscription Services, Inc. (US) Experimental Property Tags (ETAG) PROPERTY | NOTE ==================+======= Proton NMR Spectra|(1) CAS (1) Yu, Jiangbo; Inorganic Chemistry 2005 V44(5) P1611-1618 CAPLUS Properties in Registry

68 => e8 L2 16351 "IR ABSORPTION SPECTRA"/SPEC => d spec

69 Properties in Registry

70 Strategies for searching property information

71 Basic strategies search a property directly 173/BP Advanced strategies offer search precision Property note (PNT), Property source (PSO), Property type (PTYP) Uncertainty range (UR)

72 Use (P)-operator to combine property values with property conditions (P)-operator Strategies for searching property information

73 Search Question: Find the boiling point for sec-butylbenzene.

74 Strategies for searching property information => fil reg => e sec-butylbenzene/cn 5 E1 1 SEC-BUTYLASTATINE/CN E2 1 SEC-BUTYLAZINE/CN E3 1 --> SEC-BUTYLBENZENE/CN.......... => e3 and bp/fa L1 1 SEC-BUTYLBENZENE/CN AND BP/FA

75 Strategies for searching property information => d qrd L1 ANSWER 1 OF 1 REGISTRY COPYRIGHT 2006 ACS on STN RN 135-98-8 REGISTRY ED Entered STN: 16 Nov 1984 CN Benzene, (1-methylpropyl)- (9CI) (CA INDEX NAME) OTHER CA INDEX NAMES: CN Benzene, sec-butyl- (8CI) OTHER NAMES: CN (+-)-sec-Butylbenzene............. CN sec-Butylbenzene

76 Strategies for searching property information CODE| VALUE | CONDITION | TYPE | NOTE ====+===============+===============+============+========== BP |446.65 K | |Experimental| (1) NLM BP |446.65 K | |Experimental| (2) SRC BP |446.55 K |Press: 760 Torr|Experimental| (3) CAS CODE| VALUE | CONDITION | TYPE |NOTE ====+==============+===============+==========+==== BP |446.45+/-0.0 K|Press: 760 Torr|Predicted |(1)

77 Strategies for searching property information Search Question: Find compounds with Boiling Point at 100 °C exactly.

78 => 100/mp L6 366 100 K /MP => 100 c/mp L7 11756 100 C/MP => l7(p)exact/pnt 387289 EXACT/PNT L8 1395 L7(P)EXACT/PNT => d hit L8 ANSWER 1 OF 1395 REGISTRY COPYRIGHT 2005 ACS on STN CODE| VALUE | CONDITION | TYPE | NOTE ====+=======+=============+============+======= MP |373.2 K|Solv: ethanol|Experimental|(1) CAS Strategies for searching property information

79 => set unit mp=c SET COMMAND COMPLETED => d hit L8 ANSWER 1 OF 1395 REGISTRY COPYRIGHT 2005 ACS on STN CODE| VALUE | CONDITION | TYPE | NOTE ====+=========+=============+============+======= MP |100 deg C|Solv: ethanol|Experimental|(1) CAS | |(64-17-5) | | Strategies for searching property information

80 Search Question: Find compounds with LD50 value, for the mouse, between 741-745 mg/kg exactly.

81 => set unit ld50=mg/kg SET COMMAND COMPLETED => 741-745/ld50 L1 186 741 MG/KG - 745 MG/KG /LD50 => l1(p)mouse/ld50.orgn L2 121 L1(P)MOUSE/LD50.ORGN => d hit L2 ANSWER 1 OF 121 REGISTRY COPYRIGHT 2005 ACS on STN CODE| VALUE | CONDITION | TYPE | NOTE ====+==========+===========+============+======= LD50|>300 mg/kg|Orgn: mouse|Experimental|(1) CAS | |Rte: oral | | Strategies for searching property information

82 => l2(p)exact/pnt L3 1 L2(P)EXACT/PNT => d hit L3 ANSWER 1 OF 1 REGISTRY COPYRIGHT 2006 ACS on STN CODE| VALUE | CONDITION | TYPE | NOTE ====+=========+====================+============+========= LD50|741 mg/kg|Orgn: mouse |Experimental|(1) CAS | |Rte: intraperitoneal| | (1) Al'-Assar, F.; Pharmaceutical Chemistry Journal (Translation of Khimiko-Farmatsevticheskii Zhurnal) 2002 V36(11) P598-603 CAPLUS Strategies for searching property information

83 Search Question: Identify compounds isolated from the gardenia flower with the following properties: Density 0.94–1.05 gr/cc at 20 °C (Experimental) bp = 218–287 °C at 1 atm. mp = 17–18 °C Strategies for searching property information

84 => fil reg => set unit den=g/cm**3 SET COMMAND COMPLETED => set unit den.t=C SET COMMAND COMPLETED => set unit mp=c SET COMMAND COMPLETED => 218-287 C/bp(p)760 torr/bp.p and 0.94-1.05/den(p)20/den.t (p)exp?/ptyp and 17-18/mp L1 20 218-287 C/BP(P)760 TORR/BP.P AND Strategies for searching property information

85 => d qrd CODE| VALUE | CONDITION | TYPE | NOTE ====+========+===============+============+========= BP |376.65 K|Press: 4.5 Torr|Experimental|(1) IC (1)Wrobel, Dieter; Chemische Berichte 1982 V115(5) P1694-704 CAPLUS CODE| VALUE | CONDITION | TYPE |NOTE ====+===============+===============+==========+==== BP |533.65+/-19.0 K|Press: 760 Torr|Predicted |(1) (1)Calculated using Advanced Chemistry Development (ACD/Labs) Software V8.14 ((C) 1994-2006 ACD/Labs) Strategies for searching property information

86 CODE| VALUE | TYPE | NOTE ====+===========+============+========= MP |16-17 deg C|Experimental|(1) IC CODE| VALUE | CONDITION | TYPE | NOTE ====+==============+==============+============+========= DEN |0.9722 g/cm**3|Temp: 20 deg C|Experimental|(1) IC (1)Wrobel, Dieter; Chemische Berichte 1982 V115(5) P1694-704 CAPLUS CODE| VALUE | CONDITION | TYPE |NOTE ====+====================+===============+==========+==== DEN |0.956+/-0.06 g/cm**3|Temp: 20 deg C |Predicted |(1) | |Press: 760 Torr| | Strategies for searching property information

87 => fil caplus => l1 and gardenia L2 13 L1 AND GARDENIA => sel l2 hit rn SmartSELECT INITIATED New TRANSFER and ANALYZE Commands Now Available See HELP TRANSFER and HELP ANALYZE for Details L3 SEL L2 1- RN HIT : 8 TERMS Strategies for searching property information


89 Search Question: Find compounds containing the following substructure, which are biologically active: Strategies for searching property information

90 Side groups were eliminated to make the structure more general. The triazole ring was isolated. Strategies for searching property information



93 Experimental property data tags (/ETAG) Properties in Registry/CAPlus

94 Beginning March 20 th, 2005, over 2 million substances in REGISTRY will be enriched with tags pointing to additional experimental data. 186 CAS data tags (includes 13 existing) 38 InfoChem data tags Tags point to CA references Many charts, spectra, & tables are referenced Experimental property tags allow you to navigate from REGISTRY to the document where the property was reported Properties in Registry/CAPlus

95 Properties in Registry => e property data/fa E1 1278 PR/FA E2 1278 PREFERRED REGISTRY NUMBER/FA E3 22.110832 --> PROPERTY DATA/FA E4 1.854687 PROPERTY TAGS/FA E5 21508929 PSA/FA E6 52711311 REF.CA/FA E7 646085 REF.CAD/FA E8 1448140 REF.CAOLD/FA E9 52755909 REF.CAPLUS/FA E10 65579 REFRACTIVE INDEX/FA E11 162710 RELATED POLYMERS/FA E12 522144 REPLACED REGISTRY NUMBER/FA

96 Experimental property data tags Properties in Registry/CAPlus => e a/etag **** START OF FIELD ****....... E5 2961 ACID/BASE DISSOCIATION CONSTANT (KA/KB)/ETAG....... E18 2952 BORON-11 NMR SPECTRA/ETAG....... E33 65766 CRYSTAL STRUCTURE/ETAG....... E57 10340 ESR SPECTRA/ETAG....... E88 588673 IR ABSORPTION SPECTRA/ETAG....... E110 561130 MASS SPECTRA/ETAG....... => s e5 L1 2961 "ACID/BASE DISSOCIATION CONSTANT (KA/KB)"/ETAG

97 Properties in Registry/CAPlus Experimental property data tags => d prop Experimental Property Tags (ETAG) PROPERTY | NOTE =======================================+======= Acid/Base Dissociation Constant (Ka/Kb)|(1) CAS Carbon-13 NMR Spectra |(1) CAS Proton NMR Spectra |(1) CAS Jaszberenyi, Z.; Dalton Transactions 2005(4) P694-701 CAPLUS (1) Jaszberenyi, Z.; Dalton Transactions 2005(4) P694-701 CAPLUS Predicted Properties (PPROP) PROPERTY (CODE) | VALUE | CONDITION | NOTE ============================+===================+===========+======= Bioconc. Factor (BCF) |1.03 |pH 1 |(1) ACD.................

98 Properties in Registry/CAPlus

99 Experimental property data tags Properties in Registry/CAPlus ANSWER 1 CAPLUS COPYRIGHT 2006 ACS on STN ACCESSION NUMBER: 2005:38254 CAPLUS Full-textFull-text DOCUMENT NUMBER: 143:306245 TITLE: Synthesis and determination of acid dissociation constants of some new 4,5-dihydro-1H-1,2,4-triazol-5- one derivatives AUTHOR(S): Yueksek, Haydar; Bahceci, Sule; Ocak, Zafer; Oezdemir, Mustafa; Ocak, Mirac; Ermis, Burhan; Mutlu, Tolga CORPORATE SOURCE: Department of Chemistry, Kafkas University, Kars, 36100, Turk. SOURCE: Asian Journal of Chemistry (2005), 17(1), 195-201 CODEN: AJCHEW; ISSN: 0970-7077 PUBLISHER: Asian Journal of Chemistry DOCUMENT TYPE: Journal LANGUAGE: English

100 Search Question: Find the Youngs modulus of alumina. Strategies for searching property information

101 => fil reg => e young/etag E1 698 X-RAY SCATTERING/ETAG E2 2310 X-RAY SPECTRA/ETAG E3 0 --> YOUNG/ETAG E4 3260 YOUNG'S MODULUS/ETAG **** END OF FIELD **** => alumina/cn L1 1 ALUMINA/CN => l1 and e4 3260 "YOUNG'S MODULUS"/ETAG L2 1 L1 AND "YOUNG'S MODULUS"/ETAG Strategies for searching property information

102 => d qrd L2 ANSWER 1 OF 1 REGISTRY COPYRIGHT 2006 ACS on STN RN 1344-28-1 REGISTRY ED Entered STN: 16 Nov 1984 CN Aluminum oxide (Al2O3) (8CI, 9CI) (CA INDEX NAME)....................... Experimental Property Tags (ETAG) PROPERTY | NOTE ===============+======== Young's Modulus| (1) CAS Young's Modulus| (2) CAS............... (1) Neagu, R.; Key Engineering Materials 2004 V264-268(Pt. 2, Euro Ceramics VIII) P1087-1090 CAPLUS Strategies for searching property information

103 => FIL CAPLUS => D ACC 2004:653081 IBIB ANSWER 1 CAPLUS COPYRIGHT 2006 ACS on STN ACCESSION NUMBER: 2004:653081 CAPLUS Full-textFull-text DOCUMENT NUMBER: 141:247149 TITLE: Non-destructive method for impact resisting alumina composites characterization AUTHOR(S): Neagu, R.; Motoc, S.; Volceanov, E.; Gurban, A. M.; Motoc, A. M. CORPORATE SOURCE: Dept. of Refractory Materials, Metallurgical Research Institute ICEM SA, Bucharest, Rom. SOURCE: Key Engineering Materials (2004), 264-268(Pt. 2, Euro Ceramics VIII), 1087-1090 CODEN: KEMAEY; ISSN: 1013-9826 PUBLISHER: Trans Tech Publications Ltd. DOCUMENT TYPE: Journal LANGUAGE: English Strategies for searching property information

104 Find pka of Camphorsulfonic acid (3144-16-9)

105 Properties in Registry/CAPlus => fil reg => 3144-16-9 L1 1 3144-16-9 (3144-16-9/RN) => d prop

106 Properties in Registry/CAPlus Experimental Property Tags (ETAG) PROPERTY | NOTE ====================================================+======= Dielectric Constant |(1) CAS Electric Current-Potential Curve |(2) CAS IR Reflectance Spectra |(1) CAS 1 more tag shown in the MAX or ETAGFULL formats| Optical Rotatory Power |(3) CAS 1 more tag shown in the MAX or ETAGFULL formats| Partition Coefficient |(4) IC UV and Visible Absorption Spectra |(2) CAS X-Ray Reflectance Spectra

107 Properties in Registry/CAPlus Predicted Properties (PPROP) PROPERTY (CODE) | VALUE | CONDITION |NOTE =============================+====================+================+====.................. PKA (PKA) |1.17+/-0.50 |Most Acidic |(1) | |298 K |

108 => fil caplus => l1(l)prp/rl L2 213 L1(L)PRP/RL => l2 and pka L3 2 L2 AND PKA Properties in Registry/CAPlus

109 AN 1981:36188 CAPLUS Full-textFull-text DN 94:36188 TI Therapeutic doses and physicochemical constants of bases and acids AU Volpi, A.; Toffoli, F. CS Farm. "Al Moro", Mantua, Italy SO Bollettino Chimico Farmaceutico (1979), 118(10), 594-609 CODEN: BCFAAI; ISSN: 0006-6648 DT Journal LA Italian Properties in Registry/CAPlus

110 AB A study of.apprx.100 acidic and basic drugs showed the following relation: log1/D is a function of (log 1/Ka)(log1/S), where D is the av. max. dose for adults (expressed in moles), Ka is the dissocn. const. of the protonated form of the compd., whether acid or base, and S is a soly. parameter inversely proportional to the thermodn. activity coeff.,, of the undissocd. mol. in dil. aq. soln. More commonly expressed, with p being the neg. logarithm, pD is a function of ( pKa )(pS). A plot of pD vs. (pKa )(pS) gave a hyperbola, the 2 arms of which were nearly straight lines. Properties in Registry/CAPlus

111 Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00 Novità in STN (Altri STN Files) Dr. U. Klemm STN 11.00 - 11.30 Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS 11.30 - 11.45 Coffee Break 11.45 - 12.30 La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo 12.30 - 14.00 Lunch 14.00 - 14.30 Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei 14.30 - 15.15 Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS 15.15 - 15.30 Coffee Break 15.30 - 16.00 Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

112 Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00 Novità in STN (Altri STN Files) Dr. U. Klemm STN 11.00 - 11.30 Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS 11.30 - 11.45 Coffee Break 11.45 - 12.30 La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo 12.30 - 14.00 Lunch 14.00 - 14.30 Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei 14.30 - 15.15 Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS 15.15 - 15.30 Coffee Break 15.30 - 16.00 Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

113 Ricerca del polimorfismo di composti organici in STN Terza Parte Simona Casolla Dipharma S.p.A Barbara Riva Antonio Tarquini Notarbartolo&Gervasi S.p.A. 2006

114 Polimorfismo Esistenza di forme cristalline diverse per una stessa sostanza Polimorfismo dei composti organici solidi Polimorfismo dei composti organici solidi ad attività farmacologica (API)

115 Problema scientifico e brevettuale I polimorfi degli APIs diventano oggetto di interesse scientifico e brevettuale, perché 1.sono dotati di caratteristiche chimico fisiche che ne consentono un isolamento favorevole (solubilità,condizioni di cristallizzazione,ecc…). 2. caratterizzate da particolari proprietà reologiche (igroscopicità, scorrevolezza, caricabilità elettrostatica, ecc…) 3.sono dotati di diversa biodisponibilità e quindi di peculiari attività farmacologiche. I polimorfi degli APIs, oggetto di interesse brevettuale, ne condizionano fortemente produzione e/o commercializzazione.

116 Polimorfismo User's Days 2004-2005

117 Marpat (Prev.) Registry Ifiudb USPat. (it,ti,st,clm,ab) Ifiref HCAPlus (PATIPC) Wpindex (DCR) Others Wpids (FC-MC) DUP. IDE. FSORT Citations Patents search flow-sheet (only subscribers) Ricerca documentale non brevettuale

118 Marpat (Prev.) Registry Ifiudb USPat. (it,ti,st,clm,ab) Ifiref HCAPlus (PATIPC) Wpindex (DCR) Others Wpids (FC-MC) DUP. IDE. FSORT Citations Patents search flow-sheet (only subscribers) Ricerca documentale brevettuale

119 Marpat (Prev.) Registry Ifiudb USPat. (it,ti,st,clm,ab) Ifiref HCAPlus (PATIPC) Wpindex (DCR) Others Wpids (FC-MC) DUP. IDE. FSORT Citations Patents search flow-sheet (only subscribers) Creazione di un profilo di ricerca (Q def ) applicabile nel B.I. di altri files


121 User's Day 2004-2005 ricerca di records sul polimorfismo di un particolare API => s L sel chem /prp (L) / and Q def and p/dt

122 User's Day 2004-2005 ricerca di records anche orientati allo studio cristallografico di composti organici (es.APIs) => [Q def and (organic or applied)/cc and (22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 33 or 46 or 50 or 63 or 64 or 70 or 75)/cc] or [Q def and (org or pia or 1 or 2)/cc and (75 or 63)/sx] and p/dt

123 User's Day 2004-2005 => Q poly

124 Marpat (Prev.) Registry Ifiudb USPat. (it,ti,st,clm,ab) Ifiref HCAPlus (PATIPC) Wpindex (DCR) Others Wpids (FC-MC) DUP. IDE. FSORT Citations Patents search flow-sheet (only subscribers) La ricerca documentale diventa specificatamente brevettuale Ricerca dei codici UN, NCL, ICC

125 User's Day 2004-2005 (IFI) ricerca di records sul polimorfismo di un particolare API => fil Ifiudb => s (RN/urn,bi or L name )(L) Q def or (RN/urn,bi or L name ) and [L CTs def /BI or (00224 or 01402 or 04239)/un] ricerca di records sul polimorfismo di composti organici (es. APIs) => s (00224 or 01402 or 04239)/un and [(532?-570?)/ncl or (424? or 514?)/ncl] not (520? or 525? or 528?)/ncl => L IFI poly composti organici e composti bioattivi esclusi i polimeri Polimeri e resine

126 User's Day 2004-2005 (Beilstein) ricerca di informazioni riguardanti la natura cristallina di un composto organico (per es. un API) => s BRN (o RN o nome/CN) and (CRYPH or CPT or CPD or CSYS or CSG)/FA => L CRY ricerca di una particolare informazione riguardante la natura cristallina di un particolare composto organico (per es. un API) => s BRN (o RN o nome/CN) and crystal structure determination/KW => L CRY ricerca del riferimento che ha originato l'indexing => sel L CRY 1- BABSAN => L SEL CRY => fil BABS => L SEL CRY /AN

127 User's Day 2006 Composti inorganici e metallorganici Potenziamento e razionalizzazione della Query Miglioramento della modulazione Superamento dei limiti del Sistema (uso dei Full- text files dei patents) Sviluppi della ricerca in IFIREF-IFIUDB La nuova codifica Internazionale I Codici giapponesi Un protocollo di ricerca

128 User's Day 2006 I composti inorganici che presentano polimorfismo sono indicizzati (CAS Registry No.) nelle loro forme polimorfiche

129 User's Day 2006 FeS 2 –Pirite1309-36-0 –Marcassite1317-66-4 TiO 2 –Anatase1317-79-0 –Brookite12188-41-9 CaCO 3 –Calcite13397-26-7 –Aragonite14791-73-2

130 User's Day 2006 I composti organometallici che presentano diverse forme cristalline non sono indicizzati con diversi RNs per ciscuna forma

131 HCAplus Potenziamento e razionalizzazione della Query

132 HCAplus Lo studio della Indicizzazione ed il confronto con il Full Text dei Documenti trovati ha generato un potenziamento della Q def. Si è resa necessaria la razionalizzazione e lottimizzazione di Q def.



135 HCAPlus ricerca di records sul polimorfismo di un particolare API => fil reg...... => L API => sel L API RN => L sel RN => sel L API name => L sel Name => fil hcaplus => s (L sel RN /prp or L sel Name )(L)/and Q def => L Poly 1 and p/dt => L Polypat 1

136 HCAplus => (L sel RN / prp or L sel name )(L)Q def => L Poly 1 => (L sel RN / prp or L sel name ) and Q def not L Poly 1 => L Poly 2 => (L sel RN or L sel name ) and Q def not (L Poly 1 or L Poly 2 ) => L Poly 3

137 HCAplus Miglioramento della modulazione

138 HCAplus Il potenziamento della Q def porta ad un incremento del rumore; è quindi necessario un miglioramento della modulazione.

139 HCAPlus Lo studio del potenziamento di Q def ha permesso l'individuazione di ulteriori cross sections utili alla modulazione della Q def stessa. Le nuove cross sections sono: 1 e 2

140 HCAplus ricerca di records anche orientati allo studio cristallografico di composti organici (es.APIs) => s [Q def and (organic or applied)/cc and (22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 33 or 46 or 50 or 63 or 64 or 70 or 75)/cc] or [Q def and (org or pia 1 or 2)/cc and (75 or 63 or 1 or 2)/sx] and p/dt

141 HCAplus Superamento dei limiti del Sistema

142 Users Day 2005 La policy di indicizzazione di CAS L'errore nella indicizzazione Per trovare i records corrispondenti a lavori in cui struttura cristallina e/o polimorfismo non sono indicizzati, bisogna utilizzare => L sel chem and Q def => L 2 => L 2 not L Poly 1 => L 3 da valutare

143 HCAplus – Full-text Files Per il recupero di documenti brevettuali i cui records in HCAplus non contengono alcuna keywords appartenente a Q def si utilizzano, ove possibile, i Full-Text Patent Files, partendo dalla ricerca condotta in HCAplus. Il presupposto a tale strategia è che in un testo completo, se viene fatto riferimento al polimorfismo, almeno una keyword riguardante questo concetto ci deve essere.

144 HCAplus – Full-text Files => L sel chem and p/dt not (L Poly 1 or L Poly 2 or L Poly 3 ) => L Poly 4 => sel L Poly 4 pn with PC => L sel PC (PC = WO, EP, US, GB, FR(*)) => File Full Text (**) (PCTFULL, EPFULL, USPATFULL, GBFULL, FRFULL(*)) => L sel PC and Q fulldef => L fullpat => d 1- kwic=10 (*)per FRFULL la ricerca è possibile utilizzando i termini in lingua inglese, nel titolo e nellabstract dal 1996 (**)nei BI è permessa la SLART

145 HCAplus – Full-text Files Q fulldef altro non è che Q def,adattata ad una ricerca efficace nel Basic Index di un file full-text, a cui sono stati tolti termini troppo generici come solid o crystal? e tutti i controlled terms


147 IFIREF – IFIUDB Sviluppi della ricerca in IFIREF-IFIUDB

148 IFIREF – IFIUDB Rispetto al preliminare lavoro del 2004, il potenziamento della Q def, con la introduzione di nuove keywords, ha imposto una revisione ed un aggiornamento della strategia di ricerca in IFIREF-IFIUDB

149 IFIREF – IFIUDB IFIREF è la Banca Dati contenente i Codici di Classificazione dell USPTO

150 IFIREF – IFIUDB IFIREF e costituito da quattro File Segments: Classification Records contenenti i codici NCL ed un Dictionary Index del Manuale di Classificazione USPTO, delle materie e tecnologie classificate. Compound Records contenenti i codici Uniterms (UN cmp ) identificativi di specifiche sostanze chimiche strutturabili. Fragment Records contenenti i codici Uniterms (Fragments corrispondenti ad atomi, gruppi funzionali e anelli) in grado di rappresentare strutture Markush, composti generici e composti specifici a cui non corrisponde un UN cmp. General Records contenenti i codici Uniterms (UN prp ) descrittori di proprietà, usi, processi, reazioni, polimeri, classi di polimeri, sostanze naturali, miscele commerciali, classi di composti e composti non strutturabili.

151 IFIREF – IFIUDB Classification Record AN 203982 IFIREF NCL 378073000 LV 5 CT Crystalography 378000000 1 (IPC G01N, A61B, H05G, G21K, H01J) X-RAY OR GAMMA RAY SYSTEMS OR DEVICES 378001000 2 SPECIFIC APPLICATION 378070000 3 Diffraction, reflection, or scattering analysis 378071000 4 Diffractometry 378073000 5 Crystalography


153 IFIREF – IFIUDB Indagine più approfondita del contributo degli Uniterms già utilizzati (00224; 01402; 04239) Individuazione di Uniterms e di NCLs legati allutilizzo di nuovi Controlled Terms da HCAplus

154 IFIREF – IFIUDB Indagine più approfondita del contributo degli Uniterms già utilizzati Il Basic Index di IFIREF contiene i BT, CT, NT, RT ed UF corrispondenti agli Uniterm => fil ifiref => uniterm not uniterm/un Uniterm = 00224; 01402; 04239 => L => d all permette di trovare i records di IFIREF dove esso è BT,NT,RT o UF di altri UNs


156 IFIREF – IFIUDB Individuazione di UNs e di NCLslegati allutilizzo di nuovi Controlled Terms da HCAplus

157 IFIREF – IFIUDB X- Ray spectra Polymorphism (Crystal) Crystal Morphology Crystal Structure Solvates X-Ray Diffractometry Molecular structure Pseudomorphism Amorphous Structure X-Ray Diffraction Powder X-Ray Diffractometry Polymorphism Differential Scanning Calorimetry Isomorphism Diffractometry Crystals Crystallinity X-Ray Spectra Hydrates

158 IFIREF – IFIUDB Il Basic Index di IFIREF contiene controlled words e controlled terms relativo agli UNs ed ai NCLs => fil ifiref => controlled term HCAplus /BI and Class,General/FS controlled terms : solvates, hydrate(s), crystallinity, crystal morphology, X-Ray diffractometry, X-ray diffraction, Differential scanning calorimetry, Powder X-Ray diffractometry, Crystals, Isomorphism, Pseudomorphism => L => sel L ncl,un => d

159 IFIREF – IFIUDB Gli Uniterms corrispondenti ad alcuni CTs HCAplus (crystallinity, solvates, isomorphism, crystals) sono già stati trovati con lapprofondimento della ricerca condotto su gli UNs già conosciuti. La ricerca ha preso in considerazione i NCLs ed gli UNs corrispondenti agli altri CTs HCAplus.

160 IFIREF – IFIUDB UNs selezionati utilizzando i nuovi CTs HCAplus 00087 adduct 02721 hydrates 08956 differential scanning calorimetry NCLs selezionati utilizzando i nuovi CTs HCAplus 423329100 (*) x-ray diffraction pattern 423718000 (*) structure defined x-ray diffraction pattern ((*)principalmente utilizzati per i composti inorganici, nella petrolchimica e combustibili) 378071000 diffraction 378073000 crystallography 378075000 powder technique

161 IFIREF – IFIUDB Anche per i nuovi UNs si conduce lanalisi in Basic Index => fil ifiref => uniterm notuniterm/un Uniterm = 00087; 02721; 08956 => L => d all Non si evidenziano ulteriori codici

162 IFIREF – IFIUDB La stringa di ricerca di records sul polimorfismo di un particolare API diventa quindi => fil Ifiudb => (RN/urn,bi or L name )(L) Q def or (RN/urn,bi or L name ) and [L CTs def /BI or (00224 or 01402 or 01403 or 01405 or 01406 or 02312 or 02721 or 05139 or 03094 or 04239 or 02977 or 02845)/un or (423329100 or 423718000 or 378071000 or 378073000 or 378075000)/ncl ] La ricerca di records sul polimorfismo di composti organici (es. APIs) => [(00224 or 01402 or 01403 or 01405 or 01406 or 02312 or 02721 or 05139 or 03094 or 04239 or 02977 or 02845)/un or (423329100 or 423718000 or 378071000 or 378073000 or 378075000)/ncl ] and [(532? or 534? or 536? or 540? or 544? or 546? or 548? or 552? or 554? or 556? or 558? or 560? or 562? or 564? or 568? or 570?)/ncl or (424? or 514?)/ncl] not (520? or 525? or 528?)/ncl => L IFI poly 23500 records

163 IFI - HCAplus Lo studio dei codici US proiettato su Chemical Abstracts ha permesso di individuare ulteriori sezioni precedentemente trascurate: 17 FOOD AND FEED CHEMISTRY, 1982 TO PRESENT 21 GENERAL ORGANIC CHEMISTRY, 1967 TO PRESENT 45 INDUSTRIAL ORGANIC CHEMICALS, LEATHER, FATS, AND WAXES, 1982 TO PRESENT 48 UNIT OPERATIONS AND PROCESSES, 1967 TO PRESENT 80 ORGANIC ANALYTICAL CHEMISTRY, 1967 TO PRESENT

164 HCAplus ricerca di records anche orientati allo studio cristallografico di composti organici (es.APIs) aggiornata è => s [Q def and (organic or applied)/cc and (17 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 33 or 45 or 46 or 48 or 50 or 63 or 64 or 70 or 75 or 80)/cc] or [Q def and (org or pia or 1 or 2)/cc and (75 or 63 or 1 or 2)/sx] => Q poly and p/dt => Q polypat

165 La nuova codifica Internazionale Users Day 2006

166 Non essendo più utilizzabile PATIPC, che non verrà aggiornato con la Versione 8 della Classificazione Internazionale, lindagine è stata condotta via Web ed i risultati verificati in STN verso un campione di 11 multirecord Patent Families e 91 records individuali (853 brevetti in HCAplus) riguardanti il polimorfismo dei composti organici. Non sono stati introdotti codici direttamente collegabili al polimorfismo o ai concetti ad esso connessi.

167 Users Day 2006 Il potenziamento della Q def ed il miglioramento della modulazione, rispetto a quanto riportato nel 2004, hanno messo in evidenza un uso limitato ma preciso dei seguenti ICs G01N023-20 Investigating or analysing materials by using diffraction of the radiation, e.g. for investigating crystal structure C30B SINGLE-CRYSTAL GROWTH UNIDIRECTIONAL SOLIDIFICATION SINGLE CRYSTALS OR HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE

168 HCAplus I Codici giapponesi

169 HCAplus Dal 2004 è presente in CAplus un thesaurus dei codici brevettuali giapponesi (FTERM)

170 HCAplus => sel L Poly pat pn with "jp => L sel SEL L14 1- PN WITH "JP" : 62 TERMS => s L sel 51 L jp pat

171 HCAplus => e 4C086/GA15/fterm E# FREQUENCY AT TERM -- --------- -- ---- E252 363 3 4C086/GA13/FTERM E253 125 2 4C086/GA14/FTERM E254 195 2 --> 4C086/GA15/FTERM E255 1039 2 4C086/GA16/FTERM E256 299 2 4C086/GA17/FTERM E257 24 2 4C086/GA20/FTERM E258 2 21 4C086/HA00/FTERM E259 148 3 4C086/HA01/FTERM E260 149 2 4C086/HA02/FTERM E261 164 3 4C086/HA03/FTERM E262 230 2 4C086/HA04/FTERM E263 86 2 4C086/HA05/FTERM => e e254+all E264 0 BT5 FTCLA/FTERM FTERM CLASSIFICATION OF THE JAPANESE PATENT OFFICE E265 0 BT4 4/FTERM. Chemistry E266 55727 BT3 4C/FTERM.. Medical Science E267 17202 BT2 4C086/FTERM... Medicines that contain other organic and inorganic compounds E268 0 BT1 4C086/GA00/FTERM.... CHARACTERISTIC CHEMICAL STRUCTURE OF ORGANIC ACTIVE COMPONENTS E269 195 --> 4C086/GA15/FTERM..... Crystal system

172 HCAplus => s L jp pat and 4C086/GA15/FTERM => L Poly jp code jp pat 12 L poly jp code => s (polymorph? or crystal(w)(structure? or morpholog?) or solvate? or hydrate?) and 4!!!!/GA15/FTERM => L Poly jp code 152 L

173 HCAplus

174 ricerca per trovare i records contenenti patents giapponesi relativi al polimorfismo di composti organici (dopo il 2004) => s Q polypat and 4C086/GA15/FTERM

175 Users Day 2006 Un protocollo di ricerca

176 Users Day 2006 Strategia di ricerca completa in STN per il recupero di prior art sul polimorfismo di un composto o una famiglia di composti organici

177 Users Day 2006 => File Registry Ricerca del composto, suoi Sali, solvati e idrati => L RN => sel L RN RN => L sel RN => sel L RN name => L sel Name => File HCAplus => act Q def => s (L sel RN /prp or L sel Name )(L)Q def => L1 => s (L sel RN or L sel ) and Q def not L1 => L2 => s L sel RN and Beilstein/LC => L3 (se L3 > 0) => File Beilstein => s L3 (o BRN o nome/CN) and (CRYPH or CPT or CPD or CSYS or CSG)/FA => d (biblio) => File HCAplus => ricerca dei dati bibliografici => L Bei Caplus => File Rdisclosure => s L sel Name and (polymorph? or crystal(w)(structure? or morpholog?) or DSC or differential scanning calorimetry or thermal analysis => L Rdisc => File IFIUDB => s (RN/urn,bi or L name )(L) Q def or (RN/urn,bi or L name ) and [L CTs def /BI or (00224 or 01402 or 01403 or 01405 or 01406 or 02312 or 02721 or 05139 or 03094 or 04239 or 02977 or 02845)/un or (423329100 or 423718000 or 378071000 or 378073000 or 378075000)/ncl ] => L IFI

178 Users Day 2006 => sel L IFI pn => L sel IFI => File HCAplus => L5 => s (L sel RN or L sel Name ) not (L1 or L2 or L Bei Caplus or L5 ) => L6 => sel L6 pn with WO => L WO => sel L6 pn with EP => L EP => sel L6 pn with US => L US => File PCTFULL => L WO and Q fulldef => L7 => d kwic=10 => …L7 => sel L7 pn =>L8 => File EPFULL => L EP and Q fulldef => L8 => d kwic=10 => …L8 => sel L8 pn =>L9 => File USPATFULL => L US and Q fulldef => L10 => d kwic=10 => …L10 => sel L7 pn =>L10 => File HCAplus => s L6 not (L8 or L9 or L10) => L11 (patent and scientific literature) => s L11 and review/dt => L12 (da valutare) (Analytical Profiles of Drug Substances) => s L11 not L12 => L13 => s L13 and (?cyclodextr? or (inclusion or insertion)(xw)(adduct? or complex?))=> L14 => L13 not L14 =>L15

179 Users Day 2006 Se L15 contiene ancora un numero troppo grande di risposte può essere modulato con le sezioni => s [L15 and (organic or applied)/cc and (17 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 33 or 45 or 46 or 48 or 50 or 63 or 64 or 70 or 75 or 80)/cc] or [L15 and (org or pia or 1 or 2)/cc and (75 or 63 or 1 or 2)/sx] => L16 (da valutare)

180 Users Day 2006 Una buona ricerca sul polimorfismo non può prescindere da una altrettanto buona ricerca sul prodotto (API) e sulle sue preparazioni. Nella parte sperimentale di molti brevetti sono riportate le condizioni di cristallizzazione del prodotto stesso senza che ne venga caratterizzata la forma cristallina. In molti casi queste informazioni anticipano inconsapevolmente le forme cristalline, quindi i polimorfi, nonché la loro preparazione.

181 Users Day 2006 Una buona ricerca sul polimorfismo non può prescindere da una altrettanto buona ricerca sulle formulazioni del prodotto (API). Spesso in diversi lavori di formulazione sono riportate informazioni sul cambiamento di cristallinità in seguito alla formulazione.

182 Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00 Novità in STN (Altri STN Files) Dr. U. Klemm STN 11.00 - 11.30 Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS 11.30 - 11.45 Coffee Break 11.45 - 12.30 La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo 12.30 - 14.00 Lunch 14.00 - 14.30 Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei 14.30 - 15.15 Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS 15.15 - 15.30 Coffee Break 15.30 - 16.00 Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

183 Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00 Novità in STN (Altri STN Files) Dr. U. Klemm STN 11.00 - 11.30 Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS 11.30 - 11.45 Coffee Break 11.45 - 12.30 La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo 12.30 - 14.00 Lunch 14.00 - 14.30 Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei 14.30 - 15.15 Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS 15.15 - 15.30 Coffee Break 15.30 - 16.00 Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

184 STN Users Day Bologna, 6 Dicembre 2006 Idee per impostare e gestire una ricerca in Registry-CAPlus-Marpat

185 Un caso reale QUESITO: stabilire se è noto il derivato dellacido idrossammico uso terapeutico: agente antitumorale Altre informazioni: sono già noti alcuni derivati bifenilici dellacido idrossammico con attività antitumorale. In particolare è già noto: N-idrossi-5-[1,1-bifenile]-2,4-Pentadienammide 2-Propenamide, 3-[1,1'-biphenyl]-4-yl-N-hydroxy-, (2E)- RN=191228-41-8

186 Un caso reale ACCESSION NUMBER: 1998:430728 HCAPLUS Full-textFull-text DOCUMENT NUMBER: 129:148826 TITLE: Preparation of hydroxamic acids and their use as antitumor agents PATENT NO. KIND DATE APPLICATION NO. DATE --------------- ---- -------- -------------------- -------- JP--10182583 A2 19980707 1996JP-0345797 19961225 GRAPHIC IMAGE: ABSTRACT: Hydroxamic acids I [A = CH2CH2, CH:CH, C.tplbond.C; R1, R2 = H, NH2, NO2, OH, halo, C1-4 alkyl, C1-4 alkoxy, C1-4 (di)alkylamino, C1-4 alkylthio; Z = bond, CO, NHCO, CH2; the bond A is at meta or para position against the terminal benzene ring] and their pharmacol. acceptable salts are prepared. Amidation of 3-[4-(N,N-dimethyl)amino]benzoylcinnamic acid with H2NOH.HCl gave the corresponding hydroxamic acid with 14% yield, which at 1 M induced differentiation of A2780 cell.

187 Un caso reale Altre informazioni: - è importante che ci siano almeno due doppi legami coniugati (da 2 a 4, in particolare due) - non sono ammesse sostituzioni sulla catena insatura con doppi legami coniugati - il sostituente bifenilico deve essere necessariamente presente e può anche essere sostituito - oltre allacido sono di interesse anche eventuali sali o esteri Sono di interesse solo le strutture che contengano il bifenile e una catena coniugata contenente almeno due doppi legami. Una ricerca preliminare effettuata in Registry non ha consentito di individuare alcuna struttura con le caratteristiche descritte. La richiesta è per una ricerca più approfondita, soprattutto tra le strutture Markush

188 Considerazioni preliminari SCOPO: elaborare una strategia di ricerca in MARPAT stabilire se la struttura di interesse rientra tra le sostanze profetiche descritte da una struttura Markush [non indicizzate tramite RNs in CAPlus e non indicizzate in Registry (se non già presenti)] nei brevetti contenenti strutture Markush deve essere presente almeno un esempio relativo ad uno specifico composto descritto dalla struttura generica [indicizzato in CAPlus tramite RN] IDEA BASE: cercare di stabilire il miglior compromesso tra la necessità di impostare una buona strategia, la più completa possibile, e contemporaneamente contenere il numero dei risultati che si ottengono OBIETTIVO:

189 Considerazioni preliminari Schema generale della ricerca REGISTRY-HCAPLUS-MARPAT Selezionare una ampia classe di composti contenenti gli ASPETTI STRUTTURALI PRINCIPALI del composto di interesse REGISTRY: Cercare il set di strutture, eventualmente limitandolo introducendo anche il concetto delluso terapeutico, e isolare il set di brevetti presenti in Marpat HCAPLUS: Il set di brevetti isolato in HCAPlus costituisce linsieme nel quale effettuare, in subset, la ricerca per struttura in Marpat MARPAT:

190 REGISTRY Selezionare una ampia classe di composti contenenti gli ASPETTI STRUTTURALI PRINCIPALI del composto di interesse - almeno due doppi legami coniugati (da 2 a 4, in particolare due) - non sono ammesse sostituzioni sulla catena insatura - il sostituente bifenilico può anche essere sostituito - oltre allacido sono di interesse anche eventuali sali o esteri

191 REGISTRY Ricerca preliminare ampia per decidere come selezionare la famiglia degli analoghi strutturali in Registry - Ak, che congiunge Cb alla funzione idrossammica, è una catena da 4 a 8 C, lineare, insatura e con connettività esatta uguale a 2 (per non consentire né ramificazioni né altro tipo di sostituzione sulla catena insatura) - tutti i legami della funzione idrossammica sono ring/chain Si sceglie di incominciare da una struttura di questo tipo per indagare in Registry anche un altro aspetto: i composti di interesse potrebbero essere indicizzati come sali ciclici [la funzione idrossammica ha note proprietà chelanti]

192 REGISTRY Uploading C:\Programmi\STN\Queries\str1.str chain nodes : 1 2 ring/chain nodes : 3 4 5 6 chain bonds : 1-2 2-3 ring/chain bonds : 3-4 3-5 5-6 exact/norm bonds : 1-2 2-3 3-4 3-5 5-6 Connectivity : 2:2 E exact RC ring/chain Generic attributes : 2: Type of chain : Linear Saturation : Unsaturated Element Count : Node 2: Unlimited C,C4-8 s L14 ful L17 409176 SEA SSS FUL L14 EXTEND CANDIDATE STRUCTURE SEARCH COMPLETED - 409176 TO ITERATE 100.0% PROCESSED 409176 ITERATIONS ( 1293 INCOMPLETE) 1405 ANSWERS SEARCH TIME: 00.00.09 L18 1405 SEA SSS FUL L14

193 REGISTRY => d scan Ak saturo Ak saturo, ramificato, sostituito da eteroatomi => s L18/complete L19 112 L18/COMPLETE => s L19 and m/rel 1699155 M/REL L20 1 L19 AND M/REL ITERATION INCOMPLETE

194 REGISTRY => d scan in Marpat non si possono cercare i legami ring/chain la eventuale ricerca dei Sali Ciclici va trattata separatamente

195 REGISTRY Uploading C:\Programmi\STN\Queries\str2.str chain nodes : 1 2 3 4 5 6 chain bonds : 1-2 2-3 3-4 3-5 5-6 exact/norm bonds : 1-2 2-3 3-4 3-5 exact bonds : 5-6 Connectivity : 2:2 E exact RC ring/chain Generic attributes : 2: Type of chain : Linear Saturation : Unsaturated Element Count : Node 2: Limited C,C4-8 => s L29 ful L30 122814 SEA SSS FUL L29 EXTEND CANDIDATE STRUCTURE SEARCH COMPLETED - 122814 TO ITERATE 100.0% PROCESSED 122814 ITERATIONS ( 1245 INCOMPLETE) 1312 ANSWERS L31 1312 SEA SSS FUL L29 (contro 1405) => s L31/complete L32 67 L31/COMPLETE (contro 122)

196 REGISTRY => s L29 ful L30 122814 SEA SSS FUL L29 EXTEND CANDIDATE STRUCTURE SEARCH COMPLETED - 122814 TO ITERATE 100.0% PROCESSED 122814 ITERATIONS ( 1245 INCOMPLETE) 1312 ANSWERS L31 1312 SEA SSS FUL L29 (contro 1405 L18) => s L31/complete L32 67 L31/COMPLETE (contro 122 L19) => s L19 not L32 L33 45 L19 NOT L32 => d scan Cè qualcosa che non va con Ak anche tra le strutture /COMPLETE !!

197 REGISTRY Nellambito della famiglia degli analoghi strutturali in Registry tentiamo di isolare quelli strutturalmente più vicini al composto di interesse Set base di strutture in Registry: L30 122814 S L29 FUL EXTEND L31 1312 S L29 FUL => s L31 and BIPHENYL 451935 BIPHENYL L34 10 L31 AND BIPHENYL => D SCANNESSUNA STRUTTURA INTERESSANTE => S L31 AND PENTADIENAMIDE 2539 PENTADIENAMIDE L35 18 L31 AND PENTADIENAMIDE => D SCAN ALCUNE STRUTTURE INTERESSANTI

198 REGISTRY Ad es.: => S L31 and C H N O/ELF 8064414 C H N O/ELF L36 908 L31 AND C H N O/ELF => S L36 AND 2/O(P)1/N 5884777 2/O 5286019 1/N 1043485 2/O(P)1/N L37 19 L36 AND 2/O(P)1/N => D SCAN ALCUNE STRUTTURE INTERESSANTI

199 REGISTRY Ad es.: L35 18 (L31 AND PENTADIENAMIDE) e L37 19 (L31 AND C H N O/ELF AND 2/O(P)1/N) Set di composti strutturalmente più vicini alla sostanza di interesse

200 HCAPLUS Cercare il set di strutture isolate in Registry, eventualmente limitandolo introducendo anche il concetto delluso terapeutico, e isolare il set di brevetti presenti in Marpat => d his FILE 'REGISTRY' SET EXTEND ON PERM L30 122814 S L29 FUL EXTEND L31 1312 S L29 FUL L34 10 S L31 AND BIPHENYL L35 18 S L31 AND PENTADIENAMIDE L36 908 S L31 AND C H N O/ELF L37 19 S L36 AND 2/O(P)1/N SI CREANO TRE DIVERSI SET DA PORTARE IN MARPAT => s L30 L38 46124 L30 => s L38 and marpat/os L78 7572 L38 AND MARPAT/OS L78: BREVETTI MARPAT DA STRUTTURE ISOLATE IN REGISTRY

201 HCAPLUS => s (?TUMOR? OR ?NEOPLAS? OR ?CANCER? OR ?CARCINO? OR ?ONCOL? OR((HISTONE DEACETYLASE) (2A) INHIB?)) L42 860819 => s L42 and marpat/os L43 21073 L42 AND MARPAT/OS L43: BREVETTI MARPAT RELATIVI ALLUSO TERAPEUTICO => s L35 L39 15 L35 => s L37 L40 43 L37 => s L39 or L40 L41 48 L39 OR L40 => s L41 and L42 L44 28 L41 AND L42 => s L44 and marpat/os L45 15 L44 AND MARPAT/OS L45: BREVETTI MARPAT DA COMPOSTI PIU SIMILI+USO TERAPEUTICO => s L44 not p/dt L46 13 L44 NOT P/DT L46: NON PATENT LITERATURE DA COMPOSTI PIU SIMILI+USO TERAPEUTICO

202 HCAPLUS MARPAT SI TRASPORTANO IN MARPAT I TRE DIVERSI SET ISOLATI IN HCAPLUS => d L43 an 9500 L43 ANSWER 9500 OF 21073 HCAPLUS COPYRIGHT 2006 ACS on STN AN 2002:51976 HCAPLUS DN 136:123640 => S L43 RANGE=(2002:51976, ) 68016 MARPAT/OS L72 9500 L42 AND MARPAT/OS => d L43 an 18000 L43 ANSWER 18000 OF 21073 HCAPLUS COPYRIGHT 2006 ACS on STN AN 1991:680483 HCAPLUS DN 115:280483 => S L43 RANGE=(1991:680483, ) 195084 MARPAT/OS L73 18000 L42 AND MARPAT/OS => s L43 not L73 L74 3073 L43 NOT L73 => s L73 not L72 L75 8500 L73 NOT L72

203 MARPAT => s L78 L79 7572 L78 L79: BREVETTI MARPAT DA STRUTTURE ISOLATE IN REGISTRY (7572) => s L72 L80 9500 L72 => s L74 L81 3073 L74 => s L75 L82 8500 L75 => s L80 or L81 or L82 L83 21073 L80 OR L81 OR L82 L83: BREVETTI MARPAT RELATIVI ALLUSO TERAPEUTICO (21073) => s L45 L84 15 L45 L84: BREVETTI MARPAT DA COMPOSTI PIU SIMILI+USO TERAPEUTICO (15) => fil marpat

204 MARPAT Il set di brevetti isolato in Registry-HCAPlus costituisce linsieme nel quale effettuare, in subset, la ricerca per struttura in Marpat Uploading C:\Programmi\STN\Queries\marpat.str Match Level : 1:CLASS 2:CLASS 3:CLASS 4:CLASS 5:CLASS 6:CLASS 7:CLASS 8:CLASS 9:CLASS 10:CLASS 11:CLASS 12:CLASS 13:CLASS 14:CLASS 15:CLASS 16:CLASS 17:CLASS 18:CLASS 19:CLASS 20:CLASS La struttura viene cercata a liveLLo CLASS, UNLIMITED

205 MARPAT => s L85 ful sub=L79 L87 3556 SEA SUB=L79 SSS FUL L85 EXTEND CANDIDATE STRUCTURE SEARCH COMPLETED - 3556 TO ITERATE 100.0% PROCESSED 3556 ITERATIONS 41 ANSWERS SEARCH TIME: 00.00.04 L88 41 SEA SUB=L79 SSS FUL L85 L79: BREVETTI MARPAT DA STRUTTURE ISOLATE IN REGISTRY (7572) ANALISI DEI RISULTATI 1. Si cercheranno per primi eventuali documenti relativi alla sostanza impiegata per luso terapeutico indicato 2. Si cercheranno poi eventuali altri riferimenti alla sostanza di interesse

206 ANALISI DEI RISULTATI => s L88 and L84 L89 2 L88 AND L84 L84: BREVETTI MARPAT DA COMPOSTI PIU SIMILI+USO TERAPEUTICO (15) => d fhit MSTR 1 G1 = H / alkyl /...... G10 = bond / C(O) / S(O) / SO2 / S /........ G20 = 95 / 40 G9 = 35-2 8-9 / 41-2 43-9 / 45-2 46-9 G4 = H /... G22 = H / R G16 = G19 / carbon chain (opt. substd.) / CH=CH / CH=CHCH=CH G17 = OH / SH / alkylthio / alkoxy / 75 G28 = NH / 112 G29 = NH2 / alkylamino / dialkylamino / OH / alkoxy

207 ANALISI DEI RISULTATI Patent Location: claim 1 Note: and pharmaceutically acceptable salts ACCESSION NUMBER: 2005:120719 HCAPLUS DOCUMENT NUMBER: 142:197670 TITLE: Preparation of phenylalkyl acid derivatives as histone deacetylase inhibitors INVENTOR(S): Marson, Charles PATENT ASSIGNEE(S): University College London, UK PATENT INFORMATION: PATENT NO. KIND DATE APPLICATION NO. DATE --------------- ---- -------- -------------------- -------- WO 2005011661 A1 20050210 WO 2004-GB3155 20040719 AB Compds. of formula I [R1-R5 = H, alkyl, alkoxy, OH, halo, amino, nitro, CN, etc.; R6 = H, alkyl, etc; R7, R8 = H, halo, alkyl, aryl, heterocyclyl, (substituted) OH, etc.; R6R8 = CH2; X = (substituted) OH, SH, NHOH, etc.; Y = (substituted) alkenylene, alkylene; W = CONH, SO2NH, etc.] are prepared for use in treating a disorder mediated by histone deacetylase. The compds. are useful in the treatment of cancers. They may be utilized in combination therapies with DNA methylation inhibitors and other anti cancer agents. Thus, II was prepared, and had IC50 of 49 nM against histone deacetylase.

208 ANALISI DEI RISULTATI HITSTR Titolo: PHARMACEUTICAL AGENTS Riassunto: Use of compounds of formula (I) in the manufacture of a medicament for use in treating a disorder mediated by histone deacetylase: wherein the symbol ---- represents a single bond or a double bond or the symbol ---- R 6 and R 8 together represent cyclopropyl and R 1 to R 8 W, X and Y are as defined herein; and pharmaceutically acceptable salts thereof. Also disclosed are compounds for such uses. The compounds are useful in the treatment of cancers. They may be utilised in combination therapies with DNA methylation inhibitors and other anti cancer agents.

209 ANALISI DEI RISULTATI Estratto dalla descrizione: A preferred class of compounds according to the invention have the formula (II) : wherein R1, R2, R6, R18, W and X are as defined above and m is 1, 2 or 3; and pharmaceutically acceptable salts thereof. More especially, R1 and R2 each independently represent hydrogen, C1-C6 alkyl, C1-C6 alkxoy, halo or (C1-C6 alkoxy) carbonyl; R6 and R18 are each independently selected from hydrogen, C1-C4 alkyl or C1-C4 alkoxy ; W represents a single bond,-CH=N-,-N=CH-,-CONH-,-NHCO-, -SO2NH-,-NHSO2-,- OCH2-,-CH2O-,-CH2S-or-SCH2-; and X represents-NHOH, CF3 or-OR14 wherein R14 is hydrogen or Cl-C4 alkyl. Rivendicazione 9: Use according to claim 1, wherein the compound is of formula (II): wherein R1, R2, R6, R18, W and X are as defined above and m is 1,2 or 3; and pharmaceutically acceptable salts thereof Commenti Linvenzione è relativa alluso di una classe di composti nel trattamento dei disordini mediati da histone deacetylase. Tali composti sono utili nel trattamento del cancro. Una classe preferita di composti è quella descritta dalla formula (II). La struttura (II) dove in particolare R1, R2, R6,R18 = idrogeno; W = legame singolo; X = -NHOH corrisponde al composto N-idrossi-5-[1,1-bifenile]-2,4-Pentadienammide che pertanto è descritto dalla formula Markush (II).

210 ANALISI DEI RISULTATI => s L88 and L83 L97 24 L88 AND L83 L83: BREVETTI MARPAT RELATIVI ALLUSO TERAPEUTICO (21073) => s L88 not L97 L101 17 L88 NOT L97 SOLO STRUTTURE AN 106:175956 MARPAT Full-textFull-text TI Preparation of aryl hydroxamic acid derivatives, compositions containing them, and their use in medicine and other applications. EP----196184 A2 19861001 Alcune HITSTR:

211 ANALISI DEI RISULTATI Titolo: ARYL DERIVATIVES Novel compounds of formula (I) Ar-(L-Ar') q -(X) k -(Y) p -Q wherein:...... Commenti Linvenzione è relativa ad una classe di composti inibitori della lipossigenasi e/o della ciclossigenasi che possiedono utili proprietà mediche sia terapeutiche che profilattiche. Tra i composti descritti dalla formula Markush (I) segnaliamo la classe di composti che si ottiene quando: q, k = 0 p = 1 Ar = Ph-Ph Y = C1-10 alkenylene Q = -C(O)-NH-OH tale famiglia di composti contiene anche l N-idrossi-5-[1,1-bifenile]-2,4-Pentadienammide

212 ALTRE IDEE PER SFRUTTARE IL SET DEI COMPOSTI STRUTTURALMENTE PIU SIMILI Da tentare soprattutto se il set ha già dato buoni risultati e si è quindi dimostrato ben rappresentativo del composto di interesse => s L44 not p/dt L46 13 L44 NOT P/DT L46: NON PATENT LITERATURE DA COMPOSTI PIU SIMILI+USO TERAPEUTICO ACCESSION NUMBER: 2004:346246 HCAPLUS DOCUMENT NUMBER: 141:71333 TITLE: Stereodefined and polyunsaturated inhibitors of histone deacetylase based on (2E,4E)-5-arylpenta-2,4- dienoic acid hydroxyamides AB Syntheses of (2E,4E)-5-arylpenta-2,4-dienoic acid hydroxyamides are described, some of which are potent inhibitors of histone deacetylase, a double bond conferring more than a 10-fold increase in potency compared with the triple bond analog oxamflatin. Variation of substituents on the aromatic ring has a marked effect on potency, in vitro IC50 values down to 50 nM being obtained

213 RICERCA DELLA NON PATENT LITERATURE TITLE: Preparation of phenylalkyl acid derivatives as histone deacetylase inhibitors INVENTOR(S): Marson, Charles PATENT ASSIGNEE(S): University College London, UK PATENT INFORMATION: PATENT NO. KIND DATE APPLICATION NO. DATE --------------- ---- -------- -------------------- -------- WO 2005011661 A1 20050210 WO 2004-GB3155 20040719 AUTHOR(S): Marson, Charles M.; Serradji, Nawal; Rioja, Alphonso S.; Gastaud, Sebastien P.; Alao, John P.; Coombes, R. Charles; Vigushin, David M. CORPORATE SOURCE: University College London, Department of Chemistry, Christopher Ingold Laboratories, London, WC1H OAJ, UK SOURCE: Bioorganic & Medicinal Chemistry Letters (2004), 14(10), 2477-2481 CODEN: BMCLE8; ISSN: 0960-894X in un altro contesto temporale poteva essere un documento molto significativo……

214 ©Petra Gnemmi Quaestio ® by Studio Moradei Patent Information Partners via Sanvito, 43 21100 Varese e-mail:

215 Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00 Novità in STN (Altri STN Files) Dr. U. Klemm STN 11.00 - 11.30 Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS 11.30 - 11.45 Coffee Break 11.45 - 12.30 La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo 12.30 - 14.00 Lunch 14.00 - 14.30 Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei 14.30 - 15.15 Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS 15.15 - 15.30 Coffee Break 15.30 - 16.00 Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

216 A Patent Search (Registry, CAPLus, Marpat) Guglielmo Rucci

217 Question: You need to know the prior art, patents and articles, about complexes containing at least two Platinum atoms, as specified in the following structure.

218 Anything between N and Pt

219 Registry-CAPLus

220 => fil reg STRUCTURE UPLOADED => d L1 STR

221 chain nodes : 2 3 5 ring/chain nodes : 1 4 chain bonds : 1-2 1-3 4-5 exact bonds : 1-2 1-3 4-5 Hydrogen count : 2:= exact 3 5:= exact 3 Connectivity : 3:2 M minimum RC ring/chain Match level : 1:CLASS 2:CLASS 3:CLASS 4:CLASS 5:CLASS UNLIMITED


223 => fil reg => b8/pg (Fe, Co, Ni, Ru, Rh, Pd, Os, Ir, Pt) L1 1864947 B8/PG => L2 STRUCTURE UPLOADED => l2 full subset=l1 L4 1347 SEA SUB=L1 SSS FUL L2

224 => l4 and pt=>2 L5 521 L4 AND PT=>2 => fil caplus => l5 L6 207 L5 => l6 and p/dt L7 38 L6 AND P/DT







231 Registry-Caplus-MARPAT


233 > fil reg => pt/els L1 141409 PT/ELS => fil caplus => l1 and marpat/os L2 3380 L1 AND MARPAT/OS

234 => fil marpat => l2 L3 3380 L2 => L4 STRUCTURE UPLOADED => l4 full subset=l3 L6 24 SEA SUB=L3 SSS FUL L4 (Eight patents original from Marpat)

235 G7= 50 G8= NH3 / alkylamine G11= Pt

236 G1= NH3 G3, G5= G4= NH3 G19= Pt

237 G4, G6= NH3 G5=24 G1= Pt

238 G3= Pt G1= H / carbon chain

239 G1= 1G2= NH3 (opt. substd.)G3= halogen anion

240 Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00 Novità in STN (Altri STN Files) Dr. U. Klemm STN 11.00 - 11.30 Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS 11.30 - 11.45 Coffee Break 11.45 - 12.30 La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo 12.30 - 14.00 Lunch 14.00 - 14.30 Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei 14.30 - 15.15 Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS 15.15 - 15.30 Coffee Break 15.30 - 16.00 Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

241 Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00 Novità in STN (Altri STN Files) Dr. U. Klemm STN 11.00 - 11.30 Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS 11.30 - 11.45 Coffee Break 11.45 - 12.30 La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo 12.30 - 14.00 Lunch 14.00 - 14.30 Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei 14.30 - 15.15 Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS 15.15 - 15.30 Coffee Break 15.30 - 16.00 Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

242 Seminari 2006 Consorzio Scuole Lavoro Milano via G.B. Pergolesi 8

243 STN Easy - STN Expressmartedì 10/01/2006Gennaio STN Express+Discover! - STN on the Webmercoledì 11/01/2006Gennaio Le Ricerche Elementari in STNmartedì 17/01/2006Gennaio Il File Registry: La Ricerca Elementaremercoledì 18/01/2006Gennaio La Ricerca in STN con le Keywordsmartedì 24/01/2006Gennaio La Sicurezza e i dati Chimico-fisici dei composti chimicimercoledì 25/01/2006Gennaio Il File Registry: La Ricerca per Struttura 1°martedì 31/01/2006Gennaio Il File Registry: La Ricerca per Struttura 2°mercoledì 01/02/2006Febbraio La Ricerca delle Reazioni 1°martedì 07/02/2006Febbraio La Ricerca delle Reazioni 2°mercoledì 08/02/2006Febbraio Il File Registry: La ricerca via Dictionary 1° (prima parte)martedì 14/02/2006Febbraio Il File Registry: La ricerca via Dictionary 1° (seconda parte)mercoledì 15/02/2006Febbraio Il File Registry: La ricerca via Dictionary 2° (prima parte)martedì 21/02/2006Febbraio Il File Registry: La ricerca via Dictionary 2° (seconda parte)mercoledì 22/02/2006Febbraio Il File Registry: Esercitazioni e Casi Particolarimartedì 28/02/2006Febbraio Patents: Gli Elementi di Basemercoledì 01/03/2006Marzo Patents: Gli Strumenti Principali per la Ricerca (prima parte)martedì 07/03/2006Marzo Patents: Gli Strumenti Principali per la Ricerca (seconda parte)mercoledì 08/03/2006Marzo Patents: Gli Strumenti Secondari per la Ricerca (prima parte)martedì 14/03/2006Marzo Patents: Gli Strumenti Secondari per la Ricerca (seconda parte)mercoledì 15/03/2006Marzo Patents: Studio di un Casomartedì 21/03/2006Marzo La Ricerca dei Farmaceuticimercoledì 22/03/2006Marzo

244 You can find all seminars and also this presentation: Users Meeting 2006 on the WEB:

Scaricare ppt "STN UsersMeeting CNR Bologna 6 Dicembre 2006. Agenda 09.30 - 10.00 Registrazione 10.00 - 10.30 Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – 11.00."

Presentazioni simili

Annunci Google