La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

STN Users’Meeting CNR Bologna 6 Dicembre 2006.

Presentazioni simili


Presentazione sul tema: "STN Users’Meeting CNR Bologna 6 Dicembre 2006."— Transcript della presentazione:

1 STN Users’Meeting CNR Bologna 6 Dicembre 2006

2 Agenda 09.30 - 10.00 Registrazione
Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – Novità in STN (Altri STN Files) Dr. U. Klemm STN Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS Coffee Break La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo Lunch Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS Coffee Break Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

3 What’s New on STN Ursula Klemm, FIZ Karlsruhe Heidrun Waldhoff, CAS
STN User Meeting Bologna December 6, 2006

4 Agenda STN System enhancements and changes
What’s new from FIZ Karlsruhe What’s new from CAS

5 LOGOFF HOLD enhanced Frequently requested enhancement Now 120 minutes

6 CAS Registry crossover limits increased
New limit is 300,000 Applies to the following databases at present ADISCTI, ADISINSIGHT, ADISNEWS, AGRICOLA, AQUIRE, BIOSIS®, CABA, [L]CASREACT®, CHEMCATS, GENBANK, (H)CHEMLIST, IFIPAT/IFIUDB/IFICDB, EMBASE, IMSCOSEARCH, IMSPATENTS, IMSRESEARCH, IPA, JICST E-PLUS, MEDLINE®, MSDS-OHS, PAPERCHEM2, PHAR, PROMT, PROUSDDR, TOXCENTER, TULSA/TULSA2, SYNTHLINE, USPATFULL, USPAT2 More to come! Crossover charges remain the same. See HELP COST in REGISTRY for details.

7 STN is keeping pace with IPC Reform
Almost all patent files include IPC8 codes for all new patent publications from 2006 onwards Consistent implementation of IPC Reform features across the system Backfile reclassification data have been added to INPADOC, CAPLUS, USPATFULL/USPAT2, WPINDEX IPC 8 thesaurus implemented in numerous STN patent databases Planning underway to implement first IPC 8 thesaurus revisions (effective 2007)

8 E-mail messages alerting you to SDI results availability enhanced
Number of Answers in SDI run, SDI Run Number and SDI Run Date are new elements

9 Full-text files now provide KWIC display at no charge
KWIC-format is free when displaying basic index search results in: EPFULL, PCTFULL, FRFULL, GBFULL, PATDPAFULL, USPATFULL, USPAT2, RDISCLOSURE Use TRIAL KWIC for pre-selections Titles (multiple languages) Covered publication types Available fields and images Language information KWIC provides a large amount of text information EXP OCT 06

10 STN Express®, Version 8.01c, now available
8.01c launched on November 10 Post-processing enhanced to handles changes introduced with the Derwent World Patents Index reload Recent STN Express enhancements include: Increased security via SSL VPN Enhanced structure search results analysis in Variable Group Analysis Tool Access to Questel-Orbit’s Merged Markush Service

11 STN® AnaVist™, Version 1.1, enhances the ability to share visualization projects
Share copies of visualization projects with others Create project reports as either .rtf or .pdf documents No charge for software or upgrades Subset visualizations are now free Article in World Patent Information recently published Case study from MeadWestvaco

12 Agenda STN System enhancements and changes
What’s new from FIZ Karlsruhe What’s new from CAS

13 Derwent World Patents Index® - Reloaded & Enhanced
New first level content original titles and abstracts main claim USPTO classes full inventor names New value-add content Documentation Abstract backfile Derwent Chemistry Resource (DCR) backfile IPC Reform (IPC8 / IPC2006) compliance – including the enhanced STN IPC thesaurus Many technical improvements simultaneous left and right truncation in more fields no stop words much faster date search

14 New DWPISM database record structure
DWPI database records now have a new two part structure - invention and members The invention part comprises traditional DWPI content – patent family, enhanced abstract, etc The members part provides new additional data from each of the members (publications) listed in the invention (patent family) part of the record Invention and members parts are searchable and displayable separately or in combination

15 New DWPI database record structure
Invention (patent family) Members (publications) L1 ANSWER 1 OF 1 WPIX COPYRIGHT 2006 THE THOMSON CORP on STN AN [46] WPIX CR TI Optical fiber cable for use as transmission media has strength component system comprising dielectric rods surrounded by frictional adhesion coating which enables movement in response to compressive/flexural stress DC A17; A28; A89; P81; V07 IN NORRIS R H; SMALL R D; THOMAS P M; WEIMANN P A PA (FITE-N) FITEL USA CORP; (NORR-I) NORRIS R H; (SMAL-I) SMALL R D; (THOM-I) THOMAS P M; (WEIM-I) WEIMANN P A PI US A (200346)* G02B006-44 EP A (200424) EN G02B006-44 US B (200454) G02B006-44 EP B (200551) EN G02B006-44 ADT US A1 CIP of US US A1 US US B2 CIP of US US B2 US EP A1 EP EP B1 EP FDT US B2 CIP of US B PRAI US US IC ICM G02B006-44 AB US A1 NOVELTY - An optical fiber cable (10) has plastic tube(s) (120), a jacket (160), and a strength component system. The system has diametrically opposed dielectric rods (300-1, 300-2) which extend parallel to longitudinal axis, at least partially embedded in the jacket. Each rod is surrounded by frictional adhesion coating which enables local movement within the jacket in response to compressive/flexural stress. DETAILED DESCRIPTION - An optical fiber cable (10) having a longitudinal axis, comprises at least one plastic tube (120), a jacket (160), and a strength component system. The plastic tube extends parallel to the longitudinal axis and encloses several optical fibers (101). The MC CPI: A12-L03A EPI: V07-F01B4 Member(0001) PI US A (200346)* EN 9[6] G02B006-44 TIEN Dielectric optical fiber cable having reduced preferential bending AG Michael A. Morra, Fitel USA Corp. Suite F020, 2000 Northeast Expressway, Norcross, GA, US IN NORRIS R H INO: Norris, Richard Hartford INA: Powder Springs, GA, US PA (NORR-I) NORRIS R H PAO: Norris, Richard Hartford PAA: Powder Springs, GA, US ADT US A1 CIP of US ; US A1 US APTS US ; US IC ICM G02B006-44 IIC IICM G02B006-44 INCL INCLM ABEN An optical cable (10) includes one or more tubes (120), each containing a number of optical fibers (101), and a plastic jacket (160) that encloses the tube(s). A pair of diametrically opposed rods (300-1, 300-2) are at least partially embedded in the polyethylene jacket and are made from continuous-filament glass fibers that are embedded in epoxy. Each rod has a compressive stiffness that is effective to inhibit substantial contraction of the cable, and a tensile stiffness that is effective to receive tensile loads without substantial transfer of such loads to the glass fibers. Each dielectric rod CLMEN 1. An optical fiber cable having a longitudinal axis, the cable comprising: at least one plastic tube that extends parallel to the longitudinal axis and encloses a plurality of optical fibers; a jacket, which is made of a plastic material and which encloses the plastic tube; a strength member system comprising two diametrically opposed dielectric rods that extend parallel to the longitudinal axis and are at least partially embedded in the jacket, said rods having a compressive stiffness that is effective to inhibit substantial contraction of the cable and a tensile stiffness that is effective to receive a tensile load without substantial transfer of the tensile load to the optical fibers; wherein each rod is surrounded by a frictional adhesion coating that enables it to move locally within the jacket in response to compressive or flexural stress applied to the cable. Member(0002) PI EP A (200424) EN G02B006-44 TIDE Dielektrisches faseroptisches Kabel mit reduzierter bevorzugter Biegerichtung TIEN Dielectric optical fiber cable having reduced preferential bending TIFR Cable a fibers optiques avec une direction de flexion reduite privilegiee AG Schoppe, Fritz, Dipl.-Ing. Patentanwaelte Schoppe, Zimmermann, Stoeckeler & Zinkler, P.O. Box 246, 82043 Pullach bei Muenchen, DE IN NORRIS R H INO: Norris, Richard Hartford INA: 3362 Chatsworth Way, Powder Springs, GA 30127, US PA (FITE-N) FITEL USA CORP PAO: FITEL USA CORPORATION PAA: 2000 Northeast Expressway, Suite F020, Norcross, Georgia 30071, US ADT EP A1 EP APTS EP PRAI US PRTS US IC ICM G02B006-44 IIC IICM G02B006-44 ABEN An optical cable (10) includes one or more tubes (120), each containing a number of optical fibers (101), and a plastic jacket (160) that encloses the tube(s). A pair of diametrically opposed rods (300-1, 300-2) are at least partially embedded in the polyethylene jacket and are made from continuous-filament glass fibers that are embedded in epoxy. Each rod has a compressive stiffness that is effective to inhibit substantial contraction of the cable, and a tensile stiffness that is effective to receive tensile loads without substantial transfer of such loads to the glass fibers. Each dielectric rod CLMEN An optical fiber cable (10) having a longitudinal axis ( ), the cable comprising: at least one plastic tube (120) that extends parallel to the longitudinal axis and encloses a plurality of optical fibers (101); a jacket (160), which is made of a plastic material and which encloses the plastic tube; a strength member system comprising two diametrically opposed dielectric rods (300-1, 300-2) that extend parallel to the longitudinal axis and are at least partially embedded in the jacket, said rods having a compressive stiffness that is effective to inhibit substantial contraction of the cable and a tensile stiffness that is effective to receive a tensile load without substantial transfer of the tensile load to the optical fibers; X2003X2003X2003wherein each rod is surrounded by a frictional adhesion coating (330) that enables it to move locally within the jacket in response to compressive or flexural stress applied to the cable. Member(0003) PI US B (200454) EN G02B006-44 TIEN Dielectric optical fiber cable having reduced preferential bending IN NORRIS R H INO: Norris, Richard Hartford INA: Powder Springs, GA, US PA (FITE-N) FITEL USA CORP PAO: Fitel USA Corp. PAA: Norcross, GA, US ADT US B2 CIP of US ; US B2 US APTS US ; US FDT US B2 CIP of US B IC ICM G02B006-44 IIC IICM G02B006-44 INCL INCLM INCLS ; ABEN An optical cable (10) includes one or more tubes (120), each containing a number of optical fibers (101), and a plastic jacket (160) that encloses the tube(s). A pair of diametrically opposed rods (300-1, 300-2) are at least partially embedded in the polyethylene jacket and are made from continuous-filament glass fibers that are embedded in epoxy. Each rod has a compressive stiffness that is effective to inhibit substantial contraction of the cable, and a tensile stiffness that is effective to receive tensile loads without substantial transfer of such loads to the glass fibers. Each dielectric rod includes CLMEN What is claimed is: 1. An optical fiber cable having a longitudinal axis, the cable comprising: at least one plastic tube that extends parallel to the longitudinal axis and encloses a plurality of optical fibers; a jacket, which is made of a plastic material and which encloses the plastic tube; a strength member system comprising two diametrically opposed dielectric rods that extend parallel to the longitudinal axis and are at least partially embedded in the jacket, said rods having a compressive stiffness that is effective to inhibit substantial contraction of the cable and a tensile stiffness that is effective to receive a tensile load without substantial transfer of the tensile load to the optical fibers; wherein each rod is surrounded by a frictional adhesion coating that enables it to move locally within the jacket in response to compressive or flexural stress applied to the cable. Member(0004) PI EP B (200551) EN G02B006-44 TIDE Dielektrisches faseroptisches Kabel mit reduzierter bevorzugter Biegerichtung TIEN Dielectric optical fiber cable having reduced preferential bending TIFR Cable a fibres optiques ayant une direction de flexion reduite privilegiee AG Schoppe, Fritz, Dipl.-Ing. Patentanwaelte, Schoppe, Zimmermann, Stoeckeler & Zinkler, P.O. Box 246, 82043 Pullach bei Muenchen, DE IN NORRIS R H INO: Norris, Richard Hartford INA: 3362 Chatsworth Way, Powder Springs, GA 30127, US PA (FITE-N) FITEL USA CORP PAO: FITEL USA CORPORATION PAA: 2000 Northeast Expressway, Suite F020, Norcross, Georgia 30071, US ADT EP B1 EP APTS EP PRAI US PRTS US IC ICM G02B006-44 IIC IICM G02B006-44 CLMEN An optical fiber cable (10) having a longitudinal axis ( ), the cable comprising: at least one plastic tube (120) that extends parallel to the longitudinal axis and encloses a plurality of optical fibers (101); a jacket (160), which is made of a plastic material and which encloses the plastic tube; a strength member system comprising two diametrically opposed dielectric rods (300-1, 300-2) that extend parallel to the longitudinal axis and are at least partially embedded in the jacket, said rods having a compressive stiffness that is effective to inhibit substantial contraction of the cable and a tensile stiffness that is effective to receive a tensile load without substantial transfer of the tensile load to the optical fibers; X2003X2003X2003wherein each rod is surrounded by a frictional adhesion coating (330) that enables it to move locally within the jacket in response to compressive or flexural stress applied to the cable characterized in that the frictional adhesion coating material (330) is selected from the group consisting of: (i) thermoplastic elastomers; (ii) thermally crosslinkable rubbers; and (iii) UV-curable crosslinkable rubbers.

16 DWPI - Sample Record invention level publication level display format:
=> D BIB MEMB L1 ANSWER 1 OF 1 WPINDEX COPYRIGHT 2006 THE THOMSON CORP on STN AN [67] WPIXML TI New nucleic acid molecule comprising at least one junction nucleotide sequence of corn event MIR604, useful for producing a corn plant that is resistant to at least corn rootworm (en) DC C06; D16; P13 IN CHEN E; MEGHIJI M; MEGHJI M; STEINER H PA (SYGN-C) SYNGENTA PARTICIPATIONS AG PI US A (200567)* EN 37[2] WO A (200572) EN ADT US A1 Provisional US P ; US A1 US ; WO A2 WO2005-US PRAI US ; US P invention level Member(0001) PI US A (200567)* EN 37[2] C12Q-1/68 TIEN Corn event MIR604 AG SYNGENTA BIOTECHNOLOGY, INC., PATENT DEPARTMENT 3054 CORNWALLIS ROAD, P.O. BOX 12257, RESEARCH TRIANGLE PARK, NC, US IN STEINER H INO: Steiner, Henry-Yorkd INA: Durham, NC, US..... PA (SYGN-C) SYNGENTA PARTICIPATIONS AG ..... INCL INCLM INCLS ; 4356 ABEN A novel transgenic corn event designated MIR604, is disclosed. The invention relates to DNA sequences of the recombinant constructs inserted into the corn genome and ... CLMEN 1. An isolated nucleic acid molecule comprising at least one junction nucleotide sequence of corn event MIR604 selected …. publication level display format: MEMB

17 New EPO Legal Status in EPFULL
EPFULL is the European Patent Office (EPO) full-text patent database on STN EPFULL has been enhanced with all new EPO Patent Register Legal Status data, incl. history Data includes up-to-date detail unavailable in the INPADOC Legal Status (PRS) service Data is fully searchable - including details of "intention to grant", opposition, licence & reassignment Allows for precision Legal Status Alerts/SDIs! EXP OCT 06

18 EPO Legal Status including history
AN : EPFULL EPB Request for examination EPB Unexamined document without grant, (first publication) WOB PCT publication data EPB Designated contracting states AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE EP A EPB840R Designated contracting states (correction) BE DE ES FR GB IT EPB300R Priority data (correction) OLD: US P P NEW: US P P EPB565EP Drawing up and dispatch of supplementary search report (EPA4) EPB840R Designated contracting states (correction) EPB Dispatch of the first examination report EPB452EP Intention to grant EPB840R Designated contracting states (correction) EPB Document with grant, second publication D BIB.M LSEP.M format (cont.). Details in RED are not available in INPADOC. Historical data, e.g. old priority numbers. Use (P) proximity to combine terms within single Legal Status events, e.g. code (LSC) and date (LSD).

19 Monitor „Intention to Grant“ in EPFULL
=> FILE EPFULL => S HITACHI/PA L HITACHI/PA => E EPB452EP/LSC E EPB451EP ANNOUNCEMENT OF INTENTION TO GRANT/LSC E > EPB452EP/LSC E EPB452EP INTENTION TO GRANT/LSC E EPB452EPD/LSC E EPB452EPD INTENTION TO GRANT (DELETED)/LSC E EPB452EPR/LSC E EPB452EPR INTENTION TO GRANT (CORRECTION)/LSC E EPB475/LSC E EPB LAPSE OF PATENT/LSC E EPB475D/LSC E EPB475D LAPSE OF PATENT (DELETED)/LSC => S L1 AND EPB452EP/LSC(P)UPLS= L2 8 L1 AND EPB452EP/LSC(P)UPLS= Unique to STN: searchable EPO Legal Status Codes. Identify the relevant Legal Status Codes. Use (P)-operator to combine LSC with LSUP New: Complete list of Legal Status Codes:

20 Monitor Intention to Grant in EPFULL
=> D BIB.M HIT L2 ANSWER 1 OF EPFULL COPYRIGHT 2006 EPO/FIZ KA on STN AN : EPFULL EDP ED UP DUPD DUPW TIEN Storage apparatus for asynchronous remote copying. TIFR Dispositif de stockage de donnees permettant le miroitage asynchrone de donnees a distance. TIDE Speichervorrichtung fuer asynchrone entfernte Datenspiegelung. IN Muto, Yoshiakic/o Hitachi Ltd, Intel Prop Group6-1, Marunouchi 1-chome, Chiyoda-kuTokyo , JP; . . . PA Hitachi, Ltd., 6-6, Marunouchi 1-chome Chiyoda-ku, Tokyo, JP PIT EPA1 Application published with search report PI EP A DS DE FR GB AI EP A PRAI JP A

21 Monitor Intention to Grant in EPFULL
LEGAL STATUS AN : EPFULL EPB452EP Intention to grant => QUE L1 AND EPB452EP/LSC(P)UPLS/LAST L3 QUE L1 AND EPB452EP/LSC(P)UPLS/LAST => SDI L3 ENTER UPDATE FIELD CODE (UP) OR ?:UPLS ENTER SDI REQUEST NAME, (AA006/S), OR END:HITACHI/S . . . ENTER PRINT FORMAT (STD.M) OR ?:MAX HIGHLIGHT HIT TERMS? (Y)/N:y ARCHIVE ANSWERS? Y/(N):. REDISTRIBUTE ANSWERS? Y/(N):. ENTER MAXIMUM NUMBER OF HITS TO BE PRINTED PER RUN (100):. SORT SDI ANSWER SET (N)/Y?:. SEND SDI WITH NO ANSWERS? (Y)/N:. ENTER SDI EXPIRATION DATE 'YYYYMMDD' OR (NONE):. QUERY L9 HAS BEEN SAVED AS SDI REQUEST ‘HITACHI/S' Combine data within one legal status entry with (P) Use UPLS as update code MAX= ALL.M + LSEP.M

22 coming soon…! Producer: SequenceBase Corporation
USGENE is The USPTO Genetic Sequence Database – a completely new resource for comprehensive patent sequence searches Producer: SequenceBase Corporation Coverage: USPTO published application & issued patent sequences, 1982 to present Text: original title, abstract & claims Includes: SEQ ID NOs, full patent assignee & inventor names, numbers and dates

23 A typical record from USGENE on STN
L1 ANSWER 1 OF 347 USGENE COPYRIGHT SEQUENCEBASE CORP on STN ACCESSION NUMBER: cDNA USGENE TITLE: Human N-methyl-D-aspartate receptor subunits, nucleic acids encoding same and uses therefor (Patent) INVENTOR: Daggett Lorrie P. (San Diego, CA); Lu Chin-Chun (San Diego, CA) PATENT ASSIGNEE: Merck & Co Inc (Rahway NJ) PATENT INFO: US B APPLICATION INFO: US DOCUMENT TYPE: Patent ORGANISM: Not provided ABSTRACT: In accordance with the present invention, there are provided nucleic acids encoding human NMDA receptor protein subunits and . . . CLAIMS: US B2: What is claimed: 1. An isolated and substantially pure N-methyl-D-aspartate receptor subunit comprising an amino acid sequence as set forth in SEQ ID NO:56, . . . BLASTALIGN Query = 4298 letters Length = 4298 Score = 8520 bits (4298), Expect = 0.0 Identities = 4298/4298 (100%) Strand = Plus / Plus Query: 1 caagccgggcgttcggagctgtgcccggccccgcttcagcaccgcggacagcgccggccg |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 caagccgggcgttcggagctgtgcccggccccgcttcagcaccgcggacagcgccggccg USGENE features original title, abstract and claims.

24 DGENE and PCTGEN have been enhanced
Two new features have been provided with the release of STN Express, Version 8.0+ Query Upload Wizard for uploading sequence query text files for use with the RUN BLAST or RUN GETSIM commands Post-processing tools now work with the BLAST and GETSIM SCORE field, e.g., for inclusion into tables using the Table Tool EXP MAY 06

25 INSPEC has been reloaded
All former stop words have been eliminated Simultaneous left and right truncation (SLART) is now available in TI, AB, and BI New search and display fields: Abstract (/AB) Availability (/AV) – original documents, mainly for reports, dissertations, and conference proceedings Controlled Word (/CW) – additional to the bound phrase index Controlled Term (/CT) Specific source information search fields additional to Source field (/SO), such as ISSN, Publisher, URL EXP FEB 07

26 INSPEC Archive The Inspec Archive has been digitised from the Science Abstracts journal series, in particular: Science Abstracts ( ) Science Abstracts: A - Physics Abstracts ( ) Science Abstracts: B - Electrical Engineering ( ) Science Abstracts: B - Electrical & Electronics Abstracts ( ) Science Abstracts: C - Control Abstracts ( ) The archive comprises 873,699 records INSPEC now contains more than 9.8 million records in total

27 WTEXTILES (World Textiles)
Enhanced with new coverage on the use of textiles in medical field. Over 9800 records added from 2003 to the present). They relate to subjects such as protective materials, dressings, medical equipment, textiles finishing and washing, etc. WTEXTILES now contains 338,746 records from 1970 to date. (9/2006)

28 FSTA - JAPANESE PATENTS NOW INCLUDED
Covers all scientific and technological aspects of the processing and manufacturing of human food products Up to one hundred Japanese Patent records are being added each week. The target is to achieve some 2500 records by the end of the year Approx records in total (10/2006)

29 FIZ AutoDoc – Release 11/2006 The FIZ AutoDoc Standard version is now available for STN users as well Highlights: Optimized user interaction Order capabilities for all types of literature (> Journals) … Checking and verification of entered data ISSN identification by journal title Various delivery formats and speeds Automatic supplier selection according to selected options Extended history function Detailed cost display during the order process Billing via STN account

30 FIZ AutoDoc – Release 11/2006 What does it mean for STN Users ?
OLD NEW

31 FIZ AutoDoc – The new Order Form
2 3 4 1 5 Navigation Bar Order Form Address Data Last three Orders Notification

32 FIZ AutoDoc – More Delivery Formats
< 48 hours < 24 hours < 3 hours DRM Formats ! Confirmation / Access to Order History

33 FIZ AutoDoc – New Order Details Page
The “Order Details“ page sumarizes your order: Document Details Format / Speed Automatically selected Supplier Pocessing Mode Estimated Costs Additional Information  Use the Submit Order button to submit your order  Use the „Edit“ to return to the order form and make new selections

34 FIZ AutoDoc Document Suppliers (11/2006)
Document suppliers - Journal Full-text: Technische Informationsbibliothek (TIB) Deutsche Zentralbibliothek für Medizin (ZBMED) Deutsche Zentralbibliothek für Medizin Bereichsbibliothek für Ernährung, Umwelt und Agrarwissenschaften Bayerische Staatsbibliothek (BSB) Senckenbergische Bibliothek (SeB) / Universitätsbibliothek Frankfurt British Library Document Supply Centre (BLDSC) Canada Institute for Scientific and Technical Information (CISTI), Ottawa Institut d'Information Scientifique et Technique (INIST) Rapra Technology Ltd. (RAPRA) Document suppliers - Patents: Thomson Patent Store Pay-per-View Option - Journal Articles: Karger Thieme Springer (in preparation)

35 Agenda STN System enhancements and changes
What’s new from FIZ Karlsruhe What’s new from CAS

36 CASM/CAplusSM continue to be significantly enhanced
CAplus now contains over 166 million citations Power of the Company Name Thesaurus increased with a reload including almost 90,000 unique names and over 36,000 name families More pre-1907 records added to CA/CAplus Data from the issues of the Journal of the Chemical Society-Transactions (over 2,600 records) U.S. patent records from 1890 to 1906 (over 8,700 records) CAplus now has citations from its records dated 1997 – present. The Company Name Thesaurus is a search aid primarily based on patent assignee data but useful for identifying additional names and relationships among any company sources. It can easily be used on STN without the need to know codes (as some competitive products require) and with standard thesaurus functionality. CAS sets new timeliness standard by making Chinese patent records (SIPO patents, CN) available in CAplus approximately 140 days sooner than competitive services Over 10,000 records for U.S. chemical patents from were added to Volume 0 in CASM/CAplus with more to come Data from the issues of the Journal of Chemical Society-Transactions to be added to Volume 0 of CA/CAplus Addition of U.S. patent records from 1890 to 1905 Thesaurus for Japanese F-Term patent classification codes has been added Korean patent data for added this year

37 Enhanced patent information in CASM/CAplusSM continues to be a focus
CAS sets new timeliness standard by making Chinese patent records available by approximately 120 days before competitive services F-Term Thesaurus (Japanese patent classification codes) enhanced with hierarchical displays and more searching options Korean patent data for added to CA/CAplus CAplus now has citations from its records dated 1997 – present. The Company Name Thesaurus is a search aid primarily based on patent assignee data but useful for identifying additional names and relationships among any company sources. It can easily be used on STN without the need to know codes (as some competitive products require) and with standard thesaurus functionality. CAS sets new timeliness standard by making Chinese patent records (SIPO patents, CN) available in CAplus approximately 140 days sooner than competitive services Over 10,000 records for U.S. chemical patents from were added to Volume 0 in CASM/CAplus with more to come Data from the issues of the Journal of Chemical Society-Transactions to be added to Volume 0 of CA/CAplus Addition of U.S. patent records from 1890 to 1905 Thesaurus for Japanese F-Term patent classification codes has been added Korean patent data for added this year

38 Pre-1967 chemical substance information in CA/CAplus enhanced with preparation role
Simplifies retrieval of information on preparations and syntheses Applies to references from Almost 4 million index entries enhanced Enhancement began on November 13, 2006, and was expected to be completed within a few weeks. No way for me to know if this actually will have been completed by November 27, the day on which this information is to be first presented. I’ll ask our IT to drop a message to Paul and me when the job is complete. Q. Is the preparation role assigned intellectually or algorithmically? A. The role is assigned by an algorithm based on the intellectual indexing of the records. This is similar to the process used in 1995 to add roles for records. Q. Can users continue to search chemical substance names with terms synonymous for “preparation”? A. Yes. However, using the PREP role may produce additional records for pre-1967 records because it incorporates indexing which may be different from today’s practices. Q. Are other roles being added to records? A. Based on customer interest in searching preparations more effectively, completion of the PREP role assignment has been prioritized. Additional role assignments may be possible, but there are no details at this time. Q. How can users search for preparations of substances in the pre-1907 records added to Volume 0? A. CAS roles are not available in the pre-1907 records because the records do not include indexing. Users can search a chemical name with the term “preparation” and its synonyms in the Basic Index. Q. How can users search for preparations of older substances that have not yet been assigned a CAS Registry Number? A. Preparations of these substances can be searched by combining the chemical substance name with PREP/RL.

39 Patent Kind Code data updated in CA/CAplus
Effective late 2006, patent kind codes will now always match the kind code data published on the patent document New patent kind codes will be used beginning in December 2006 Backfile will be updated, starting in December 2006, to ensure searching consistency across the files Old patent kind code data will now appear in the PK.OLD and PK.B.OLD fields SDIs and saved search queries should be updated List of kind code changes available on the web site CAS used to use IFD (Inpadoc Patent Family) for database creation activities. IFD is now being phased out and DOCDB has been introduced as its replacement. About 60 of 300 kind codes will change. Some of these changes impact large numbers of records. (Literally millions.) Japanese patents especially impacted. Old codes will be placed in the newly developed PK.OLD and PK.B.OLD fields. Not expected to be particularly useful., but if anyone wants the data, it will have a home. does not yet include the entire list of changes. It will be there by the time you present. Roll-out, STNewsline underway. Minor enhancement to USPATFULL/USPAT2 also planned

40 The number of substances added to CAS REGISTRYSM is projected to reach record level in 2006
Continued growth of new substances from patents Additional substances from Chemical Catalogs Other substance collections such as NCI Cancer Screened databases REGISTRY has been updated to include the amino acid code for pyrrolysine.   ·         We will end 2006 with more than 30 million small molecules in the CAS Registry (2005 ended with about 27 million small molecules). ·         The External Substance Collection project will result in about 2 million new registrations this year (1.95 from clearing the chemical catalog, i.e., CHEMCATS, queue, and K from processing 10 external databases). ·         Small molecules registered from document analysis will be 1.2 million. ·         New small molecule registrations in 2006 will be about 3.3 million total (a new record by about 800K), with 2 million from the External Substance Collection project plus 1.2 million from document analysis and 100K from other sources (This is in part due to much greater throughput provided by IT efforts). By the end of 2006, REGISTRY will have over 30 million small molecules, with over 3 million new small molecule registrations in 2006

41 CAS REGISTRY property data enhanced and growing
Over 1.4 billion predicted and experimental properties, tags, and spectra in REGISTRY for over 22 million CAS Registry Numbers® Enhanced with the addition of experimental NMR and IR spectra Over 42,000 mass spectral images were added to 35,000 REGISTRY records. If a customer is looking for substance property data, REGISTRY is now a “must search” source that they will not want to miss.  Being able to link immediately to spectral data is an enhancement that will be of great benefit to many customers. Customers have asked for the addition of property data to REGISTRY substances for several years.  In response to these requests, this CAS initiative makes REGISTRY a more competitive, viable resource for finding property data and references.  The addition of spectral data to REGISTRY/ZREGISTRY is part of the continuing strategic effort to position CAS REGISTRY as the most comprehensive database to obtain substance related data.  Total number of predicted and experimental properties, tags, and spectra in REGISTRY has grown to nearly 1.4 million for over 21 million CAS Registry Numbers.

42 CASREACT® now contains over 11 million reactions
CASREACT–answers your chemical reaction questions Includes over 4.6 million single-step reactions and more than 6.6 million multi-step reactions Additional reactions from to be loaded later this year Includes over 4.6 million single-step reactions and more than 6.6 multi-step reactions Additional reactions from to be loaded later this year Available on SciFinder®, SciFinder Scholar™, and STN®

43 Processing efficiencies and new data added to MARPAT®
Daily updates coming soon Improved highlighting in display formats A new SET option in MARPAT, SET MARHIGHLIGHT ON/OFF, allows you to turn highlighting improvements introduced in 2005 ON and OFF Coverage in MARPAT extended back to 1961 with addition of more Markush structures Daily updates expected before the end of 2006 Improved processing efficiencies in MARPAT now provide faster access to new Markush records; as a result, MARPATprev was removed from STN. Enhanced highlighting features in MARPAT: structure highlighting in the FQHIT (first query-focused hit) and QHIT (all query-focused hits) display formats make MARPAT results easier to understand A new SET option in MARPAT gives customers the choice of using either the display highlighting improvements released in 2005 or the former less detailed formats. Addition of INPI structures in MARPAT.

44 Several databases on STN have been enhanced recently
TULSA/TULSA2 (Petroleum Abstracts) Reloaded and enhanced with new search and display fields. IPC thesauri added. ADISCTI (ADIS Clinical Trials Insight) Reloaded and enhanced And, we continue to make improvements. In 2006, there have been enhancements to the databases on STN. TULSA/TULSA2 were reloaded and enhanced with new search and display fields. INSPEC: Addition of Backfile data (INSPEC Archive) in the 2nd Half of 2006 ENHANCED WITH ARCHIVE and added to additional database clusters Adis Clinical Trials Insight, produced by Wolters Kluwer Health and available on STN as ADISCTI, has been reloaded and enhanced. 

45 IFI database enhancements are on the way
Reload of IFIPAT/IFIUDB/IFICDB IPC 8-compliant IPC 8 Thesaurus to be added KWIC will be free in IFI displays Basic Index fields will be separately searchable

46 Questions? Ursula Klemm, FIZ Karlsruhe Heidrun Waldhoff, CAS
STN User Meeting Bologna December 6, 2006

47 Agenda 09.30 - 10.00 Registrazione
Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – Novità in STN (Altri STN Files) Dr. U. Klemm STN Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS Coffee Break La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo Lunch Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS Coffee Break Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

48 Le proprietà chimico-fisiche in Registry
Guglielmo Rucci

49 Properties in Registry
Structure CAS Registry Number CAS Index Name Molecular Formula Calculated Properties Experimental Properties

50 UNITS in Registry => help unit
The following are the default search units for the property search fields in the REGISTRY File: Property Search Field Default Unit Bioconcentration Factor /BCF none Bioconcentration Factor pH /BCF.PH none Boiling Point /BP deg C Boiling Point Pressure /BP.P deg C Density /DEN g/cm**3 Density Pressure /DEN.P Torr Density Temperature /DEN.T deg C Electric Conductance /ECON Siemens Electric Conductance Temperature /ECON.T deg C Electric Conductivity /ECND S/cm Electric Conductivity Temperature /ECND.T deg C Electric Resistance /ERES ohm Electric Resistance Temperature /ERES.T deg C Electric Resistivity /EREST ohm*cm

51 UNITS in Registry => help set unit
The unit systems available are: SI, MKS, CGS, STN (commonly used metric units), FPS, and ENG (commonly used U.S. Engineering units). The default units for numeric fields in a file are the units in which the file was loaded. You may change the unit for a numeric field by entering "SET UNIT" at an arrow prompt (=>). You will be prompted for the field codes and units that you want to change. The equal sign (=) is required and unit designations may have no intervening spaces. Examples: => SET UNIT ENTER FIELD CODES AND UNITS OR (END):BP=K ENTER FIELD CODES AND UNITS OR (END):BP=F DEN=LB/FT**3 => SET UNIT BP=F DEN=LB/FT**3 => set unit all=cgs SET COMMAND COMPLETED => set unit all=stn

52 Properties in Registry
=> e property data/fa E PR/FA E PREFERRED REGISTRY NUMBER/FA E > PROPERTY DATA/FA E PROPERTY TAGS/FA E PSA/FA E REF.CA/FA E REF.CAD/FA E REF.CAOLD/FA E REF.CAPLUS/FA E REFRACTIVE INDEX/FA E RELATED POLYMERS/FA E REPLACED REGISTRY NUMBER/FA

53 Properties in Registry
Calculated data Experimental data

54 Properties in Registry
Calculated data Values for the calculated physical properties in the REGISTRY file were determined using CAS connection tables and software developed by Advanced Chemistry Development, Inc.

55 Properties in Registry
Calculated data pKa for the most acidic and most basic centers in the molecule Number of Hydrogen Donors / Acceptors Number of Rotatable Bonds Molecular Weight Molar Solubility in water at various pHs logP/logD (water-octanol partition coefficients)

56 Properties in Registry
The Lipinski, calculated properties, are the important characteristics for successful drug candidates. <=5 Hydrogen-bond donors <=10 Hydrogen-bond acceptors <=500 Molecular weight <=5 Calculated logP

57 Properties in Registry
Calculated data Bioconcentration factor Boiling point Enthalpy of Vaporization Flash point Organic Carbon Adsorption Coefficient (Koc) Vapor pressure  

58 Properties in Registry
* Bioconcentration Factor - provides an indication of how readily a substance accumulates in organisms, living in an environment polluted by that substance (applies primarily, but is not limited to, aquatic environments) * Boiling Point - provides an indication of the temperature at which a compound goes from the liquid to gaseous state * Enthalpy of Vaporization - provides an indication of the volatilization characteristics of a compound and is useful in remediation studies involving organic compounds * Flash Point - provides an indication of the temperature at which a substance ignites and is useful in predicting explosive atmospheres in chemical manufacturing and processing applications * Organic Carbon Adsorption Coefficient (Koc) - provides an indication of how readily a substance accumulates in the organic component of soils and other particulate matter vs. migrating with the aqueous environment surrounding soil particles and is especially important in remediation and bioavailability studies * Vapor pressure - provides an indication of a compound's tendency to evaporate

59 Properties in Registry
Calculated data Property Search Example Units Freely Rotatable Bonds S 2-5/FRB Hydrogen Donors S HD<= Hydrogen Acceptors S 1-3/HAC LogD S 2.21/LOGD LogP S LOGP<= Molar Solubility S SLB.MOL>= MOL/L Molecular Weight S MW< pKa S PKA<=

60 Properties in Registry
Experimental data The source of experimental property data in the REGISTRY file is the SPRESI database produced by ZIC/VINITI and offered by Infochem. The data added to the REGISTRY file are from the journal and patent literature in the time period

61 Properties in Registry
Experimental data Definitions: Boiling Point - the temperature at which Density - mass per unit volume of Melting Point - the temperature at which Some melting point temperatures may be flagged . . . Polymorph - indicates the melting point . . . Sublm - indicates the temperature Decomp - indicates the temperature Optical Rotatory Power - the degree of rotation Refractive Index - the ratio of the

62 Properties in Registry
Experimental data Experimental Properties (EPROP) PROPERTY (CODE) | VALUE | CONDITION | NOTE =====================+===================+=================+========== Boiling Point (BP) | deg C | | (1) CAS Broholm, Mette M.; Environmental Science and Technology 2005 V39(21) P CAPLUS

63 Properties in Registry
Spectra

64 Properties in Registry
=> e a/spec **** START OF FIELD **** E /SPEC E ABSORPTION/SPEC E CARBON/SPEC E CARBON-13 NMR SPECTRA/SPEC E IR/SPEC E IR ABSORPTION SPECTRA/SPEC E IR SPECTRA/SPEC E MASS/SPEC E MASS SPECTRA/SPEC E NMR/SPEC E NMR SPECTRA/SPEC E SPECTRA/SPEC **** END OF FIELD ****

65 Properties in Registry
L "CARBON-13 NMR SPECTRA"/SPEC => help dfields SPEC Spectra SPEC.C13NMR Carbon-13 NMR Spectra SPEC.IR IR Absorption Spectra => d spec

66 Properties in Registry

67 Properties in Registry
=> d eprops L1 ANSWER 1 OF REGISTRY COPYRIGHT 2006 ACS on STN Experimental Properties (EPROP) PROPERTY (CODE) | VALUE | NOTE =====================+========+========== Carbon-13 NMR Spectra|Spectrum|(1) WSS (1) Spectral data were obtained from Wiley Subscription Services, Inc. (US) Experimental Property Tags (ETAG) PROPERTY | NOTE ==================+======= Proton NMR Spectra|(1) CAS (1) Yu, Jiangbo; Inorganic Chemistry 2005 V44(5) P CAPLUS

68 Properties in Registry
=> e8 L "IR ABSORPTION SPECTRA"/SPEC => d spec

69 Properties in Registry

70 Strategies for searching property information

71 Strategies for searching property information
Basic strategies search a property directly 173/BP Advanced strategies offer search precision Property note (PNT), Property source (PSO), Property type (PTYP) Uncertainty range (UR)

72 Strategies for searching property information
(P)-operator Use (P)-operator to combine property values with property conditions

73 Find the boiling point for sec-butylbenzene.
Strategies for searching property information Search Question: Find the boiling point for sec-butylbenzene.

74 Strategies for searching property information
=> fil reg => e sec-butylbenzene/cn 5 E SEC-BUTYLASTATINE/CN E SEC-BUTYLAZINE/CN E > SEC-BUTYLBENZENE/CN => e3 and bp/fa L SEC-BUTYLBENZENE/CN AND BP/FA

75 Strategies for searching property information
=> d qrd L1 ANSWER 1 OF 1 REGISTRY COPYRIGHT 2006 ACS on STN RN REGISTRY ED Entered STN: 16 Nov 1984 CN Benzene, (1-methylpropyl)- (9CI) (CA INDEX NAME) OTHER CA INDEX NAMES: CN Benzene, sec-butyl- (8CI) OTHER NAMES: CN (+-)-sec-Butylbenzene CN sec-Butylbenzene

76 Strategies for searching property information
CODE| VALUE | CONDITION | TYPE | NOTE ====+===============+===============+============+========== BP | K | |Experimental| (1) NLM BP | K | |Experimental| (2) SRC BP | K |Press: 760 Torr|Experimental| (3) CAS CODE| VALUE | CONDITION | TYPE |NOTE ====+==============+===============+==========+==== BP | /-0.0 K|Press: 760 Torr|Predicted |(1)

77 Find compounds with Boiling Point at 100 °C exactly .
Strategies for searching property information Search Question: Find compounds with Boiling Point at 100 °C exactly .

78 Strategies for searching property information
=> 100/mp L K /MP => 100 c/mp L C/MP => l7(p)exact/pnt EXACT/PNT L L7(P)EXACT/PNT => d hit L8 ANSWER 1 OF REGISTRY COPYRIGHT 2005 ACS on STN CODE| VALUE | CONDITION | TYPE | NOTE ====+=======+=============+============+======= MP |373.2 K|Solv: ethanol|Experimental|(1) CAS

79 Strategies for searching property information
=> set unit mp=c SET COMMAND COMPLETED => d hit L8 ANSWER 1 OF REGISTRY COPYRIGHT 2005 ACS on STN CODE| VALUE | CONDITION | TYPE | NOTE ====+=========+=============+============+======= MP |100 deg C|Solv: ethanol|Experimental|(1) CAS | |( ) | |

80 Strategies for searching property information
Search Question: Find compounds with LD50 value, for the mouse, between mg/kg exactly .

81 Strategies for searching property information
=> set unit ld50=mg/kg SET COMMAND COMPLETED => /ld50 L MG/KG MG/KG /LD50 => l1(p)mouse/ld50.orgn L L1(P)MOUSE/LD50.ORGN => d hit L2 ANSWER 1 OF 121 REGISTRY COPYRIGHT 2005 ACS on STN CODE| VALUE | CONDITION | TYPE | NOTE ====+==========+===========+============+======= LD50|>300 mg/kg|Orgn: mouse|Experimental|(1) CAS | |Rte: oral | |

82 Strategies for searching property information
=> l2(p)exact/pnt L L2(P)EXACT/PNT   => d hit L3 ANSWER 1 OF 1 REGISTRY COPYRIGHT 2006 ACS on STN CODE| VALUE | CONDITION | TYPE | NOTE ====+=========+====================+============+========= LD50|741 mg/kg|Orgn: mouse |Experimental|(1) CAS | |Rte: intraperitoneal| | (1) Al'-Assar, F.; Pharmaceutical Chemistry Journal (Translation of Khimiko-Farmatsevticheskii Zhurnal) 2002 V36(11) P CAPLUS

83 Strategies for searching property information
Search Question: Identify compounds isolated from the gardenia flower with the following properties: Density 0.94–1.05 gr/cc at 20 °C (Experimental) bp = 218–287 °C at 1 atm. mp = 17–18 °C

84 Strategies for searching property information
=> fil reg => set unit den=g/cm**3 SET COMMAND COMPLETED => set unit den.t=C => set unit mp=c => C/bp(p)760 torr/bp.p and /den(p)20/den.t (p)exp?/ptyp and 17-18/mp L C/BP(P)760 TORR/BP.P AND

85 Strategies for searching property information
=> d qrd CODE| VALUE | CONDITION | TYPE | NOTE ====+========+===============+============+========= BP | K|Press: 4.5 Torr|Experimental|(1) IC (1)Wrobel, Dieter; Chemische Berichte 1982 V115(5) P CAPLUS CODE| VALUE | CONDITION | TYPE |NOTE ====+===============+===============+==========+==== BP | /-19.0 K|Press: 760 Torr|Predicted |(1) (1)Calculated using Advanced Chemistry Development (ACD/Labs) Software V8.14 ((C) ACD/Labs)

86 Strategies for searching property information
CODE| VALUE | TYPE | NOTE ====+===========+============+========= MP |16-17 deg C|Experimental|(1) IC CODE| VALUE | CONDITION | TYPE | NOTE ====+==============+==============+============+========= DEN | g/cm**3|Temp: 20 deg C|Experimental|(1) IC (1)Wrobel, Dieter; Chemische Berichte 1982 V115(5) P CAPLUS CODE| VALUE | CONDITION | TYPE |NOTE ====+====================+===============+==========+==== DEN |0.956+/-0.06 g/cm**3|Temp: 20 deg C |Predicted |(1) | |Press: 760 Torr| |

87 Strategies for searching property information
=> fil caplus => l1 and gardenia L L1 AND GARDENIA => sel l2 hit rn SmartSELECT INITIATED New TRANSFER and ANALYZE Commands Now Available See HELP TRANSFER and HELP ANALYZE for Details L SEL L2 1- RN HIT : TERMS

88 Strategies for searching property information

89 Strategies for searching property information
Search Question: Find compounds containing the following substructure, which are biologically active:

90 Strategies for searching property information
Side groups were eliminated to make the structure more general. The triazole ring was isolated.

91 Strategies for searching property information

92 Strategies for searching property information

93 Properties in Registry/CAPlus Experimental property data tags (/ETAG)

94 Properties in Registry/CAPlus
Beginning March 20th, 2005, over 2 million substances in REGISTRY will be enriched with “tags” pointing to additional experimental data. 186 CAS data tags (includes 13 existing) 38 InfoChem data tags Tags point to CA references Many charts, spectra, & tables are referenced Experimental property tags allow you to navigate from REGISTRY to the document where the property was reported

95 Properties in Registry
=> e property data/fa E PR/FA E PREFERRED REGISTRY NUMBER/FA E > PROPERTY DATA/FA E PROPERTY TAGS/FA E PSA/FA E REF.CA/FA E REF.CAD/FA E REF.CAOLD/FA E REF.CAPLUS/FA E REFRACTIVE INDEX/FA E RELATED POLYMERS/FA E REPLACED REGISTRY NUMBER/FA

96 Properties in Registry/CAPlus
Experimental property data tags => e a/etag **** START OF FIELD **** E ACID/BASE DISSOCIATION CONSTANT (KA/KB)/ETAG E BORON-11 NMR SPECTRA/ETAG E CRYSTAL STRUCTURE/ETAG E ESR SPECTRA/ETAG E IR ABSORPTION SPECTRA/ETAG E MASS SPECTRA/ETAG => s e5 L "ACID/BASE DISSOCIATION CONSTANT (KA/KB)"/ETAG

97 Properties in Registry/CAPlus
Experimental property data tags => d prop Experimental Property Tags (ETAG) PROPERTY | NOTE =======================================+======= Acid/Base Dissociation Constant (Ka/Kb)|(1) CAS Carbon-13 NMR Spectra |(1) CAS Proton NMR Spectra |(1) CAS (1) Jaszberenyi, Z.; Dalton Transactions 2005(4) P CAPLUS Predicted Properties (PPROP) PROPERTY (CODE) | VALUE | CONDITION | NOTE ============================+===================+===========+======= Bioconc. Factor (BCF) | |pH |(1) ACD

98 Properties in Registry/CAPlus

99 Properties in Registry/CAPlus
Experimental property data tags ANSWER 1 CAPLUS COPYRIGHT 2006 ACS on STN ACCESSION NUMBER: : CAPLUS Full-text DOCUMENT NUMBER: :306245 TITLE: Synthesis and determination of acid dissociation constants of some new 4,5-dihydro-1H-1,2,4-triazol-5- one derivatives AUTHOR(S): Yueksek, Haydar; Bahceci, Sule; Ocak, Zafer; Oezdemir, Mustafa; Ocak, Mirac; Ermis, Burhan; Mutlu, Tolga CORPORATE SOURCE: Department of Chemistry, Kafkas University, Kars, 36100, Turk. SOURCE: Asian Journal of Chemistry (2005), 17(1), CODEN: AJCHEW; ISSN: PUBLISHER: Asian Journal of Chemistry DOCUMENT TYPE: Journal LANGUAGE: English

100 Strategies for searching property information
Search Question: Find the Young’s modulus of alumina.

101 Strategies for searching property information
=> fil reg => e young/etag E X-RAY SCATTERING/ETAG E X-RAY SPECTRA/ETAG E > YOUNG/ETAG E YOUNG'S MODULUS/ETAG **** END OF FIELD **** => alumina/cn L ALUMINA/CN => l1 and e4 3260 "YOUNG'S MODULUS"/ETAG L L1 AND "YOUNG'S MODULUS"/ETAG

102 Strategies for searching property information
=> d qrd L2 ANSWER 1 OF 1 REGISTRY COPYRIGHT 2006 ACS on STN RN REGISTRY ED Entered STN: 16 Nov 1984 CN Aluminum oxide (Al2O3) (8CI, 9CI) (CA INDEX NAME) Experimental Property Tags (ETAG) PROPERTY | NOTE ===============+======== Young's Modulus| (1) CAS Young's Modulus| (2) CAS (1) Neagu, R.; Key Engineering Materials 2004 V (Pt. 2, Euro Ceramics VIII) P CAPLUS

103 Strategies for searching property information
=> FIL CAPLUS => D ACC 2004: IBIB ANSWER 1 CAPLUS COPYRIGHT 2006 ACS on STN ACCESSION NUMBER: : CAPLUS Full-text DOCUMENT NUMBER: :247149 TITLE: Non-destructive method for impact resisting alumina composites characterization AUTHOR(S): Neagu, R.; Motoc, S.; Volceanov, E.; Gurban, A. M.; Motoc, A. M. CORPORATE SOURCE: Dept. of Refractory Materials, Metallurgical Research Institute ICEM SA, Bucharest, Rom. SOURCE: Key Engineering Materials (2004), (Pt. 2, Euro Ceramics VIII), CODEN: KEMAEY; ISSN: PUBLISHER: Trans Tech Publications Ltd. DOCUMENT TYPE: Journal LANGUAGE: English

104 Find pka of Camphorsulfonic acid (3144-16-9)

105 Properties in Registry/CAPlus
=> fil reg => L ( /RN) => d prop

106 Properties in Registry/CAPlus
Experimental Property Tags (ETAG) PROPERTY | NOTE ====================================================+======= Dielectric Constant |(1) CAS Electric Current-Potential Curve |(2) CAS IR Reflectance Spectra |(1) CAS 1 more tag shown in the MAX or ETAGFULL formats| Optical Rotatory Power |(3) CAS Partition Coefficient |(4) IC UV and Visible Absorption Spectra |(2) CAS X-Ray Reflectance Spectra

107 Properties in Registry/CAPlus
Predicted Properties (PPROP) PROPERTY (CODE) | VALUE | CONDITION |NOTE =============================+====================+================+==== PKA (PKA) |1.17+/ |Most Acidic |(1) | |298 K |

108 Properties in Registry/CAPlus
=> fil caplus => l1(l)prp/rl L L1(L)PRP/RL => l2 and pka L L2 AND PKA  

109 Properties in Registry/CAPlus
AN : CAPLUS Full-text DN 94:36188 TI Therapeutic doses and physicochemical constants of bases and acids AU Volpi, A.; Toffoli, F. CS Farm. "Al Moro", Mantua, Italy SO Bollettino Chimico Farmaceutico (1979), 118(10), CODEN: BCFAAI; ISSN: DT Journal LA Italian

110 Properties in Registry/CAPlus
AB A study of .apprx.100 acidic and basic drugs showed the following relation: log1/D is a function of (log 1/Ka)(log1/S), where D is the av. max. dose for adults (expressed in moles), Ka is the dissocn. const. of the protonated form of the compd., whether acid or base, and S is a soly. parameter inversely proportional to the thermodn. activity coeff., , of the undissocd. mol. in dil. aq. soln. More commonly expressed, with p being the neg. logarithm, pD is a function of ( pKa )(pS). A plot of pD vs. (pKa )(pS) gave a hyperbola, the 2 arms of which were nearly straight lines.

111 Agenda 09.30 - 10.00 Registrazione
Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – Novità in STN (Altri STN Files) Dr. U. Klemm STN Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS Coffee Break La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo Lunch Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS Coffee Break Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

112 Agenda 09.30 - 10.00 Registrazione
Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – Novità in STN (Altri STN Files) Dr. U. Klemm STN Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS Coffee Break La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo Lunch Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS Coffee Break Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

113 Ricerca del polimorfismo di composti organici in STN
Terza Parte Simona Casolla Dipharma S.p.A Barbara Riva Antonio Tarquini Notarbartolo&Gervasi S.p.A. 2006

114 Polimorfismo Esistenza di forme cristalline diverse per una stessa sostanza Polimorfismo dei composti organici solidi Polimorfismo dei composti organici solidi ad attività farmacologica (API)

115 Problema scientifico e brevettuale
I polimorfi degli APIs diventano oggetto di interesse scientifico e brevettuale, perché 1. sono dotati di caratteristiche chimico fisiche che ne consentono un isolamento favorevole (solubilità,condizioni di cristallizzazione,ecc…). 2. caratterizzate da particolari proprietà reologiche (igroscopicità, scorrevolezza, caricabilità elettrostatica, ecc…) 3. sono dotati di diversa biodisponibilità e quindi di peculiari attività farmacologiche. I polimorfi degli APIs, oggetto di interesse brevettuale, ne condizionano fortemente produzione e/o commercializzazione.

116 Polimorfismo User's Days

117 Patents search flow-sheet
Marpat (Prev.) HCAPlus (PATIPC) Wpindex (DCR) Wpids (FC-MC) (only subscribers) Registry Others Ifiudb DUP. IDE. FSORT Ricerca documentale non brevettuale USPat. (it,ti,st,clm,ab) Ifiref Citations Patents search flow-sheet

118 Patents search flow-sheet
Marpat (Prev.) HCAPlus (PATIPC) Wpindex (DCR) Wpids (FC-MC) (only subscribers) Registry Others Ifiudb DUP. IDE. FSORT Ricerca documentale brevettuale USPat. (it,ti,st,clm,ab) Ifiref Citations Patents search flow-sheet

119 profilo di ricerca (Qdef) Patents search flow-sheet
Marpat (Prev.) HCAPlus (PATIPC) Wpindex (DCR) Wpids (FC-MC) (only subscribers) Registry Others Ifiudb DUP. IDE. FSORT USPat. (it,ti,st,clm,ab) Creazione di un profilo di ricerca (Qdef) applicabile nel B.I. di altri files Ifiref Citations Patents search flow-sheet

120 User's Days 2004-2005 => act Qdef/q
QUE ABB=ON PLU=ON HYDRATES+UF,RT/CT OR HYDRATED SALTS OR SALT HYDRATES OR "SOLID SOLUTIONS"+UF/CT OR "SOLUTIONS, SOLID"/CT OR MIXED CRYSTALS OR "SOLID SOLNS." OR "SUBSTITUTIONAL SOLID SOLNS." OR MICROSTRUCTURE/CT OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) IR SPECTRA"+UF/CT OR IR SPECTRA-CRYSTAL STRUCTURE RELATIONSHIP OR "CRYSTAL MORPHOLOGY"+ALL/CT OR CRYSTAL FACETS OR CRYSTAL HABIT OR CRYSTAL SHAPE OR CRYSTAL SYMMETRY OR MORPHOTROPY OR "SINGLE-CRYSTAL MORPHOL." OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) RAMAN SPECTRA"+ALL/CT OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) NMR"+ALL/CT OR NMR-CRYSTAL STRUCTURE RELATIONSHIP "THERMOGRAVIMETRIC ANALYSIS"+UF,RT/CT OR "TG (THERMOGRAVIMETRY)" OR "TGA (THERMOGRAVIMETRIC ANALYSIS)" OR "THERMOGRAVIMETRY (TG)" OR "THERMAL ANALYSIS"+UF/CT OR THERMOMETRIC ANALYSIS OR CALORIMETRY+OLD,UF/CT OR "BATCH CALORIMETRY" OR "DIFFERENTIAL SCANNING CALORIMETRY"+OLD,UF,RT/CT OR "DSC (DIFFERENTIAL SCANNING CALORIMETRY)" OR "DIFFERENTIAL SCANNING CALORIMETRY (DSC)" OR "POLYMORPHISM (CRYSTAL)"+OLD,UF,NT,RT/CT OR POLYMORPHIC TRANSITION OR POLYSTRUCTURE/CT OR "AMORPHOUS STRUCTURE"+UF/CT OR CRYSTALLINITY+UF/CT OR CRYSTALLIZATION/CT OR CRYSTALS/CT OR CRYSTAL STRUCTURE/CT OR "CRYSTALLINITY (L) TRANSCRYSTALLINITY"+OLD,UF/CT OR TRANSCRYSTALLINITY/CT OR CRYST. TEXTURE OR CRYSTALLOG. TEXTURE OR CRYSTALLOGRAPHIC TEXTURE OR GRANULARITY OR POLE FIGURES OR TEXTURE/CT OR X-RAY DIFFRACTION/CT OR X-RAY DIFFRACTOMETRY/CT OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) RAMAN SPECTRA"/CT OR "POLYMORPHISM (CRYSTAL) (L) DIMORPHISM"+OLD/CT OR "POLYMORPHISM (CRYSTAL) (L) ENANTIOTROPY"+ OLD/CT OR POLYMORPHISM (CRYSTAL) (L) ISODIMORPHISM"/CT OR "POLYMORPHISM (CRYSTAL) (L)MONOTROPY"+OLD/CT OR "POLYMORPHISM (CRYSTAL) (L) PSEUDOPOLYMORPHISM"+OLD,UF/CT OR "POLYMORPHISM(L)DIMORPHISM"/CT OR "POLYMORPHISM (CRYSTAL) (L) PSEUDOPOLYMORPHISM"/CT OR "STRUCTURAL PHASE TRANSITION"+OLD,UF/CT OR "POLYMORPHISM (CRYSTAL)"/CT OR CRYSTAL STRUCTURE TRANSITIONS OR CRYSTAL TRANSITIONS OR PHASE TRANSFORMATION OR POLYMORPHIC TRANSITION OR SOLID STATE PHASE TRANSITION OR SOLID-SOLID PHASE TRANSITION OR SOLID-STATE PHASE TRANSITION OR STRUCTURAL PHASE TRANSFORMATION OR STRUCTURAL TRANSITIONS OR POLYMORPHISM/CT OR "POLYMORPHISM (CRYSTAL)"/CT OR "POLYMORPHISM (CRYSTAL)"+OLD,UF,NT,RT/CT OR POLYMORPH? OR "CRYSTAL STRUCTURE"/CT OR CRYSTALLINITY+UF,RT/CT OR "CRYSTALLINITY (L) TRANSCRYSTALLINITY"/CT OR CRYSTALL? OR ALLOTROPY/CT OR "POLYMORPHISM (CRYSTAL)(L) ALLOTROPY"/CT OR ALLOTROP? OR AMORPHO? OR PSEUDOMORPHISM? OR SOLID(W)STATE? OR ?CRYSTALL? OR "X-RAY ANALYSIS" OR PARAMORPHISM OR CRYSTAL(W)MORPHOL? OR SOLVATES+NT1,RT/CT OR HYDRATE? OR SOLVAT? OR SOLVATION+NT1,UF/CT OR SOLVOPHOBIC EFFECT OR SPECIFIC SOLVATION OR ?SOLVENT?(W)ADDUCT? OR ?SOLVENT?(A)ADDUCT? OR ?SOLVENT?(A)COMPOUND? OR ?SOLVENT?(1A)COMPOUND? OR SOLIDIFICATION+OLD,UF/CT OR "COCRYSTN." OR COCRYSTALLIZATION OR COCRYSTALL? OR SOLID(W)FORM? OR "SOLID-STATE"(W)FORM? OR SOLID(W)FORM? OR "POWDER X-RAY DIFFRACTOMETRY"+OLD,UF/CT OR POWDER X-RAY DIFFRACTION OR X-RAY POWDER DIFFRACTOMETRY OR X-RAY SPECTRA OR X-RAY SPECTRA/CT OR NOVEL(XA)FORM? OR (POLYMORPH? OR CRYSTALL? OR SOLID?(XA)MODIFICATION? OR SINGLE(W)CRYSTAL? OR CRYSTALS+UF/CT OR CRYSTALLOGRAPHY/CT OR SINGLE CRYSTAL? OR X-RAY SCATTERING/CT OR X-RAY SCATTERING OR ELECTRON? DIFFRACTION

121 User's Day ricerca di records sul polimorfismo di un particolare API => s Lsel chem /prp (L) / and Qdef and p/dt

122 => [Qdef and (organic or applied)/cc
User's Day ricerca di records anche orientati allo studio cristallografico di composti organici (es.APIs) => [Qdef and (organic or applied)/cc and (22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 33 or 46 or 50 or 63 or 64 or 70 or 75)/cc] or [Qdef and (org or pia or 1 or 2)/cc and (75 or 63)/sx] and p/dt

123 User's Day => Qpoly

124 Patents search flow-sheet
Marpat (Prev.) HCAPlus (PATIPC) Wpindex (DCR) Wpids (FC-MC) (only subscribers) Registry Others La ricerca documentale diventa specificatamente brevettuale Ricerca dei codici UN, NCL, ICC Ifiudb DUP. IDE. FSORT USPat. (it,ti,st,clm,ab) Ifiref Citations Patents search flow-sheet

125 User's Day (IFI) ricerca di records sul polimorfismo di un particolare API => fil Ifiudb => s (RN/urn,bi or Lname )(L) Qdef or (RN/urn,bi or Lname ) and [LCTsdef/BI or (00224 or or 04239)/un] ricerca di records sul polimorfismo di composti organici (es. APIs) => s (00224 or or 04239)/un and [(532?-570?)/ncl or (424? or 514?)/ncl] not (520? or 525? or 528?)/ncl => LIFI poly composti organici e composti bioattivi esclusi i polimeri Polimeri e resine

126 User's Day 2004-2005 (Beilstein)
ricerca di informazioni riguardanti la natura cristallina di un composto organico (per es. un API) => s BRN (o RN o “nome”/CN) and (CRYPH or CPT or CPD or CSYS or CSG)/FA => LCRY ricerca di una particolare informazione riguardante la natura cristallina di un particolare composto organico (per es. un API) => s BRN (o RN o nome/CN) and crystal structure determination/KW ricerca del riferimento che ha originato l'indexing => sel LCRY BABSAN => LSELCRY => fil BABS => LSELCRY /AN

127 User's Day 2006 Composti inorganici e metallorganici
Potenziamento e razionalizzazione della Query Miglioramento della modulazione Superamento dei limiti del Sistema (uso dei Full-text files dei patents) Sviluppi della ricerca in IFIREF-IFIUDB La nuova codifica Internazionale I Codici giapponesi Un protocollo di ricerca

128 User's Day 2006 I composti inorganici che presentano polimorfismo sono indicizzati (CAS Registry No.) nelle loro forme polimorfiche

129 User's Day 2006 FeS2 Pirite 1309-36-0 Marcassite 1317-66-4 TiO2
Anatase Brookite CaCO3 Calcite Aragonite

130 User's Day 2006 I composti organometallici che presentano diverse forme cristalline non sono indicizzati con diversi RNs per ciscuna forma

131 Potenziamento e razionalizzazione
HCAplus Potenziamento e razionalizzazione della Query

132 HCAplus Lo studio della Indicizzazione ed il confronto con il Full Text dei Documenti trovati ha generato un potenziamento della Qdef. Si è resa necessaria la razionalizzazione e l’ottimizzazione di Qdef.

133 HCAplus => act Qdef/q
QUE ABB=ON PLU=ON HYDRATES+UF,RT/CT OR HYDRATED SALTS OR SALT HYDRATES OR "SOLID SOLUTIONS"+UF/CT OR "SOLUTIONS, SOLID"/CT OR MIXED CRYSTALS OR "SOLID SOLNS." OR "SUBSTITUTIONAL SOLID SOLNS." OR MICROSTRUCTURE/CT OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) IR SPECTRA"+UF/CT OR IR SPECTRA-CRYSTAL STRUCTURE RELATIONSHIP OR "CRYSTAL MORPHOLOGY"+ALL/CT OR CRYSTAL FACETS OR CRYSTAL HABIT OR CRYSTAL SHAPE OR CRYSTAL SYMMETRY OR MORPHOTROPY OR "SINGLE-CRYSTAL MORPHOL." OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) RAMAN SPECTRA"+ALL/CT OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) NMR"+ALL/CT OR NMR-CRYSTAL STRUCTURE RELATIONSHIP "THERMOGRAVIMETRIC ANALYSIS"+UF,RT/CT OR "TG (THERMOGRAVIMETRY)" OR "TGA (THERMOGRAVIMETRIC ANALYSIS)" OR "THERMOGRAVIMETRY (TG)" OR "THERMAL ANALYSIS"+UF/CT OR THERMOMETRIC ANALYSIS OR CALORIMETRY+OLD,UF/CT OR "BATCH CALORIMETRY" OR "DIFFERENTIAL SCANNING CALORIMETRY"+OLD,UF,RT/CT OR "DSC (DIFFERENTIAL SCANNING CALORIMETRY)" OR "DIFFERENTIAL SCANNING CALORIMETRY (DSC)" OR "POLYMORPHISM (CRYSTAL)"+OLD,UF,NT,RT/CT OR POLYMORPHIC TRANSITION OR POLYSTRUCTURE/CT OR "AMORPHOUS STRUCTURE"+UF/CT OR CRYSTALLINITY+UF/CT OR CRYSTALLIZATION/CT OR CRYSTALS/CT OR CRYSTAL STRUCTURE/CT OR "CRYSTALLINITY (L) TRANSCRYSTALLINITY"+OLD,UF/CT OR TRANSCRYSTALLINITY/CT OR CRYST. TEXTURE OR CRYSTALLOG. TEXTURE OR CRYSTALLOGRAPHIC TEXTURE OR GRANULARITY OR POLE FIGURES OR TEXTURE/CT OR X-RAY DIFFRACTION/CT OR X-RAY DIFFRACTOMETRY/CT OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) RAMAN SPECTRA"/CT OR "POLYMORPHISM (CRYSTAL) (L) DIMORPHISM"+OLD/CT OR "POLYMORPHISM (CRYSTAL) (L) ENANTIOTROPY"+ OLD/CT OR POLYMORPHISM (CRYSTAL) (L) ISODIMORPHISM"/CT OR "POLYMORPHISM (CRYSTAL) (L)MONOTROPY"+OLD/CT OR "POLYMORPHISM (CRYSTAL) (L) PSEUDOPOLYMORPHISM"+OLD,UF/CT OR "POLYMORPHISM(L)DIMORPHISM"/CT OR "POLYMORPHISM (CRYSTAL) (L) PSEUDOPOLYMORPHISM"/CT OR "STRUCTURAL PHASE TRANSITION"+OLD,UF/CT OR "POLYMORPHISM (CRYSTAL)"/CT OR CRYSTAL STRUCTURE TRANSITIONS OR CRYSTAL TRANSITIONS OR PHASE TRANSFORMATION OR POLYMORPHIC TRANSITION OR SOLID STATE PHASE TRANSITION OR SOLID-SOLID PHASE TRANSITION OR SOLID-STATE PHASE TRANSITION OR STRUCTURAL PHASE TRANSFORMATION OR STRUCTURAL TRANSITIONS OR POLYMORPHISM/CT OR "POLYMORPHISM (CRYSTAL)"/CT OR "POLYMORPHISM (CRYSTAL)"+OLD,UF,NT,RT/CT OR POLYMORPH? OR "CRYSTAL STRUCTURE"/CT OR CRYSTALLINITY+UF,RT/CT OR "CRYSTALLINITY (L) TRANSCRYSTALLINITY"/CT OR CRYSTALL? OR ALLOTROPY/CT OR "POLYMORPHISM (CRYSTAL)(L) ALLOTROPY"/CT OR ALLOTROP? OR AMORPHO? OR PSEUDOMORPHISM? OR SOLID(W)STATE? OR ?CRYSTALL? OR "X-RAY ANALYSIS" OR PARAMORPHISM OR CRYSTAL(W)MORPHOL? OR SOLVATES+NT1,RT/CT OR HYDRATE? OR SOLVAT? OR SOLVATION+NT1,UF/CT OR SOLVOPHOBIC EFFECT OR SPECIFIC SOLVATION OR ?SOLVENT?(W)ADDUCT? OR ?SOLVENT?(A)ADDUCT? OR ?SOLVENT?(A)COMPOUND? OR ?SOLVENT?(1A)COMPOUND? OR SOLIDIFICATION+OLD,UF/CT OR "COCRYSTN." OR COCRYSTALLIZATION OR COCRYSTALL? OR SOLID(W)FORM? OR "SOLID-STATE"(W)FORM? OR SOLID(W)FORM? OR "POWDER X-RAY DIFFRACTOMETRY"+OLD,UF/CT OR POWDER X-RAY DIFFRACTION OR X-RAY POWDER DIFFRACTOMETRY OR X-RAY SPECTRA OR X-RAY SPECTRA/CT OR NOVEL(XA)FORM? OR (POLYMORPH? OR CRYSTALL? OR SOLID?(XA)MODIFICATION? OR SINGLE(W)CRYSTAL? OR CRYSTALS+UF/CT OR CRYSTALLOGRAPHY/CT OR SINGLE CRYSTAL? OR X-RAY SCATTERING/CT OR X-RAY SCATTERING OR ELECTRON? DIFFRACTION

134 HCAplus => act Qdef/q
X-RAY?/CT OR X-RAY DIFFRACT? OR X-IRRADN. OR X-RADIATION OR "X-RAY MICROSCOPY (L) SCANNING"+OLD/CT OR SCANNING(A)X-RAY(A)MICROSCOPY OR "X-RAY ANALYSIS" OR "POWDER X-RAY DIFFRACTOMETRY"+OLD/CT OR POWDER(A)X-RAY(A)DIFFRACT? OR X-RAY SPECTRA OR X-RAY SCATTERING OR XRDP OR XRPD OR XPRD OR ELECTRON?(XA)DIFFRACTION? OR NEUTRON SCATTERING (L) SMALL-ANGLE"+OLD/CT OR NEUTRON SMALL-ANGLE SCATTERING OR SANS OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) IR SPECTRA"/CT OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) RAMAN SPECTRA"+ALL/CT OR "CRYSTAL STRUCTURE-PROPERTY RELATIONSHIP (L) NMR"+ALL/CT OR NMR-CRYSTAL STRUCTURE RELATIONSHIP OR CRYSTAL? (xA)(FORM? OR FACET# OR HABIT OR SHAPE OR SYMMETRY OR STRUCTURE(W)TRANSITION# OR TRANSITION? OR MODIFICATION# OR MORPHOL?) OR MORPHOTROPY OR "SINGLE-CRYSTAL MORPHOL." OR CRYSTALLIZATION OR CRYSTAL# OR CRYSTAL STRUCTURE OR "CRYSTALLINITY (L) TRANSCRYSTALLINITY"+OLD OR CRYSTALLINITY+RT OR "CRYSTAL MORPHOLOGY"+ALL OR CRYSTALLOGRAPHY)/CT OR (CRYST. OR CRYSTALLOG. OR CRYSTALLOGRAPHIC)(W)TEXTURE OR TEXTURE/CT OR GRANULARITY OR POLE FIGURES OR SOLIDIFICATION+OLD/CT OR "COCRYSTN." OR COCRYSTALLIZATION OR ?CRYSTALL? OR SINGLE(W)CRYSTAL? OR ("THERMOGRAVIMETRIC ANALYSIS"+RT OR "THERMAL ANALYSIS" OR CALORIMETRY+OLD OR "DIFFERENTIAL SCANNING CALORIMETRY"+OLD,RT OR "SCANNING PROBE MICROSCOPY (L) THERMAL"+OLD) /CT OR "TG (THERMOGRAVIMETRY)" OR "TGA (THERMOGRAVIMETRIC ANALYSIS)" OR "THERMOGRAVIMETRY (TG)" OR "BATCH CALORIMETRY" OR "DSC (DIFFERENTIAL SCANNING CALORIMETRY)" OR "DIFFERENTIAL SCANNING CALORIMETRY (DSC)" OR DSC OR THERM?(XA)?ANAL? OR THERMOMICROSCOP? OR SCANNING THERMAL MICROSCOPY OR "POLYMORPHISM (CRYSTAL)"+OLD,NT,RT OR "AMORPHOUS STRUCTURE" OR "POLYMORPHISM (CRYSTAL) (L) DIMORPHISM"+OLD OR "POLYMORPHISM (CRYSTAL) (L) ENANTIOTROPY"+OLD OR "POLYMORPHISM (CRYSTAL) (L) ISODIMORPHISM" OR "POLYMORPHISM (CRYSTAL) (L) MONOTROPY"+OLD OR "POLYMORPHISM (CRYSTAL) (L) PSEUDOPOLYMORPHISM" OR "POLYMORPHISM (L) DIMORPHISM" OR "POLYMORPHISM (CRYSTAL) (L) PSEUDOPOLYMORPHISM" OR "STRUCTURAL PHASE TRANSITION"+OLD)/CT OR "POLYMORPHISM (CRYSTAL)" OR POLYMORPH? OR POLYSTRUCTUR? OR ALLOTROP? OR ?AMORPH? OR PSEUDOMORPHISM? OR PARAMORPHISM OR PSEUDOPOLYMORPH? (SOLVATES+NT1,RT OR SOLVATION+NT1 OR HYDRATES+RT)/CT OR HYDRATE? OR SOLVAT? OR OLVOPHOBIC EFFECT OR ?SOLVENT?(A)(ADDUCT? OR COMPLEX) OR ?SOLVENT?(1A)COMPOUND? OR (SOLID-SOLID OR SOLID-STATE)(XA)PHASE TRANSITION? OR STRUCTURAL PHASE TRANSFORMATION# OR STRUCTURAL TRANSITIONS OR (SOLID OR "SOLID-STATE")(W)FORM? OR NOVEL(XA)FORM? OR SOLID? OR SOLID(W)STATE? OR "SOLID SOLUTIONS"/CT OR "SOLUTIONS, SOLID"/CT OR MIXED CRYSTAL# OR "SOLID SOLNS." OR "SUBSTITUTIONAL SOLID SOLNS.“ OR MICROSTRUCTURE/CT OR SOLID STATE PHASE TRANSITION? OR GLASS?(XA)(STRUCTUR? OR FORM?) OR MOLECUL?(XW)STRUCT? OR (MOLECULAR STRUCTURE-BIOLOGICAL ACTIVITY RELATIONSHIP OR STRUCTURE-ACTIVITY RELATIONSHIP OR STRUCTURE-ACTIVITY RELATIO? OR MOLECULAR STRUCTURE-BIOLOGICAL ACTIVITY RELATIONSHIPS)/CT

135 HCAPlus ricerca di records sul polimorfismo di un particolare API
=> fil reg ...... => LAPI => sel LAPI RN => Lsel RN => sel LAPI name => Lsel Name => fil hcaplus => s (Lsel RN /prp or Lsel Name )(L)/and Qdef => LPoly1 and p/dt => LPolypat1

136 HCAplus => (Lsel RN / prp or Lsel name )(L)Qdef => LPoly1
=> (Lsel RN / prp or Lsel name ) and Qdef not LPoly1 => LPoly2 => (Lsel RN or Lsel name ) and Qdef not (LPoly1 or LPoly2) => LPoly3

137 Miglioramento della modulazione
HCAplus Miglioramento della modulazione

138 HCAplus Il potenziamento della Qdef porta ad un incremento del rumore; è quindi necessario un miglioramento della modulazione.

139 HCAPlus Lo studio del potenziamento di Qdef ha permesso l'individuazione di ulteriori cross sections utili alla modulazione della Qdef stessa. Le nuove cross sections sono: 1 e 2

140 [Qdef and (org or pia 1 or 2)/cc and (75 or 63 or 1 or 2)/sx]
HCAplus ricerca di records anche orientati allo studio cristallografico di composti organici (es.APIs) => s [Qdef and (organic or applied)/cc and (22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 33 or 46 or 50 or 63 or 64 or 70 or 75)/cc] or [Qdef and (org or pia 1 or 2)/cc and (75 or 63 or 1 or 2)/sx] and p/dt

141 Superamento dei limiti del Sistema
HCAplus Superamento dei limiti del Sistema

142 User’s Day 2005 La policy di indicizzazione di CAS
L'errore nella indicizzazione Per trovare i records corrispondenti a lavori in cui struttura cristallina e/o polimorfismo non sono indicizzati, bisogna utilizzare => Lsel chem and Qdef => L2 => L2 not LPoly1 => L3 da valutare

143 HCAplus – Full-text Files
Per il recupero di documenti brevettuali i cui records in HCAplus non contengono alcuna keywords appartenente a Qdef si utilizzano, ove possibile, i Full-Text Patent Files, partendo dalla ricerca condotta in HCAplus. Il presupposto a tale strategia è che in un testo completo, se viene fatto riferimento al polimorfismo, almeno una keyword riguardante questo “concetto” ci deve essere.

144 HCAplus – Full-text Files
=> Lsel chem and p/dt not (LPoly1 or LPoly2 or LPoly3) => LPoly4 => sel LPoly4 pn with “PC” => L sel PC (PC = WO, EP, US, GB, FR(*)) => File “Full Text” (**) (PCTFULL, EPFULL, USPATFULL, GBFULL, FRFULL(*)) => L sel PC and Qfulldef => Lfullpat => d 1- kwic=10 (*)per FRFULL la ricerca è possibile utilizzando i termini in lingua inglese, nel titolo e nell’abstract dal 1996 (**)nei BI è permessa la SLART

145 HCAplus – Full-text Files
Qfulldef altro non è che Qdef,adattata ad una ricerca efficace nel Basic Index di un file full-text, a cui sono stati tolti termini troppo generici come “solid” o “crystal?” e tutti i controlled terms

146 HCAplus – Full-text Files
=> act Qfulldef X-RAY SCATTERING OR XRDP OR XRPD OR XPRD OR ELECTRON?(XA)DIFFRACTION? OR NEUTRON SMALL-ANGLE SCATTERING OR SANS OR NMR-CRYSTAL STRUCTURE RELATIONSHIP OR CRYSTAL? (xA)(FORM? OR FACET# OR HABIT OR SHAPE OR SYMMETRY OR STRUCTURE(W)TRANSITION# OR TRANSITION? OR MODIFICATION# OR MORPHOL?) OR MORPHOTROPY OR "SINGLE-CRYSTAL MORPHOL." OR GRANULARITY OR POLE FIGURES OR "COCRYSTN." OR COCRYSTALLIZATION OR SINGLE(W)CRYSTAL? OR "TG (THERMOGRAVIMETRY)" OR "TGA (THERMOGRAVIMETRIC ANALYSIS)" OR "THERMOGRAVIMETRY (TG)" OR "BATCH CALORIMETRY" OR "DSC (DIFFERENTIAL SCANNING CALORIMETRY)" OR "DIFFERENTIAL SCANNING CALORIMETRY (DSC)" OR DSC OR THERM?(XA)?ANAL? OR THERMOMICROSCOP? OR SCANNING THERMAL MICROSCOPY OR "POLYMORPHISM (CRYSTAL)" OR POLYMORPH? OR POLYSTRUCTUR? OR ALLOTROP? OR ?AMORPH? OR PSEUDOMORPHISM? OR PARAMORPHISM OR PSEUDOPOLYMORPH? HYDRATE? OR SOLVAT? OR SOLVOPHOBIC EFFECT OR ?SOLVENT?(A)ADDUCT? OR ?SOLVENT?(1A)COMPOUND? OR (SOLID-SOLID OR SOLID-STATE)(XA)PHASE TRANSITION? OR STRUCTURAL PHASE TRANSFORMATION# OR STRUCTURAL TRANSITIONS OR (SOLID OR "SOLID-STATE")(W)FORM? OR NOVEL(XA)FORM? OR SOLID(W)STATE? OR MIXED CRYSTAL# OR "SOLID SOLNS." OR "SUBSTITUTIONAL SOLID SOLNS."OR SOLID STATE PHASE TRANSITION? OR GLASS?(XA)(STRUCTUR? OR FORM?) OR MOLECUL?(XW)STRUCT?

147 Sviluppi della ricerca in IFIREF-IFIUDB

148 IFIREF – IFIUDB Rispetto al preliminare lavoro del 2004, il potenziamento della Qdef, con la introduzione di nuove keywords, ha imposto una revisione ed un aggiornamento della strategia di ricerca in IFIREF-IFIUDB

149 IFIREF – IFIUDB IFIREF è la Banca Dati contenente i Codici di Classificazione dell’ USPTO

150 IFIREF – IFIUDB IFIREF e costituito da quattro File Segments:
Classification Records contenenti i codici NCL ed un “Dictionary Index” del Manuale di Classificazione USPTO, delle materie e tecnologie classificate. Compound Records contenenti i codici Uniterms (UNcmp) identificativi di specifiche sostanze chimiche strutturabili. Fragment Records contenenti i codici Uniterms (“Fragments” corrispondenti ad atomi, gruppi funzionali e anelli) in grado di rappresentare strutture Markush, composti generici e composti specifici a cui non corrisponde un UNcmp. General Records contenenti i codici Uniterms (UNprp) descrittori di proprietà, usi, processi, reazioni, polimeri, classi di polimeri, sostanze naturali, miscele commerciali, classi di composti e composti non strutturabili.

151 IFIREF – IFIUDB Classification Record AN 203982 IFIREF
NCL LV 5 CT Crystalography (IPC G01N, A61B, H05G, G21K, H01J) X-RAY OR GAMMA RAY SYSTEMS OR DEVICES SPECIFIC APPLICATION Diffraction, reflection, or scattering analysis Diffractometry Crystalography

152 IFIREF – IFIUDB General Record AN 224 IFIREF UN 00224 CT AMORPHOUS
UF NONCRYSTALLINE BT PHYSICAL PROPERTIES 04044 RT CRYSTAL STRUCTURE 01402; DIAMOND-LIKE CARBON R; DOSAGE 01773; GLASS TRANSITION TEMPERATURE 02456; GLASSY ALLOYS R; ISOMORPHISM 02977; MORPHOLOGY 03469; PHASE CHANGE/RECORDING/ 09980; POLYMORPHISM 04239

153 IFIREF – IFIUDB Indagine più approfondita del contributo degli Uniterms già utilizzati (00224; 01402; 04239) Individuazione di Uniterms e di NCLs legati all’utilizzo di nuovi “Controlled Terms” da HCAplus

154 IFIREF – IFIUDB Indagine più approfondita del contributo degli Uniterms già utilizzati Il Basic Index di IFIREF contiene i BT, CT, NT, RT ed UF corrispondenti agli Uniterm => fil ifiref => “uniterm” not “uniterm”/un “Uniterm” = 00224; 01402; 04239 => L => d all permette di trovare i records di IFIREF dove esso è BT,NT,RT o UF di altri UNs

155 IFIREF – IFIUDB 09980 PHASE CHANGE/RECORDING/ 04239 POLYMORPHISM
PHYSICAL PROPERTIES MORPHOLOGY ISOMORPHISM GLASS TRANSITION TEMPERATURE CRYSTAL STRUCTURE POLYALLOMERS INTERCALATION COMPOUNDS STRUCTURES SOLVATES POLYCRYSTALLINE MICROCRYSTALS LATTICES INTERSTITIAL COMPOUNDS INCLUSION COMPOUNDS CRYSTALS/SINGLE/ CRYSTALS CRYSTAL, CRYSTALLINE, CRYSTALLINITY/STO/ CLATHRATES AMORPHOUS RESTRICTION FRAGMENT LENGTH POLYMORPHISM FORMS

156 IFIREF – IFIUDB Individuazione di UNs e di NCLs legati all’utilizzo di nuovi Controlled Terms da HCAplus

157 IFIREF – IFIUDB Polymorphism (Crystal) Crystal Morphology
Crystal Structure Solvates X-Ray Diffractometry Molecular structure Pseudomorphism Amorphous Structure X-Ray Diffraction Powder X-Ray Diffractometry Polymorphism Differential Scanning Calorimetry Isomorphism Diffractometry Crystals Crystallinity X-Ray Spectra Hydrates X- Ray spectra

158 IFIREF – IFIUDB Il Basic Index di IFIREF contiene controlled words e controlled terms relativo agli UNs ed ai NCLs => fil ifiref => “controlled term”HCAplus/BI and Class,General/FS “controlled terms” : solvates, hydrate(s), crystallinity, crystal morphology, X-Ray diffractometry, X-ray diffraction, Differential scanning calorimetry, Powder X-Ray diffractometry, Crystals, Isomorphism, Pseudomorphism => L => sel L ncl,un => d

159 IFIREF – IFIUDB Gli Uniterms corrispondenti ad alcuni CTsHCAplus (crystallinity, solvates, isomorphism, crystals) sono già stati trovati con l’approfondimento della ricerca condotto su gli UNs già conosciuti. La ricerca ha preso in considerazione i NCLs ed gli UNs corrispondenti agli altri CTsHCAplus.

160 IFIREF – IFIUDB UNs selezionati utilizzando i nuovi CTsHCAplus
00087 adduct 02721 hydrates 08956 differential scanning calorimetry NCLs selezionati utilizzando i nuovi CTsHCAplus (*) x-ray diffraction pattern (*) structure defined x-ray diffraction pattern ((*)principalmente utilizzati per i composti inorganici, nella petrolchimica e combustibili) diffraction crystallography powder technique

161 IFIREF – IFIUDB => fil ifiref => “uniterm” not “uniterm”/un
Anche per i nuovi UNs si conduce l’analisi in Basic Index => fil ifiref => “uniterm” not “uniterm”/un “Uniterm” = 00087; 02721; 08956 => L => d all Non si evidenziano ulteriori codici

162 IFIREF – IFIUDB La stringa di ricerca di records sul polimorfismo di un particolare API diventa quindi => fil Ifiudb => (RN/urn,bi or Lname )(L) Qdef or (RN/urn,bi or Lname ) and [LCTsdef/BI or (00224 or or or or or or or or or or or 02845)/un or ( or or or or )/ncl ] La ricerca di records sul polimorfismo di composti organici (es. APIs) => [(00224 or or or or or or or or or or or 02845)/un or ( or or or or )/ncl ] and [(532? or 534? or 536? or 540? or 544? or 546? or 548? or 552? or 554? or 556? or 558? or 560? or 562? or 564? or 568? or 570?)/ncl or (424? or 514?)/ncl] not (520? or 525? or 528?)/ncl => LIFI poly 23500 records

163 IFI - HCAplus Lo studio dei codici US proiettato su Chemical Abstracts ha permesso di individuare ulteriori sezioni precedentemente trascurate: 17 FOOD AND FEED CHEMISTRY, 1982 TO PRESENT 21 GENERAL ORGANIC CHEMISTRY, 1967 TO PRESENT 45 INDUSTRIAL ORGANIC CHEMICALS, LEATHER, FATS, AND WAXES, 1982 TO PRESENT 48 UNIT OPERATIONS AND PROCESSES, 1967 TO PRESENT 80 ORGANIC ANALYTICAL CHEMISTRY, 1967 TO PRESENT

164 HCAplus ricerca di records anche orientati allo studio cristallografico di composti organici (es.APIs) aggiornata è => s [Qdef and (organic or applied)/cc and (17 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 33 or 45 or 46 or 48 or 50 or 63 or 64 or 70 or 75 or 80)/cc] or [Qdef and (org or pia or 1 or 2)/cc and (75 or 63 or 1 or 2)/sx] => Qpoly and p/dt => Qpolypat

165 La nuova codifica Internazionale
User’s Day 2006 La nuova codifica Internazionale

166 User’s Day 2006 Non essendo più utilizzabile PATIPC, che non verrà aggiornato con la Versione 8 della Classificazione Internazionale, l’indagine è stata condotta via Web ed i risultati verificati in STN verso un campione di 11 multirecord Patent Families e 91 records individuali (853 brevetti in HCAplus) riguardanti il polimorfismo dei composti organici. Non sono stati introdotti codici direttamente collegabili al polimorfismo o ai concetti ad esso connessi.

167 User’s Day 2006 Il potenziamento della Qdef ed il miglioramento della modulazione, rispetto a quanto riportato nel 2004, hanno messo in evidenza un uso limitato ma preciso dei seguenti ICs G01N Investigating or analysing materials by using diffraction of the radiation, e.g. for investigating crystal structure C30B SINGLE-CRYSTAL GROWTH UNIDIRECTIONAL SOLIDIFICATION SINGLE CRYSTALS OR HOMOGENEOUS POLYCRYSTALLINE MATERIAL WITH DEFINED STRUCTURE

168 HCAplus I Codici giapponesi

169 HCAplus Dal 2004 è presente in CAplus un thesaurus dei codici brevettuali giapponesi (FTERM)

170 HCAplus => sel LPolypat pn with "jp”
=> Lsel SEL L14 1- PN WITH "JP" : TERMS => s Lsel L jp pat

171 HCAplus => e 4C086/GA15/fterm E# FREQUENCY AT TERM
E C086/GA13/FTERM E C086/GA14/FTERM E > 4C086/GA15/FTERM E C086/GA16/FTERM E C086/GA17/FTERM E C086/GA20/FTERM E C086/HA00/FTERM E C086/HA01/FTERM E C086/HA02/FTERM E C086/HA03/FTERM E C086/HA04/FTERM E C086/HA05/FTERM => e e254+all E BT5 FTCLA/FTERM FTERM CLASSIFICATION OF THE JAPANESE PATENT OFFICE E BT4 4/FTERM . Chemistry E BT3 4C/FTERM . . Medical Science E BT2 4C086/FTERM . . . Medicines that contain other organic and inorganic compounds E BT1 4C086/GA00/FTERM CHARACTERISTIC CHEMICAL STRUCTURE OF ORGANIC ACTIVE COMPONENTS E > 4C086/GA15/FTERM Crystal system

172 HCAplus => s L jp pat and 4C086/GA15/FTERM
=> L Poly jp code jp pat L’ poly jp code => s (polymorph? or crystal(w)(structure? or morpholog?) or solvate? or hydrate?) and !!!!/GA15/FTERM => L Poly jp code L

173 HCAplus

174 HCAplus ricerca per trovare i records contenenti patents giapponesi relativi al polimorfismo di composti organici (dopo il 2004) => s Qpolypat and 4C086/GA15/FTERM

175 User’s Day 2006 Un protocollo di ricerca

176 User’s Day 2006 Strategia di ricerca completa in STN per il recupero di “prior art” sul polimorfismo di un composto o una famiglia di composti organici

177 User’s Day 2006 => File Registry Ricerca del composto, suoi Sali, solvati e idrati => LRN => sel LRN RN => Lsel RN => sel LRN name => Lsel Name => File HCAplus => act Qdef => s (Lsel RN /prp or Lsel Name )(L)Qdef => L1 => s (Lsel RN or Lsel ) and Qdef not L1 => L2 => s Lsel RN and Beilstein/LC => L3 (se L3 > 0) => File Beilstein => s L3 (o BRN o “nome”/CN) and (CRYPH or CPT or CPD or CSYS or CSG)/FA => d (biblio) => File HCAplus => ricerca dei dati bibliografici => LBeiCaplus => File Rdisclosure => s Lsel Name and (polymorph? or crystal(w)(structure? or morpholog?) or DSC or differential scanning calorimetry or thermal analysis => LRdisc => File IFIUDB => s (RN/urn,bi or Lname )(L) Qdef or (RN/urn,bi or Lname ) and [LCTsdef/BI or (00224 or or or or or or or or or or or 02845)/un or ( or or or or )/ncl ] => LIFI

178 User’s Day 2006 => sel LIFI pn => LselIFI
=> File HCAplus => L5 => s (Lsel RN or Lsel Name ) not (L1 or L2 or LBeiCaplus or L5 ) => L6 => sel L6 pn with “WO” => LWO => sel L6 pn with “EP” => LEP => sel L6 pn with “US” => LUS => File PCTFULL => LWO and Qfulldef => L7 => d kwic=10 => …L7’ => sel L7’ pn =>L8 => File EPFULL => LEP and Qfulldef => L8 => d kwic=10 => …L8’ => sel L8’ pn =>L9 => File USPATFULL => LUS and Qfulldef => L10 => d kwic=10 => …L10’ => sel L7’ pn =>L10 => File HCAplus => s L6 not (L8 or L9 or L10) => L11 (patent and scientific literature) => s L11 and review/dt => L12 (da valutare) (Analytical Profiles of Drug Substances) => s L11 not L12 => L13 => s L13 and (?cyclodextr? or (inclusion or insertion)(xw)(adduct? or complex?))=> L14 => L13 not L14 =>L15

179 User’s Day 2006 Se L15 contiene ancora un numero troppo grande di risposte può essere modulato con le sezioni => s [L15 and (organic or applied)/cc and (17 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 33 or 45 or 46 or 48 or 50 or 63 or 64 or 70 or 75 or 80)/cc] or [L15 and (org or pia or 1 or 2)/cc and (75 or 63 or 1 or 2)/sx] => L16 (da valutare)

180 User’s Day 2006 Una buona ricerca sul polimorfismo non può prescindere da una altrettanto buona ricerca sul prodotto (API) e sulle sue preparazioni. Nella parte sperimentale di molti brevetti sono riportate le condizioni di cristallizzazione del prodotto stesso senza che ne venga caratterizzata la forma cristallina. In molti casi queste informazioni “anticipano” “inconsapevolmente” le forme cristalline, quindi i polimorfi, nonché la loro preparazione.

181 User’s Day 2006 Una buona ricerca sul polimorfismo non può prescindere da una altrettanto buona ricerca sulle formulazioni del prodotto (API). Spesso in diversi lavori di formulazione sono riportate informazioni sul cambiamento di cristallinità in seguito alla formulazione.

182 Agenda 09.30 - 10.00 Registrazione
Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – Novità in STN (Altri STN Files) Dr. U. Klemm STN Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS Coffee Break La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo Lunch Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS Coffee Break Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

183 Agenda 09.30 - 10.00 Registrazione
Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – Novità in STN (Altri STN Files) Dr. U. Klemm STN Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS Coffee Break La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo Lunch Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS Coffee Break Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

184 Idee per impostare e gestire una ricerca in Registry-CAPlus-Marpat
STN Users’ Day Bologna, 6 Dicembre 2006 Idee per impostare e gestire una ricerca in Registry-CAPlus-Marpat

185 N-idrossi-5-[1,1’-bifenile]-2,4-Pentadienammide
Un caso reale N-idrossi-5-[1,1’-bifenile]-2,4-Pentadienammide QUESITO: stabilire se è noto il derivato dell’acido idrossammico uso terapeutico: agente antitumorale Altre informazioni: sono già noti alcuni derivati bifenilici dell’acido idrossammico con attività antitumorale. In particolare è già noto: RN= 2-Propenamide, 3-[1,1'-biphenyl]-4-yl-N-hydroxy-, (2E)-

186 Un caso reale ACCESSION NUMBER: 1998:430728 HCAPLUS Full-text
DOCUMENT NUMBER: :148826 TITLE: Preparation of hydroxamic acids and their use as antitumor agents PATENT NO KIND DATE APPLICATION NO DATE JP A JP GRAPHIC IMAGE: ABSTRACT: Hydroxamic acids I [A = CH2CH2, CH:CH, C.tplbond.C; R1, R2 = H, NH2, NO2, OH, halo, C1-4 alkyl, C1-4 alkoxy, C1-4 (di)alkylamino, C1-4 alkylthio; Z = bond, CO, NHCO, CH2; the bond A is at meta or para position against the terminal benzene ring] and their pharmacol. acceptable salts are prepared. Amidation of 3-[4-(N,N-dimethyl)amino]benzoylcinnamic acid with H2NOH.HCl gave the corresponding hydroxamic acid with 14% yield, which at 1 M induced differentiation of A2780 cell.

187 Un caso reale Sono di interesse solo le strutture che contengano il bifenile e una catena coniugata contenente almeno due doppi legami. Altre informazioni: è importante che ci siano almeno due doppi legami coniugati (da 2 a 4, in particolare due) non sono ammesse sostituzioni sulla catena insatura con doppi legami coniugati il sostituente bifenilico deve essere necessariamente presente e può anche essere sostituito - oltre all’acido sono di interesse anche eventuali sali o esteri Una ricerca preliminare effettuata in Registry non ha consentito di individuare alcuna struttura con le caratteristiche descritte. La richiesta è per una ricerca più approfondita, soprattutto tra le strutture Markush

188 Considerazioni preliminari
SCOPO: elaborare una strategia di ricerca in MARPAT stabilire se la struttura di interesse rientra tra le sostanze profetiche descritte da una struttura Markush [non indicizzate tramite RNs in CAPlus e non indicizzate in Registry (se non già presenti)] cercare di stabilire il miglior compromesso tra la necessità di impostare una buona strategia, la più completa possibile, e contemporaneamente contenere il numero dei risultati che si ottengono OBIETTIVO: nei brevetti contenenti strutture Markush deve essere presente almeno un esempio relativo ad uno specifico composto descritto dalla struttura generica [indicizzato in CAPlus tramite RN] IDEA BASE:

189 Considerazioni preliminari
Schema generale della ricerca REGISTRY-HCAPLUS-MARPAT Selezionare una ampia classe di composti contenenti gli ASPETTI STRUTTURALI PRINCIPALI del composto di interesse REGISTRY: Cercare il set di strutture, eventualmente limitandolo introducendo anche il concetto dell’uso terapeutico, e isolare il set di brevetti presenti in Marpat HCAPLUS: Il set di brevetti isolato in HCAPlus costituisce l’insieme nel quale effettuare, in subset, la ricerca per struttura in Marpat MARPAT:

190 REGISTRY Selezionare una ampia classe di composti contenenti gli ASPETTI STRUTTURALI PRINCIPALI del composto di interesse almeno due doppi legami coniugati (da 2 a 4, in particolare due) non sono ammesse sostituzioni sulla catena insatura il sostituente bifenilico può anche essere sostituito - oltre all’acido sono di interesse anche eventuali sali o esteri

191 REGISTRY Ricerca preliminare ampia per decidere come selezionare la famiglia degli analoghi strutturali in Registry Ak, che congiunge Cb alla funzione idrossammica, è una catena da 4 a 8 C, lineare, insatura e con connettività esatta uguale a 2 (per non consentire né ramificazioni né altro tipo di sostituzione sulla catena insatura) tutti i legami della funzione idrossammica sono ring/chain Si sceglie di incominciare da una struttura di questo tipo per indagare in Registry anche un altro aspetto: i composti di interesse potrebbero essere indicizzati come sali ciclici [la funzione idrossammica ha note proprietà chelanti]

192 REGISTRY Uploading C:\Programmi\STN\Queries\str1.str chain nodes : 1 2
1 2 ring/chain nodes : chain bonds : ring/chain bonds : exact/norm bonds : Connectivity : 2:2 E exact RC ring/chain Generic attributes : 2: Type of chain : Linear Saturation : Unsaturated Element Count : Node 2: Unlimited C,C4-8 s L14 ful L SEA SSS FUL L14 EXTEND CANDIDATE STRUCTURE SEARCH COMPLETED TO ITERATE 100.0% PROCESSED ITERATIONS ( INCOMPLETE) ANSWERS SEARCH TIME: L SEA SSS FUL L14

193 REGISTRY => s L18/complete L19 112 L18/COMPLETE
=> d scan ITERATION INCOMPLETE ITERATION INCOMPLETE Ak saturo Ak saturo, ramificato, sostituito da eteroatomi => s L18/complete L L18/COMPLETE => s L19 and m/rel M/REL L L19 AND M/REL

194 REGISTRY in Marpat non si possono cercare i legami ring/chain
=> d scan in Marpat non si possono cercare i legami ring/chain la eventuale ricerca dei Sali Ciclici va trattata separatamente

195 REGISTRY Uploading C:\Programmi\STN\Queries\str2.str chain nodes :
chain bonds : exact/norm bonds : exact bonds : 5-6 Connectivity : 2:2 E exact RC ring/chain Generic attributes : 2: Type of chain : Linear Saturation : Unsaturated Element Count : Node 2: Limited C,C4-8 => s L29 ful L SEA SSS FUL L29 EXTEND CANDIDATE STRUCTURE SEARCH COMPLETED TO ITERATE 100.0% PROCESSED ITERATIONS ( 1245 INCOMPLETE) ANSWERS L SEA SSS FUL L29 (contro 1405) => s L31/complete L L31/COMPLETE (contro 122)

196 REGISTRY => s L29 ful L30 122814 SEA SSS FUL L29 EXTEND
CANDIDATE STRUCTURE SEARCH COMPLETED TO ITERATE 100.0% PROCESSED ITERATIONS ( 1245 INCOMPLETE) ANSWERS L SEA SSS FUL L29 (contro L18) => s L31/complete L L31/COMPLETE (contro L19) => s L19 not L32 L L19 NOT L32 => d scan C’è qualcosa che non va con Ak anche tra le strutture /COMPLETE !!

197 strutturalmente più vicini al composto di interesse
REGISTRY Nell’ambito della famiglia degli analoghi strutturali in Registry tentiamo di isolare quelli strutturalmente più vicini al composto di interesse Set base di strutture in Registry: L S L29 FUL EXTEND L S L29 FUL => s L31 and BIPHENYL BIPHENYL L L31 AND BIPHENYL => D SCAN NESSUNA STRUTTURA INTERESSANTE => S L31 AND PENTADIENAMIDE 2539 PENTADIENAMIDE L L31 AND PENTADIENAMIDE => D SCAN ALCUNE STRUTTURE INTERESSANTI

198 REGISTRY Ad es.: => S L31 and C H N O/ELF 8064414 C H N O/ELF
L L31 AND C H N O/ELF => S L36 AND 2/O(P)1/N /O /N /O(P)1/N L L36 AND 2/O(P)1/N => D SCAN ALCUNE STRUTTURE INTERESSANTI

199 Set di composti strutturalmente più vicini alla sostanza di interesse
REGISTRY Ad es.: L (L31 AND PENTADIENAMIDE) e L (L31 AND C H N O/ELF AND 2/O(P)1/N) Set di composti strutturalmente più vicini alla sostanza di interesse

200 HCAPLUS Cercare il set di strutture isolate in Registry, eventualmente limitandolo introducendo anche il concetto dell’uso terapeutico, e isolare il set di brevetti presenti in Marpat SI CREANO TRE DIVERSI SET DA PORTARE IN MARPAT => d his FILE 'REGISTRY' SET EXTEND ON PERM L S L29 FUL EXTEND L S L29 FUL L S L31 AND BIPHENYL L S L31 AND PENTADIENAMIDE L S L31 AND C H N O/ELF L S L36 AND 2/O(P)1/N => s L30 L L30 => s L38 and marpat/os L L38 AND MARPAT/OS L78: BREVETTI MARPAT DA STRUTTURE ISOLATE IN REGISTRY

201 HCAPLUS L43: BREVETTI MARPAT RELATIVI ALL’USO TERAPEUTICO
=> s (?TUMOR? OR ?NEOPLAS? OR ?CANCER? OR ?CARCINO? OR ?ONCOL? OR((HISTONE DEACETYLASE) (2A) INHIB?)) L => s L42 and marpat/os L L42 AND MARPAT/OS L43: BREVETTI MARPAT RELATIVI ALL’USO TERAPEUTICO => s L35 L L35 => s L37 L L37 => s L39 or L40 L L39 OR L40 => s L41 and L42 L L41 AND L42 => s L44 and marpat/os L L44 AND MARPAT/OS L45: BREVETTI MARPAT DA COMPOSTI “PIU’ SIMILI”+USO TERAPEUTICO => s L44 not p/dt L L44 NOT P/DT L46: NON PATENT LITERATURE DA COMPOSTI “PIU’ SIMILI”+USO TERAPEUTICO

202 HCAPLUS → MARPAT SI TRASPORTANO IN MARPAT I TRE DIVERSI SET ISOLATI IN HCAPLUS => d L43 an 9500 L43 ANSWER 9500 OF HCAPLUS COPYRIGHT 2006 ACS on STN AN : HCAPLUS DN 136:123640 => S L43 RANGE=(2002:51976, ) 68016 MARPAT/OS L L42 AND MARPAT/OS => d L43 an 18000 L43 ANSWER OF HCAPLUS COPYRIGHT 2006 ACS on STN AN : HCAPLUS DN 115:280483 => S L43 RANGE=(1991:680483, ) MARPAT/OS L L42 AND MARPAT/OS => s L43 not L73 L L43 NOT L73 => s L73 not L72 L L73 NOT L72

203 MARPAT L79: BREVETTI MARPAT DA STRUTTURE ISOLATE IN REGISTRY (7572)
=> fil marpat => s L78 L L78 L79: BREVETTI MARPAT DA STRUTTURE ISOLATE IN REGISTRY (7572) => s L72 L L72 => s L74 L L74 => s L75 L L75 => s L80 or L81 or L82 L L80 OR L81 OR L82 L83: BREVETTI MARPAT RELATIVI ALL’USO TERAPEUTICO (21073) => s L45 L L45 L84: BREVETTI MARPAT DA COMPOSTI “PIU’ SIMILI”+USO TERAPEUTICO (15)

204 La struttura viene cercata a liveLLo CLASS, UNLIMITED
MARPAT Il set di brevetti isolato in Registry-HCAPlus costituisce l’insieme nel quale effettuare, in subset, la ricerca per struttura in Marpat Uploading C:\Programmi\STN\Queries\marpat.str Match Level : 1:CLASS 2:CLASS 3:CLASS 4:CLASS 5:CLASS 6:CLASS 7:CLASS 8:CLASS 9:CLASS 10:CLASS 11:CLASS 12:CLASS 13:CLASS 14:CLASS 15:CLASS 16:CLASS 17:CLASS 18:CLASS 19:CLASS 20:CLASS La struttura viene cercata a liveLLo CLASS, UNLIMITED

205 MARPAT ANALISI DEI RISULTATI
L79: BREVETTI MARPAT DA STRUTTURE ISOLATE IN REGISTRY (7572) => s L85 ful sub=L79 L SEA SUB=L79 SSS FUL L85 EXTEND CANDIDATE STRUCTURE SEARCH COMPLETED TO ITERATE 100.0% PROCESSED ITERATIONS ANSWERS SEARCH TIME: L SEA SUB=L79 SSS FUL L85 ANALISI DEI RISULTATI 1. Si cercheranno per primi eventuali documenti relativi alla sostanza impiegata per l’uso terapeutico indicato 2. Si cercheranno poi eventuali altri riferimenti alla sostanza di interesse

206 ANALISI DEI RISULTATI L84: BREVETTI MARPAT DA COMPOSTI
=> s L88 and L84 L L88 AND L84 L84: BREVETTI MARPAT DA COMPOSTI “PIU’ SIMILI”+USO TERAPEUTICO (15) => d fhit G1 = H / alkyl <containing 2-10 C> /...... G10 = bond / C(O) / S(O) / SO2 / S / G20 = 95 / 40 MSTR 1 G17 = OH / SH / alkylthio <containing 1-6 C> / alkoxy <containing 1-6 C> / 75 G9 = / / G4 = H / ... G22 = H / R G16 = G19 / carbon chain <containing 2 or more C, 0 or more double bonds> (opt. substd.) / CH=CH / CH=CHCH=CH G28 = NH / 112 G29 = NH2 / alkylamino <containing 1-6 C> / dialkylamino <each alkyl containing 1-6 C> / OH / alkoxy <containing 1-6 C>

207 ANALISI DEI RISULTATI Patent Location: claim 1
Note: and pharmaceutically acceptable salts ACCESSION NUMBER: : HCAPLUS DOCUMENT NUMBER: :197670 TITLE: Preparation of phenylalkyl acid derivatives as histone deacetylase inhibitors INVENTOR(S): Marson, Charles PATENT ASSIGNEE(S): University College London, UK PATENT INFORMATION: PATENT NO KIND DATE APPLICATION NO DATE WO A WO 2004-GB AB Compds. of formula I [R1-R5 = H, alkyl, alkoxy, OH, halo, amino, nitro, CN, etc.; R6 = H, alkyl, etc; R7, R8 = H, halo, alkyl, aryl, heterocyclyl, (substituted) OH, etc.; R6R8 = CH2; X = (substituted) OH, SH, NHOH, etc.; Y = (substituted) alkenylene, alkylene; W = CONH, SO2NH, etc.] are prepared for use in treating a disorder mediated by histone deacetylase. The compds. are useful in the treatment of cancers. They may be utilized in combination therapies with DNA methylation inhibitors and other anti cancer agents. Thus, II was prepared, and had IC50 of 49 nM against histone deacetylase.

208 ANALISI DEI RISULTATI HITSTR Titolo: PHARMACEUTICAL AGENTS
Riassunto: Use of compounds of formula (I) in the manufacture of a medicament for use in treating a disorder mediated by histone deacetylase: wherein the symbol ---- represents a single bond or a double bond or the symbol ---- R6 and R8 together represent cyclopropyl and R1 to R8 W, X and Y are as defined herein; and pharmaceutically acceptable salts thereof. Also disclosed are compounds for such uses. The compounds are useful in the treatment of cancers. They may be utilised in combination therapies with DNA methylation inhibitors and other anti cancer agents.

209 ANALISI DEI RISULTATI Commenti
Estratto dalla descrizione: A preferred class of compounds according to the invention have the formula (II) : wherein R1, R2, R6, R18, W and X are as defined above and m is 1, 2 or 3; and pharmaceutically acceptable salts thereof. More especially, R1 and R2 each independently represent hydrogen, C1-C6 alkyl, C1-C6 alkxoy, halo or (C1-C6 alkoxy) carbonyl; R6 and R18 are each independently selected from hydrogen, C1-C4 alkyl or C1-C4 alkoxy ; W represents a single bond,-CH=N-,-N=CH-,-CONH-,-NHCO-, -SO2NH-,-NHSO2-,-OCH2-,-CH2O-,-CH2S-or-SCH2-; and X represents-NHOH, CF3 or-OR14 wherein R14 is hydrogen or Cl-C4 alkyl. Rivendicazione 9: Use according to claim 1, wherein the compound is of formula (II): wherein R1, R2, R6, R18, W and X are as defined above and m is 1,2 or 3; and pharmaceutically acceptable salts thereof Commenti L’invenzione è relativa all’uso di una classe di composti nel trattamento dei disordini mediati da histone deacetylase. Tali composti sono utili nel trattamento del cancro. Una classe preferita di composti è quella descritta dalla formula (II). La struttura (II) dove in particolare R1, R2, R6,R18 = idrogeno; W = legame singolo; X = -NHOH corrisponde al composto N-idrossi-5-[1,1’-bifenile]-2,4-Pentadienammide che pertanto è descritto dalla formula Markush (II).

210 ANALISI DEI RISULTATI => s L88 and L83
L L88 AND L83 L83: BREVETTI MARPAT RELATIVI ALL’USO TERAPEUTICO (21073) => s L88 not L97 L L88 NOT L97 SOLO STRUTTURE AN 106: MARPAT Full-text TI Preparation of aryl hydroxamic acid derivatives, compositions containing them, and their use in medicine and other applications. EP A Alcune HITSTR:

211 ANALISI DEI RISULTATI Commenti
Titolo: ARYL DERIVATIVES Novel compounds of formula (I) Ar-(L-Ar')q-(X)k-(Y)p-Q wherein:...... Commenti L’invenzione è relativa ad una classe di composti inibitori della lipossigenasi e/o della ciclossigenasi che possiedono utili proprietà mediche sia terapeutiche che profilattiche. Tra i composti descritti dalla formula Markush (I) segnaliamo la classe di composti che si ottiene quando: q, k = 0 p = 1 Ar = Ph-Ph Y = C1-10 alkenylene Q = -C(O)-NH-OH tale famiglia di composti contiene anche l’ N-idrossi-5-[1,1’-bifenile]-2,4-Pentadienammide

212 ALTRE IDEE PER SFRUTTARE IL SET DEI COMPOSTI STRUTTURALMENTE PIU’ SIMILI
Da tentare soprattutto se il set ha già dato buoni risultati e si è quindi dimostrato “ben rappresentativo” del composto di interesse => s L44 not p/dt L L44 NOT P/DT L46: NON PATENT LITERATURE DA COMPOSTI “PIU’ SIMILI”+USO TERAPEUTICO ACCESSION NUMBER: : HCAPLUS DOCUMENT NUMBER: :71333 TITLE: Stereodefined and polyunsaturated inhibitors of histone deacetylase based on (2E,4E)-5-arylpenta-2,4- dienoic acid hydroxyamides AB Syntheses of (2E,4E)-5-arylpenta-2,4-dienoic acid hydroxyamides are described, some of which are potent inhibitors of histone deacetylase, a double bond conferring more than a 10-fold increase in potency compared with the triple bond analog oxamflatin. Variation of substituents on the aromatic ring has a marked effect on potency, in vitro IC50 values down to 50 nM being obtained

213 RICERCA DELLA NON PATENT LITERATURE
AUTHOR(S): Marson, Charles M.; Serradji, Nawal; Rioja, Alphonso S.; Gastaud, Sebastien P.; Alao, John P.; Coombes, R. Charles; Vigushin, David M. CORPORATE SOURCE: University College London, Department of Chemistry, Christopher Ingold Laboratories, London, WC1H OAJ, UK SOURCE: Bioorganic & Medicinal Chemistry Letters (2004), 14(10), CODEN: BMCLE8; ISSN: X TITLE: Preparation of phenylalkyl acid derivatives as histone deacetylase inhibitors INVENTOR(S): Marson, Charles PATENT ASSIGNEE(S): University College London, UK PATENT INFORMATION: PATENT NO KIND DATE APPLICATION NO DATE WO A WO 2004-GB in un altro “contesto temporale” poteva essere un documento molto significativo……

214 Thanks for your attention !
©Petra Gnemmi Quaestio® by Studio Moradei Patent Information Partners via Sanvito, 43 21100 Varese

215 Agenda 09.30 - 10.00 Registrazione
Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – Novità in STN (Altri STN Files) Dr. U. Klemm STN Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS Coffee Break La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo Lunch Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS Coffee Break Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

216 (Registry, CAPLus, Marpat)
A Patent Search (Registry, CAPLus, Marpat) Guglielmo Rucci

217 Question: You need to know the prior art, patents and articles, about complexes containing at least two Platinum atoms, as specified in the following structure.

218 Anything between N and Pt

219 Registry-CAPLus

220 => fil reg  STRUCTURE UPLOADED  => d L STR

221 1:CLASS 2:CLASS 3:CLASS 4:CLASS 5:CLASS
chain nodes : ring/chain nodes : 1 4 chain bonds : exact bonds :   Hydrogen count : 2:= exact 3 5:= exact 3 Connectivity : 3:2 M minimum RC ring/chain Match level : 1:CLASS 2:CLASS 3:CLASS 4:CLASS 5:CLASS UNLIMITED

222 => l1 FULL FILE PROJECTIONS: ONLINE **INCOMPLETE** BATCH **INCOMPLETE** PROJECTED ITERATIONS: TO PROJECTED ANSWERS: TO L SEA SSS SAM L1

223 => fil reg => b8/pg (Fe, Co, Ni, Ru, Rh, Pd, Os, Ir, Pt) L B8/PG => L STRUCTURE UPLOADED => l2 full subset=l1 L SEA SUB=L1 SSS FUL L2

224 => l4 and pt=>2 L L4 AND PT=>2 => fil caplus => l5 L L5 => l6 and p/dt L L6 AND P/DT

225

226

227

228

229

230

231 Registry-Caplus-MARPAT

232 => fil marpat => L STRUCTURE UPLOADED => l1 FULL FILE PROJECTIONS: ONLINE **INCOMPLETE** BATCH **INCOMPLETE** PROJECTED ITERATIONS: TO PROJECTED ANSWERS: TO L SEA SSS SAM L1

233 > fil reg => pt/els L PT/ELS => fil caplus => l1 and marpat/os L L1 AND MARPAT/OS

234 => fil marpat => l2 L L2 => L STRUCTURE UPLOADED => l4 full subset=l3 L SEA SUB=L3 SSS FUL L4 (Eight patents original from Marpat)

235 G11= Pt G7= 50 G8= NH3 / alkylamine

236 G19= Pt G1= NH3 G4= NH3 G3, G5=

237 G1= Pt G4, G6= NH3 G5=24

238 G3= Pt G1= H / carbon chain

239 G1= 1 G2= NH3 (opt. substd.) G3= halogen anion

240 Agenda 09.30 - 10.00 Registrazione
Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – Novità in STN (Altri STN Files) Dr. U. Klemm STN Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS Coffee Break La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo Lunch Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS Coffee Break Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

241 Agenda 09.30 - 10.00 Registrazione
Novità in STN (CAS Files) Ms. H. Waldhoff CAS 10.30 – Novità in STN (Altri STN Files) Dr. U. Klemm STN Le proprietà chimico-fisiche in Registry Dr. G. Rucci STN/CAS Coffee Break La ricerca delle sostanze polimorfe in STN III° Dr. A. Tarquini Notarbartolo Lunch Registry-CAPlus-Marpat: un caso reale Dr. P. Gnemmi Moradei Una ricerca brevettuale (Registy CAPlus Marpat) Dr. G. Rucci STN/CAS Coffee Break Seminari 2007, Commenti, Chiusura Dr. G. Rucci STN/CAS

242 Seminari 2006 Consorzio Scuole Lavoro Milano via G.B. Pergolesi 8

243 STN Easy - STN Express martedì 10/01/2006 Gennaio STN Express+Discover! - STN on the Web mercoledì 11/01/2006 Le Ricerche Elementari in STN martedì 17/01/2006 Il File Registry: La Ricerca Elementare mercoledì 18/01/2006 La Ricerca in STN con le Keywords martedì 24/01/2006 La Sicurezza e i dati Chimico-fisici dei composti chimici mercoledì 25/01/2006 Il File Registry: La Ricerca per Struttura 1° martedì 31/01/2006 Il File Registry: La Ricerca per Struttura 2° mercoledì 01/02/2006 Febbraio La Ricerca delle Reazioni 1° martedì 07/02/2006 La Ricerca delle Reazioni 2° mercoledì 08/02/2006 Il File Registry: La ricerca via Dictionary 1° (prima parte) martedì 14/02/2006 Il File Registry: La ricerca via Dictionary 1° (seconda parte) mercoledì 15/02/2006 Il File Registry: La ricerca via Dictionary 2° (prima parte) martedì 21/02/2006 Il File Registry: La ricerca via Dictionary 2° (seconda parte) mercoledì 22/02/2006 Il File Registry: Esercitazioni e Casi Particolari martedì 28/02/2006 Patents: Gli Elementi di Base mercoledì 01/03/2006 Marzo Patents: Gli Strumenti Principali per la Ricerca (prima parte) martedì 07/03/2006 Patents: Gli Strumenti Principali per la Ricerca (seconda parte) mercoledì 08/03/2006 Patents: Gli Strumenti Secondari per la Ricerca (prima parte) martedì 14/03/2006 Patents: Gli Strumenti Secondari per la Ricerca (seconda parte) mercoledì 15/03/2006 Patents: Studio di un Caso martedì 21/03/2006 La Ricerca dei Farmaceutici mercoledì 22/03/2006

244 You can find all seminars and also this presentation:
Users’ Meeting 2006 on the WEB:


Scaricare ppt "STN Users’Meeting CNR Bologna 6 Dicembre 2006."

Presentazioni simili


Annunci Google