La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Analisi quantitativa delle sequenze di DNA Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute.

Copie: 1
Delezioni Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine (TIGEM)

Presentazioni simili


Presentazione sul tema: "Analisi quantitativa delle sequenze di DNA Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute."— Transcript della presentazione:

1 Analisi quantitativa delle sequenze di DNA Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine (TIGEM)

2 Genome Variation SSR Short Sequence Repeats ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CACACACACACACACACACACACACA CCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACAC AGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CACACACACACACACACACACACACACACACA CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCT AGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTC GCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGAC ACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC Allele 1 Allele 2 ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CACACACACACACA CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATAT AGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTG ACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATA Allele 3

3 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAG ACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGG GCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCC CTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCG CTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTC GCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAG ACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATA GCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACA CGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCG AGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGC ACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCT CGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGC TCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCT GAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACAC GTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGA

4 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACTATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCG ACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTA GCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAG CTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCC GACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCG ACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACA GCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACA GCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACA CACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCT CGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTC CTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACA GATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCT CCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCT CGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCT CGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCT CGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATA TATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAG ATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACAC CGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAG CTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTG AAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGA CCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGA 1 2 Copy Number Variation 10% of the human genome could vary in copy number

5

6

7 grandi delezioni

8

9

10

11 fenotipo Livello di espressione Ipotesi sulla variabilità del fenotipo di 6 individui diversi in caso di trisomia 21 in presenza di varianti alleliche

12 dominanza e recessività in genetica, il carattere (o lallele) è dominante se leterozigote è indistinguibile dallomozigote in medicina la malattia è: –dominante: fenotipo clinicamente manifesto con 1 allele mutato –recessiva: fenotipo clinicamente manifesto con 2 alleli mutati (omozigote o eterozigote composto)

13 5 effetti di un allele amorfo e ipomorfo causati dalle delezioni nullo o amorfo = nessun prodotto genico ipomorfo = ridotta quantità/attività ipermorfo = aumentata quantità/attività neomorfo = nuova quantità/attività antimorfo = quantità/attività antagonistica (dominante negativo)

14 Nella condizione A un fenotipo si osserva solo se entrambi gli alleli sono colpiti (omozigosi o eterozigosi composta) Nella condizione B si osserva un fenotipo già in eterozigosi per aploinsufficienza

15 In caso di delezioni del cromosoma X nei maschi si osserva direttamente in fenotipo come sindrome da geni contigui In caso di delezioni autosomiche in eterozigosi molto spesso il dosaggio dimezzato non è causa di malattia. Quando si osserva una sindrome da delezione, è risolutivo trovare la stessa sindrome causata da una mutazione puntiforme in uno solo dei geni. Se questo non cè mai, la sindrome esiste solo come somma di più difetti

16 Malattie autosomiche dominanti causate da delezioni basi biochimiche delle delezioni dominanti 1.il livello dimezzato di prodotto genico è insufficiente a mantenere il fenotipo 2.il difetto eterozigote diviene omozigote a livello delle cellule dei tessuti periferici (LOH) 3.Un solo allele è espresso per imprinting dellaltro

17

18 aploinsufficienza insufficiente quantità di prodotto genico causata da una mutazione in eterozigosi la mutazione è di tipo allele amorfo o ipomorfo colpisce geni per i quali il 50% di prodotto genico non è abbastanza per garantirne la funzione spesso un dosaggio preciso è richiesto ai fattori di trascrizione e alle molecole di segnale espressi nel corso dello sviluppo

19 Williams-Beuren prevalenza alla nascita 1/ /20.000, ma può non essere diagnosticata

20 Williams una delezione tipica

21 Williams genetica delezione de novo trasmissione autosomica dominante delezione di 1.6MB da 21 geni contigui in eterozigosi a 7q11.23 –gene dellelastina –LIM kinase 1 (LIMK1) –CLIP-115 che lega i microtubuli –Fattori di trascrizione GTF2I e GTF2IRD1 –effetto posizionale su altri geni circostanti la delezione

22 Williams FISH delezione 7q11.23 rilevabile mediante FISH ma non cariotipo rilevabile mediante FISH ma non cariotipo

23 Wolf-Hirschhorn genetica delezione de novo di circa 4MB le delezioni sono più frequenti nella linea germinale maschile trasmissione autosomica dominante Regione critica di 165 kb di molti geni contigui in eterozigosi a 4p16.3

24 Wolf-Hirschhorn Scarso accrescimento Ritardo mentale, ipotonia Labbro leporino Conformazione ad elmo di guerriero greco

25 Sindrome 5p- (cri du chat) 1: nati Pianto acuto e flebile Caratteristiche principali: –Ritardo di crescita –Microcefalia ed ipertelorismo –Ipotonia, diastasi dei retti –Deficit intellettivo e del linguaggio

26 Sindrome 18q- ipotonia microcefalia ipoplasia della regione centrale del volto ritardo mentale e sordità

27 Imprinting

28 Nelle cellule germinali primordiali limprinting viene cancellato del tutto e il DNA è demetilato Successivamente nella linea germinale maschile si determina un pattern di imprinting che in alcuni loci è complementare a quello della linea germinale femminile I cromosomi su cui avviene limprinting (7, 11, 15) manterranno questo pattern e lo riprodurranno ad ogni mitosi Si potranno sempre distinguere lespressione genica del cromosoma materno e paterno

29 Disomia uniparentale Due copie dello stesso cromosoma sono ereditate dallo stesso genitore Spesso questo avviene attraverso un fenomeno transitorio di trisomia, seguito dalla perdita del cromosoma singolo e mantenimento del cromosoma doppio

30 Angelman 70% dei casi delezione della regione cromosomica 15q11-q13, che è soggetta al fenomeno dell'imprinting del cromosoma paterno Il gene materno (l'unico espresso) può essere alterato con 4 meccanismi noti: –delezione –disomia uniparentale paterna –difetti nell'imprinting –mutazioni a carico del gene UBE3A (ubiquitin ligasi) La diagnosi è clinica e il difetto genetico non si identifica nel 20% dei casi

31

32 "happy puppet syndrome" si può identificare in Cucciolo (Dopey) "addormentato", il più giovane dei nani che non ha mai imparato a parlare ritardo mentale con assenza del linguaggio, difficoltà nell'equilibrio, eccessivo buon umore Angelman

33 L'incidenza è 1/ nati crisi epilettiche e comunque alterazioni dell'EEG e microcefalia relativa Angelman

34 Prader-Willi iperfagia>obesità eccessiva assunzione di liquidi reazioni abnormi ai sedativi acromicria, criptorchidismo insensibilità al dolore, lesioni cutanee sbalzi di umore

35 Prader-Willi 1/15.000

36 Distrofia muscolare Duchenne/Becker DMD Duchenne - 1/3,500 maschi Insorgenza -- Infanzia - tra 2 e 6 anni Sintomi – Debolezza generalizzata e danno muscolare prima agli arti e al tronco, polpacci ingrossati Progressione – Lenta ma inesorabile. Colpisce tutti i muscoli volontari. Sopravvivenza fino a anni BMD Becker - 1/10,000 maschi Insorgenza – Adolescenza o dopo Sintomi – Identici alla DMD ma più attenuati. Vi è coinvolgimento cardiaco significativo Progressione – Più lenta e più variabile della distrofia di Duchenne con buona aspettativa di vita

37 Le delezioni intrageniche del gene della distrofina mandano fuori cornice la lettura delle triplette quando gli esoni cancellati contenevano un numero di nucleotidi che non è multiplo esatto di tre (1,2,4,5,7,8,10,11 ecc). Questo causa la distrofia di Duchenne

38

39 Le delezioni intrageniche che non alterano la cornice di lettura portano alla distrofia muscolare di Becker o ad un apparente buona salute. Forniscono informazioni per preparare delle microdistrofine per la terapia genica

40

41 Perdita di eterozigosità LOH (loss of heterozygosity)

42 Nomenclatura delle delezioni Le delezioni sono designate con la sigla del che segue i numeri dei nucleotidi a monte e a valle della delezione separatida un segno _ –82_83del (o 82_83delTG) indica una delezione di TG nella sequenza ACTTTGTGCC (dove A è il nucleotide 76) che diventa ACTTTGCC

43 MLPA probes

44 Hybridization 1.The MLPA probemix is added to denatured genomic DNA 2.The two parts of each probe hybridise to adjacent target sequences

45 ligation 3. Probes are ligated by a thermostable ligase

46 PCR amplification 4.A universal primer pair is used to amplify all ligated probes The PCR product of each probe has a unique length ( bp)

47 separation and quantification by capillary electrophoresis Each peak is the amplification product of a specific probe. Samples are compared to a control sample. A difference in relative peak height or peak area indicates a copy number change of the probe target sequence

48

49

50 Triple X Female Male 283 bp 346 bp detection of Chr X copy number X

51 MLPA discriminates sequences that differ in only a single nucleotide and can be used to detect known mutations MismatchPerfect match Ligation of the two probe oligonucleotides Amplification product Mismatch at the probe ligation site No ligation, no amplification product

52 Unmethylated Target M M Methylated Target Denaturation and Multiplex probe hybridization M Only undigested (methylated) and ligated probes are exponentially amplified Ligation and Digestion with methylation sensitive endonucleases M MS-MLPA

53

54

55


Scaricare ppt "Analisi quantitativa delle sequenze di DNA Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute."

Presentazioni simili


Annunci Google