La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Lezione 1 Cromosomopatie: incidenza e rischio riproduttivo lezione 1 Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda.

Presentazioni simili


Presentazione sul tema: "Lezione 1 Cromosomopatie: incidenza e rischio riproduttivo lezione 1 Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda."— Transcript della presentazione:

1 lezione 1 Cromosomopatie: incidenza e rischio riproduttivo lezione 1 Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine, Napoli

2 Difetto congenito una qualsiasi anomalia insorta tra il concepimento e la nascita genetico (ereditario e non ereditario) – –cromosomico – –genico non genetico

3 Rischio riproduttivo generale per una coppia per cui lanamnesi personale e familiare abbiano escluso un incremento del rischio rispetto alla popolazione è 3-5% in caso di difetti congeniti rilevabili alla nascita (anomalie cromosomiche = 0.65%) 8-10% rilevabili entro i 10 anni di età

4 Variazioni genetiche sono dette SNP e si presentano 1:500 basi CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC

5

6 Valutazione del rischio riproduttivo nel periodo preconcezionale momento ottimale (ma oltre la metà delle gestazioni insorge inaspettatamente) raccolta dei dati (visita, abitudini, terapie, accertamenti lab) SCOPO: identificazione dei portatori sani di malattie genetiche – –portatori che hanno un rischio riproduttivo a prescindere dal partner – –portatori in cui il rischio si manifesta solo nel caso di unione con un partner portatore

7 portatori che hanno un rischio riproduttivo a prescindere dal partner donne con mutazioni recessive legate al cromosoma X (esempio: Distrofia muscolare di Duchenne) donne con mutazioni recessive legate al cromosoma X (esempio: Distrofia muscolare di Duchenne)

8 portatori che hanno un rischio riproduttivo a prescindere dal partner portatori di una traslocazione cromosomica bilanciata portatori di una traslocazione cromosomica bilanciata –scambio di materiale genetico tra cromosomi non omologhi –non vi è modificazione della dose genica –frequenza 1/520 nati –fenotipicamente normale reciproca

9 Conseguenze possibili delle traslocazioni bilanciate Traslocazione bilanciata Normale Traslocazione non bilanciata Trisomia Segregazione alternata Segregazione adiacente 1 Segregazione adiacente 2 Traslocazione non bilanciata

10 portatori che hanno un rischio riproduttivo a prescindere dal partner mutazioni dominanti ad esordio tardivo (corea di Huntington, atassie spinocerebellari) mutazioni dominanti ad esordio tardivo (corea di Huntington, atassie spinocerebellari) mutazioni dominanti a penetranza incompleta mutazioni dominanti a penetranza incompleta

11 portatori in cui il rischio si manifesta solo nel caso di unione con un altro portatore mutazioni autosomiche recessive mutazioni autosomiche recessive –con familiarità (coppia già a rischio) –senza familiarità (valutare la consanguineità)

12 ogni individuo è portatore sano di almeno 8 malattie genetiche recessive, di cui 3 letali fratelli, genitori-figli fratelli, genitori-figli fratellastri, zii-nipoti fratellastri, zii-nipoti cugini diretti (0.5%) cugini diretti (0.5%) secondi cugini secondi cugini 1/4 omozigosi 1/4 omozigosi 1/8 omozigosi 1/8 omozigosi 1/16 omozigosi 1/16 omozigosi 1/64 omozigosi 1/64 omozigosi i difetti congeniti hanno un rischio empirico raddoppiato in caso di coefficiente di consanguineità 1/16 le conseguenze genetiche della consanguineità non possono essere valutate da un esame cromosomico che pertanto risulta inutile

13 La fibrosi cistica è la malattia autosomica recessiva letale più frequente Il grafico indica in quale percentuale dei casi un test rapido di laboratorio potrebbe identificare i portatori sani eterozigoti nelle varie etnie Il grafico indica in quale percentuale dei casi un test rapido di laboratorio potrebbe identificare i portatori sani eterozigoti nelle varie etnie

14 coppia con familiarità per anomalie cromosomiche è indicazione allesecuzione di un cariotipo fetale e lestensione dellindagine ai parenti traslocazioni reciproche autosomiche – –maggiori sono le dimensioni cromosomiche minore è la possibilità di una gravidanza a termine traslocazioni X-autosoma – –maschi sterili, rischio 20-40% traslocazioni robertsoniane – –non 21 60% cariotipo bilanciato – –21 15% rischio di Down inversioni – –pericentriche varianti dell1, 9, 16 e Y, in altri casi il rischio è 5-10% – –paracentriche, rischi inferiore allo 0.5%

15 Traslocazionireciproca Robertsoniana La traslocazione Robertsoniana avviene tra due cromosomi acrocentrici. Questi cromosomi ( 13, 14, 15, 21 e 22 ) hanno solo il braccio lungo (q) che contiene geni, mentre il telomero è posizionato allestremità del cromosoma.

16 inversioniParacentrica, braccio corto Paracentrica, braccio lungo Pericentrica

17 Un precedente figlio con anomalie cromosomiche Aumenta il rischio in caso di: tutte le trisomie non mosaico 47, XXY (s. Klinefelter) riarrangiamenti strutturali marker cromosomi

18 Le alterazioni cromosomiche sono più frequenti al crescere delletà materna, mentre le mutazioni puntiformi sono legate al numero di divisioni cellulari che avvengono circa ogni 15 gg nella linea germinale maschile

19 Tritest interpretazione dei risultati Tritest interpretazione dei risultati anomaliafetaleAFPhCGuE difetti del tubo neurale* NormalNormal Trisomia21 Trisomia18 * NTD: anencefalia, spina bifida and encefalocele.

20 Patologia fetale Sensibilità NTD - AFP solo 75-80% spina bifida 95% anencefalia Trisomia 21 - Tritest 70% sindrome di Down Trisomia 18 - Tritest 80% sindrome di Edward

21 Anomalie ecografiche maggiori

22 ecografia segni minori segni minori

23 Frequenza di anomalie cromosomiche negli aborti spontanei (39.8%-40.9%) trisomie autosomiche 49-52% trisomie autosomiche 49-52% Turner (45, X) 15-19% Turner (45, X) 15-19% triploidia (69) 15-16% triploidia (69) 15-16% tetraploidia (92) 5-6% tetraploidia (92) 5-6% altre anomalie 6-14% altre anomalie 6-14%

24 Trisomia 21 Il 70% delle gravidanze non giunge a termine

25 Trisomia 21, sindrome di Down in Italia casi Ipotiroidismo, ipotonia iperlassità articolare viso tondo e mento piccolo ipotelorismo (ridotta distanza tra gli occhi) macroglossia (lingua grande e protrudente) Brachidattilia (dita corte) solco palmare trasverso cardiopatie congenite leucemia ritardo mentale Morbo di Alzheimer Occhi inclinati verso lalto

26 S. Klinefelter (47,XXY) 1:900 maschi Il 50% delle gravidanze giunge a termine Il 50% delle gravidanze giunge a termine Fenotipo maschile Fenotipo maschile Caratteristiche principali: Caratteristiche principali: –Statura alta –Ipogonadismo, bassi livelli di testosterone, mancata produzione di spermatozoi (azoospermia) e quindi sterilità –Ginecomastia –Sia lintelligenza sia lattesa di vita sono quasi normali

27 Un precedente figlio con anomalie cromosomiche NON aumenta il rischio in caso di: 47, XYY (47 cromosomi, doppia Y) Triploidia (69 cromosomi) Tetraploidia (96 cromosomi) sindrome di Turner (45 cromosomi, monosomia del crom. X)

28 Monosomia X (45,X0) 1:2.500 Solo l1% delle gravidanze giunge a termine Solo l1% delle gravidanze giunge a termine Errore nella spermatogenesi nell 80% dei casi e non correla con letà dei genitori Errore nella spermatogenesi nell 80% dei casi e non correla con letà dei genitori Caratteristiche principali: Caratteristiche principali: –linfedema periferico –pterigio del collo (collo corto a tenda) –bassa statura –amenorrea primaria –talvolta sono presenti anche cardiopatia, ipertensione e anomalie renali. –Sia lintelligenza sia lattesa di vita sono normali

29 TRIPLOIDIA Frequenza alla nascita = 1/ Frequenza negli aborti = 1/14 Cariotipo 69,XXY 57% Cariotipo 69,XXX 40% Cariotipo 69,XYY 3%

30

31 Tipo I, corredo sovrannumerario paterno Feto microcefalico o normale Placenta ingrossata Tipo II, corredo sovrannumerario materno Ritardo di crescita Feto con macrocefalia relativa Placenta poco sviluppata Nati vivi Basso peso Asimmetria cranio-facciale e difetti di ossificazione del cranio Microftalmia, ipertelorismo, micrognazia Sindattilia cutanea, piedi torti Anomalie genitali, ipoplasia delle surrenali Cardiopatie

32

33 feto con anomalia cromosomica (mosaicismo) trisomie a mosaico 8, 9, 13, 18, 21 trisomie a mosaico 8, 9, 13, 18, 21 crescita in coltura di cellule materne crescita in coltura di cellule materne mosaicismo vero (livello III) mosaicismo vero (livello III) pseudomosaicismo (livelli II e I) pseudomosaicismo (livelli II e I)

34 La FISH è una tecnica che permette il riconoscimento delle sequenze geniche direttamente sui cromosomi. Si rende fluorescente un frammento di DNA e lo si fa ibridare con la sequenza complementare in situ.

35 Sonde FISH centromero subtelomero intero cromosoma locus

36 PAINTING: ogni cromosoma risulta colorato in fluorescenza in modo distinguibile dagli altri. I colori sono poi modificati e resi più evidenti al computer

37 Nuove possibilità diagnostiche prenatali non invasive Cellule fetali nel sangue materno Cellule fetali nel sangue materno –Le cellule fetali possono attraversare la placenta e circolare nel sangue di una donna gravida –In circolo è presente una cellula fetale nucleata (eritrociti nucleati) per di cellule materne –Queste cellule possono persistere per anni dopo il parto DNA fetale nel plasma materno DNA fetale nel plasma materno –Nel plasma sono presenti DNA e RNA liberi di origine fetale –La rilevazione è più semplice rispetto alle cellule fetali ed è stata utilizzata per la diagnosi di malattie genetiche di origine paterna –Il DNA fetale è distinguibile da quello materno perché meno metilato –Livelli aumentati di DNA fetale sono trovati nella trisomia 21 –Il DNA fetale sparisce pochi minuti dopo la nascita


Scaricare ppt "Lezione 1 Cromosomopatie: incidenza e rischio riproduttivo lezione 1 Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda."

Presentazioni simili


Annunci Google