La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Cromosomopatie: incidenza e rischio riproduttivo Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli.

Copie: 1
Cromosomopatie: incidenza e rischio riproduttivo Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli.

Presentazioni simili


Presentazione sul tema: "Cromosomopatie: incidenza e rischio riproduttivo Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli."— Transcript della presentazione:

1 Cromosomopatie: incidenza e rischio riproduttivo Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine, Napoli

2 Difetto congenito una qualsiasi anomalia insorta tra il concepimento e la nascita genetico (ereditario e non ereditario) – –cromosomico – –genico non genetico

3 Rischio riproduttivo generale per una coppia per cui lanamnesi personale e familiare abbiano escluso un incremento del rischio rispetto alla popolazione è 3-5% in caso di difetti congeniti rilevabili alla nascita (a. crom 0.65%) 8-10% rilevabili entro i 10 anni di età

4

5 Variazioni genetiche CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC

6

7 Valutazione del rischio riproduttivo nel periodo preconcezionale momento ottimale (ma oltre la metà delle gestazioni insorge inaspettatamente) raccolta dei dati (visita, abitudini, terapie, accertamenti lab) SCOPO: identificazione dei portatori sani di malattie genetiche – –portatori che hanno un rischio riproduttivo a prescindere dal partner – –portatori in cui il rischio si manifesta solo nel caso di unione con un partner portatore

8 portatori che hanno un rischio riproduttivo a prescindere dal partner donne con mutazioni legate allX (esempio: Distrofia muscolare di Duchenne) donne con mutazioni legate allX (esempio: Distrofia muscolare di Duchenne)

9 portatori che hanno un rischio riproduttivo a prescindere dal partner portatori di una traslocazione cromosomica bilanciata portatori di una traslocazione cromosomica bilanciata –scambio di materiale genetico tra cromosomi non omologhi –non vi è modificazione della dose genica –frequenza 1/520 nati –fenotipicamente normale reciproca

10 Traslocazioni bilanciate (meiosi e fertilizzazione) Traslocazione bilanciata Normale Traslocazione Trisomia Segregazione alternata Segregazione adiacente 1 Segregazione adiacente 2

11 portatori che hanno un rischio riproduttivo a prescindere dal partner mutazioni dominanti ad esordio tardivo (corea di Huntington, atassie spinocerebellari) mutazioni dominanti ad esordio tardivo (corea di Huntington, atassie spinocerebellari) mutazioni dominanti a penetranza incompleta mutazioni dominanti a penetranza incompleta

12 portatori in cui il rischio si manifesta solo nel caso di unione con un altro portatore mutazioni autosomiche recessive mutazioni autosomiche recessive –con familiarità (coppia già a rischio) –senza familiarità (valutare la consanguineità)

13 ogni individuo è portatore sano di almeno 8 malattie genetiche recessive, di cui 3 letali fratelli, genitori-figli fratelli, genitori-figli fratellastri, zii-nipoti fratellastri, zii-nipoti cugini diretti (0.5%) cugini diretti (0.5%) secondi cugini secondi cugini 1/4 omozigosi 1/4 omozigosi 1/8 omozigosi 1/8 omozigosi 1/16 omozigosi 1/16 omozigosi 1/64 omozigosi 1/64 omozigosi i difetti congeniti hanno un rischio empirico raddoppiato in caso di coefficiente di consanguineità 1/16 non è utile lesame cromosomico

14 coppia con familiarità per anomalie cromosomiche è indicazione allesecuzione di un cariotipo fetale e lestensione dellindagine ai parenti traslocazioni reciproche autosomiche – –maggiori sono le dimensioni cromosomiche minore è la possibilità di una gravidanza a termine traslocazioni X-autosoma – –maschi sterili, rischio 20-40% traslocazioni robertsoniane – –non 21 60% cariotipo bilanciato – –21 15% rischio di Down inversioni – –pericentriche varianti dell1, 9, 16 e Y, in altri casi il rischio è 5-10% – –paracentriche, rischi inferiore allo 0.5%

15 Traslocazioni reciproca Robertsoniana

16 inversioniParacentrica, braccio corto Paracentrica, braccio lungo Pericentrica

17 Un precedente figlio con anomalie cromosomiche Aumenta il rischio in caso di: tutte le trisomie non mosaico 47, XXY (s. Klinefelter) riarrangiamenti strutturali marker cromosomi

18 Le alterazioni cromosomiche sono più frequenti al crescere delletà materna, mentre le mutazioni puntiformi sono legate al numero di divisioni cellulari che avvengono circa ogni 15 gg nella linea germinale maschile

19 Frequenza di anomalie cromosomiche negli aborti spontanei (39.8%-40.9%) trisomie autosomiche 49-52% trisomie autosomiche 49-52% Turner (45, X) 15-19% Turner (45, X) 15-19% triploidia (69) 15-16% triploidia (69) 15-16% tetraploidia (92) 5-6% tetraploidia (92) 5-6% altre anomalie 6-14% altre anomalie 6-14%

20 Trisomia 21 Il 70% delle gravidanze non giunge a termine


Scaricare ppt "Cromosomopatie: incidenza e rischio riproduttivo Vincenzo Nigro Laboratorio di genetica - Dipartimento di Patologia Generale, Seconda Università degli."

Presentazioni simili


Annunci Google