La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Terapia genica Inibizione mirata dellespressione genica per bloccare un processo patologico Distruzione mirata geneticamente di specifiche cellule Supplementazione:

Presentazioni simili


Presentazione sul tema: "Terapia genica Inibizione mirata dellespressione genica per bloccare un processo patologico Distruzione mirata geneticamente di specifiche cellule Supplementazione:"— Transcript della presentazione:

1 Terapia genica Inibizione mirata dellespressione genica per bloccare un processo patologico Distruzione mirata geneticamente di specifiche cellule Supplementazione: fornire una copia funzionante del gene difettoso Sostituzione: sostituire il gene mutante con una copia funzionante in situ

2

3

4

5 Supplementazione: fornire una copia funzionante del gene difettoso ex vivo: trasferire i geni clonati in cellule in coltura, selezionare le cellule, espanderle in vitro e poi immetterle nel paziente in vivo: trasferire direttamente i geni nel tessuto bersaglio o in circolo, facendo in modo che poi arrivi al tessuto bersaglio

6 ex vivo

7 Vettori non virali per la terapia genica Liposomi: vescicole sintetiche che si formano quando alcuni lipidi sono in soluzione acquosa. Possono essere anionici e circondano il DNA o cationici e legano il DNA allesterno iniezione diretta di plasmidi o bombardamento del tessuto del DNA attaccato a pellets di metallo (biolistico). Il trasferimento è molto basso e il DNA non è integrato.

8 Liposomi

9 Virus per la terapia genica Retrovirus: sono ad RNA e sintetizzano cDNA che integrano casualmente nel genoma dellospite quando si dissolve la membrana nucleare (divisione cellulare) Adenovirus: sono a DNA e capaci di trasdurre ad alti titoli tutte le cellule, ma in forma episomale. E molto forte la reazione immunitaria. Morte di Jesse Gelsinger nel 1999 Adeno-associati (AAV) hanno DNA a singola elica e si potrebbero integrare sul cromosoma 19q13 grazie al gene rep. Ma il 96% del genoma è deleto. Possono ospitare fino a 4.5kb Lentivirus: sono retrovirus specializzati che infettano anche le cellule non in divisione. Sono più complessi dei retrovirus e sono capaci di unespressione a lungo termine.

10 Vettori virali per la terapia genica Genoma StatoCapacitàTarget AAV DnaIntegrato Episomal 4.7 kbD/ND AdenoDnaEpisomal< 36 kbD/ND RetroRnaIntegrato8 kbD LentiRnaIntegrato8 kbD/ND HSVDnaEpisomal>50kbD/ND

11 AAV2 Virus Adeno-associato Famiglia: Parvoviride Genere : Dependovirus Genoma : DNAss 4.7kb Bersaglio: Cellule in divisione e cellule non in divisione Stato : episomale/integrazione sito specifica su 19q13.3 Sierotipi : 10 AAV1-10 ITR Rep Cap ITR Rep78 Rep68 Rep52 Rep40 VP1 VP2 VP3

12 AAV RICOMBINANTI Plasmide Cis ITR TRANSGENE p5p19p40ITR REP TRANSGENE TERAPEUTICO MAX 4.5kb CAP

13 Tripla trasfezione HEK 293 cells (E1) Trans rep2 cap pro E2A E4 VAI Adeno Helper Transgene ITR2 Cis Produzione di vettori rAAV rAAV Pro pA

14 AAV2/1 (6) AAV2/2 Rep 2 Cap 2 ITR 2 AAV2/5 Rep 2 Cap 5 ITR 2 AAV2/3 Rep 2 Cap 3 ITR 2 AAV2/7 Rep 2 Cap 7 ITR 2 AAV2/4 Rep 2 Cap 4 ITR 2 AAV2/8 Rep 2 Cap 8 ITR 2 Cap 1 ITR 2 Rep 2 gene terapeutico rAAV Pseudotipizzati

15 DIFFERENZE TRA SIEROTIPI AAV 1-8 RECETTORI RECETTORI AAV2 FGFR1,EPARINA AAV2 FGFR1,EPARINA AAV4 AAV4 Ac.SIALICO Ac.SIALICO AAV5 AAV5 PDGFR, Ac.SIALICO PDGFR, Ac.SIALICO TROPISMO TROPISMO AAV1 Muscolo,retina AAV1 Muscolo,retina AAV2 Muscolo,fegato AAV2 Muscolo,fegato AAV4 Cervello AAV4 Cervello AAV5 Cervello,polm. AAV5 Cervello,polm. AAV6 Muscolo,retina AAV6 Muscolo,retina AAV7 Muscolo,fegato AAV7 Muscolo,fegato AAV8 Fegato AAV8 Fegato PROTEINE CAPSIDE ANTIGENICITA

16 Infezione di cellule in divisione e non in divisione Vantaggi Svantaggi Produzione di anticorpi anti-AAV AAV2 No risomministrazione del vettore virale Dimensioni dellinserto non superiori alle 4.5kb Non patogeni Espressione genica efficiente e a lungo termine Pochi effetti immunologici Ampia varietà di cellule ospiti

17 Analisi di linkage Vincenzo Nigro Dipartimento di Patologia Generale Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine (TIGEM)

18 trasmissione autosomica dominante AaAaaa AaAaAaAa un genitore AaAaAaAa AA AaAa AaAaaa entrambi i genitori 50% dei figli manifestano il carattere senza preferenza di sesso 75% dei figli manifestano il carattere senza preferenza di sesso A allele patologico dominante a allele normale recessivo Aa a a AA a a Genotipi: Genotipi: 1/2 Aa, 1/2 aa Fenotipi: Fenotipi: 1/2 affetti, 1/2 non affetti Genotipi: Genotipi: 1/4 AA, 1/2 Aa, 1/4 aa Fenotipi: Fenotipi: 3/4 affetti, 1/4 non affetti

19 Espressività Espressività: grado con il quale la malattia è espressa in un individuo al livello di popolazione un fenotipo presenta espressivita variabile quando allinterno dellinsieme di soggetti sicuramente portatori il fenotipo presenta gravita e/o complessita diversa anche allinterno della famiglia ci puo essere espressivita variabile importanza di un accurato esame clinico esteso ai consanguinei di un affetto, anche apparentemente sani Il tipo e la gravità delle manifestazioni cliniche non sono sempre sovrapponibili negli individui affetti dalla stessa patologia autosomica dominante

20 mutazioni eterozigoti di PAX3 Waardenburg sordità (o deficit uditivo di vario livello) bilaterale,sordità modifiche nella pigmentazione, sia dei capelli (albinismo parziale, in genere piebaldismo) che della pelle,capellipelle anomalie nello sviluppo dei tessuti derivati dalla cresta neurale lateralizzazione del canto mediale diverso colore degli occhi (eterocromia), di solito uno marrone e l'altro blueterocromia

21 SINDROME DI WAARDENBURG Sindrome completa: sordita + occhi di colore diverso + ciuffo di capelli bianchi sulla fronte + precoce incanutimento 1 sordità 2 sordità+ occhi di colore diverso 3 sordità+ occhi di colore diverso + ciuffo di capelli bianchi sulla fronte 4 ciuffo di capelli bianchi sulla fronte + precoce incanutimento Espressivita variabile

22 esordio variabile il fenotipo puo comparire in età avanzata il fenotipo non è congenito pur essendo ereditario dal punto di vista genetico raramente questi fenotipi sono dovuti a nuove mutazioni a livello di popolazione lallele mutato puo essere frequente, purché l insorgenza si verifichi dopo linizio delletà riproduttiva e non limiti la fitness (capacita di riprodursi)

23 penetranza proporzione di individui portatori del gene patologico che hanno segni clinici della malattia può dipendere: – accuratezza diagnostica (esami clinici e di laboratorio mirati - es. porfiria acuta) – età (esordio variabile - es. Corea di Huntington) – meccanismo dazione del gene (retinoblastoma, teoria dei 2 hits di Knudson)

24 tratti autosomici dominanti penetranza Penetranza 100 % Penetranza 50 %

25 Sapere che un gene puo non essere completamente penetrante, e critico per studiarne la genetica o fornire consulenza genetica: un certo soggetto che non manifesta il carattere puo essere portatore del gene. la penetranza è un concetto che si riferisce alla popolazione A livello del singolo individuo il carattere ha solo due possibilità 1. si manifesta 2. non si manifesta è presa in considerazione più frequentemente nei caratteri dominanti penetranza

26 Età di insorgenza della Corea di Huntington a)Probabilità che un individuo portatore del gene mutato abbia sviluppato i sintomi ad una data età b)Rischio che il figlio sano di un soggetto affetto sia portatore del gene mutato ad una determinata età.

27 Lespressivita e il grado di gravitacon cui fra gli individui che presentano il fenotipo questo si esprime: puo costituire un sottoinsieme degli individui penetranti La penetranza ridotta non e da confondere con lespressivita variabile Es. Neurofibromatosi: presenza di tumori lungo i nervi periferici e regioni di pigmentazione scura (macchie di caffelatte)Tutti i portatori presentano almeno uno dei segni, ma la gravita puo essere diversa anche allinterno della stessa famiglia: un genitore con macchie e piccoli tumori cutanei benigni puo avere un figlio che presenta tumori estesi e maligni. (questa differenza non e prevedibile si puo solo quantizzare il rischio di ereditare lallele non il fenotipo) Penetranza ed espressivita

28 ipotesi sul rischio di ricorrenza 1.La malattia non è genetica 2.La malattia è dovuta a nuova mutazione dominante: rischi di ricorrenza trascurabili nella prole della coppia 3.La trasmissione è autosomica recessiva: rischio di ricorrenza di 1 su 4 per la futura prole indipendentemente dal sesso 4.La malattia è legata allX recessiva e la madre può essere o meno portatrice: rischio di ricorrenza di 1 su 2 maschi se la madre è portatrice 5.La malattia è poligenica o cromosomica: rischio di ricorrenza ben definito dipendente dal tipo di malattia

29 mappaggio genico serve ad identificare la posizione cromosomica di un locus genico possono essere mappati: –marcatori genetici anonimi, quali brevi sequenze di DNA (dette STS), DNA microsatelliti, ecc. –geni –loci associati a malattie con trasmissione mendeliana –loci associati a predisposizione a malattie con trasmissione nonmendeliana

30 a cosa serve il mappaggio in genetica medica? –per identificare la localizzazione dei geni malattia –per fare diagnosi indiretta in una famiglia in cui la mutazione responsabile di una malattia genetica mendeliana non è stata ancora identificata –per identificare i geni responsabili della suscettibilità a malattie non mendeliane

31 per localizzare e identificare geni malattia Linkage mapping

32 per fare diagnosi indiretta in una famiglia in cui la mutazione responsabile di una malattia genetica mendeliana non è stata ancora identificata

33 per identificare i geni associati ad una suscettibilità a malattie non mendeliane

34 Segregazione e crossing-over un figlio riceve un cromosoma da ciascun genitore che è il prodotto finale della ricombinazione meiotica Non è possibile ricevere un cromosoma che non abbia effettuato crossing-over

35 principi generali del mappaggio si segue la segregazione della patologia nei pedigrees utilizzando marcatori genetici a posizione nota si correla la segregazione della patologia e dei marcatori in più famiglie quanto più spesso la patologia e un marcatore co-segregano tanto più sono vicini * * * * * *

36 cè bisogno di famiglie abbastanza grandi in cui si osserva la trasmissione della patologia

37 i membri della famiglia devono essere genotipizzati usando marcatori polimorfici marcatori polimorfici sono noti per ogni cromosoma e di ciascuno si conosce esattamente la posizione cromosomica i marcatori più informativi sono quelli che presentano un elevato grado di eterozigosità, perché questo consente di distinguere lallele paterno dallallele materno La nomenclatura D20S906 indica che un marcatore di DNA è singolo nel genoma ed è localizzato sul cromosoma 20; purtroppo il numero 906 non ha alcun rapporto con la posizione

38 Marcatori polimorfici A partire dagli anni 80 RFLP: restriction fragment length polymorphisms Nella accezione attuale, il DNA purificato è amplificato con la PCR. Il prodotto della PCR è quindi tagliato in frammenti di restrizione mediante enzimi di restrizione detti endonucleasi, che attuano il taglio unicamente in corrispondenza di particolari sequenze nucleotidiche, specifiche per ogni enzima. I frammenti di restrizione sono separati per lunghezza mediante elettroforesi su gel d'agarosio

39 RFLP lenzima di restrizione SmaI taglia lesanucleotide CCCGGG. La sequenza CCGGGG rende non digeribile il DNA in quella posizione

40 STR A partire dal 1990 STR: short-tandem repeats or microsatellites –e.g. (CA n ) –gttatcttagggctcagtcacacacacacacacacacacatccaggtattggatcaac Quello che varia tra gli alleli è il numero di ripetizioni dellelemento. E molto più frequente riscontrare individui eterozigoti, con un numero di ripetizioni differente nei due alleli

41 SNPs single nucleotide polymorphisms Variazioni puntiformi della sequenza tra due copie del genomaVariazioni puntiformi della sequenza tra due copie del genoma Per un SNP un individuo può esserePer un SNP un individuo può essere –Omozigote T/T o C/C –Eterozigote T/C

42 ACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATA GCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTC CGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGC TAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGC GACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGAT ATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGAACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGC TCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGAC GTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGC GCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGA CCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGG CTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCC TGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCG ATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCAC ACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATAT ATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCT CGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGA GACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATAT AGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACA CCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCG AGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATA TAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTC GAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGT AGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGA CGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAG CGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAG ACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGG GCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCC CTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCG CTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCT AGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTC GCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACC GCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTC GAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGA AACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGAC CTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAG ACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATA GCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACA CGTGCTAGCTAGCTCCTCTCGAGACGTTATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGAC ACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCG AGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGC ACACCGCTCGAGATAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCT CGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGC TCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCT GAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGC TAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCCTCGCGACACACACAGATATATAGCGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACAC GTGCTAGCTAGCTCCTCTCGACGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACAC AGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTA GCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACA CACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCG CACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCT CTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGATATATAGCGCTCCCTGAAACAGCTCCGACACAGCTCGCACACCGCTCGAGACCTGACCTGACACGTGCTAGCTAGCTCCTCTCGAGACGTAGGGCTCTCGATATAGCTCGCGACACACACAGA Variazioni della sequenza del DNA

43 SNPs nel genoma umano DB SNP built 128 (23 Oct 2007) Totale Totale codificanti Codificanti sinonimi Codificanti nonsinonimi

44 Aploblocchi sul sito

45 Diploid gamete precursor cell () Haploid gamete precursors Hap. gametes NR R R A - B - - A - B A - B - - A - B A - B - - A - B A - B - - A - B A - B - A - B - - A - B - A - B DNA recombination Meiosis 2 (22 + 1) chr1

46 ricombinanti R e non ricombinanti NR il 50% deve essere R e il 50% NR se i loci sono posti su cromosomi differenti, mentre i NR sono >50% se i loci sono sintenici.

47 Lanalisi della frazione di ricombinazione è alla base del mappaggio la frazione di ricombinazione tra due loci,, è compresa tra 0 e 0.5 Il valore di non può mai essere maggiore di 0.5, il che indica che i loci sono posizionati molto lontani o su cromosomi differenti se è significativamente minore di 0.5 i loci sono linked più piccolo è più vicini sono i loci

48

49 lunità di misura della distanza genetica è il centiMorgan cM La distanza genetica tra due loci è il numero atteso di crossovers per meiosi l le distanze piccole sono accurate mentre le grandi sono sottostimate perché un doppio crossover può far pensare a un non ricombinante l per valutare distanze grandi occorre sommare distanze piccole l per q <10% la correlazione tra q e cM è 1:1 l mediamente 1 cM corrisponde a circa bp, ma tale valore è inversamente proporzionale alla frequenza di ricombinazione

50 Le meiosi si visualizzano con MLH1 che è parte del macchinario di ricombinazione Nella meiosi maschile che avviene nei testicoli ci sono circa 51 chiasmi e quindi considerando 50cM per chiasma, il genoma è di 2550 cM Nella meiosi femminile che è più difficile da studiare perché avviene a settimane di vita fetale ci sono almeno 70 chiasmi (3500 cM), ma si stimano 4280cM Dal momento che la frequenza di ricombinazione è differente si usa un valore medio tra i due sessi

51 Il mappaggio per linkage è basato sullanalisi della ricombinazione d D d d = affetto = non affetto D = allele patologico d = allele wild-type Locus malattia Marker

52 d D d d Doppio eterozigote 1° obiettivo - stabilire la fase

53 d D d d NR NR NR NR NR R recombinanti = 1/5 2° obiettivo – contare i ricombinanti

54 lod-score Il lod-score misura le probabilità a favore del linkage Compara la probabilità ad un certo valore di e la probabilità nel caso non vi sia alcun linkage e quindi che sia uguale a 0.5 LOD = log of the oddsZ( ) = log 10 [L( )/L(0.5)]

55 d D d d NR NR NR NR NR R Z = log 10 R ( 1- ) NR 0.5 (R+NR) LOD SCORE (LOD) = log 10 ( 1- ) ° obiettivo – calcolare il LOD score

56 Il metodo La probabilità L( ) è calcolata per i differenti valori di tra 0 e 0.5 Un rapporto tra le probabilità è calcolato LR( ) = L( )/L(0.50) Il lod-score è il logaritmo in base 10 (log10) del rapporto tra le probabilità Z( ) = log10[L( )/L(0.50)] La migliore stima della frazione di ricombinazione è il valore di a cui Z( ) è massimo (MLS)

57 Per le patologie a trasmissione mendeliana Z( ) >> 3 si accetta il linkage per un carattere autosomico Z( ) >>2 si accetta il linkage per un carattere X-linked Z( ) < -2 si respinge definitivamente lipotesi di linkage per un particolare valore di Z( ) > -2 ma < 3 occorrono ulteriori studi

58 linked, no recombination

59 Link utile


Scaricare ppt "Terapia genica Inibizione mirata dellespressione genica per bloccare un processo patologico Distruzione mirata geneticamente di specifiche cellule Supplementazione:"

Presentazioni simili


Annunci Google