La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,

Presentazioni simili

Presentazione sul tema: "Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,"— Transcript della presentazione:

1 Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence, chemistry and biochemistry to solve biological problems usually on the molecular level

2 I Computers nella scienza ComunicazioneInformazioneCalcolo

3 Banche dati Sequenze: (proteine, geni, reg. regolative, rna - 100 miliardi di basi 100 milioni di sequenze 100 mila organismi Testi: letteratura scientifica 15 milioni di articoli 5 mila riviste Altre: strutture, enzimi, malattie, promotori etc..

4 Analisi di sequenze Sequenze: (proteine, geni, reg. regolative, rna) 1 sequenza nel 1977 nel 1983 2000 in banca dati strumenti e metodi per l'analisi delle sequenze sono alla base di quasi tutta la bioinformatica

5 Annotazione funzionale Ricerche in banche dati Motivi funzionali

6 Analisi filogenetiche Ricostruire la storia evolutiva di geni e organismi

7 Bioinformatica strutturale Visualizzazione Classificazione e funzione

8 Predire la struttura Trovare la struttura 3D di una proteina a partire dalla sua sequenza

9 Simulazioni Drug design Protein design Docking

10 Genomica acaccacacc cacaccacac ccacacccac acaccacacc cacacacaca cacacaccac acccacacac acccacacac cacaccacac ccacacacca cccacacaca cacaacacta ccctaatcta accctgtcca acctgtctcc aaacttaccc tccattacct tacctccccactcgttaccc tgccccattt aaccatacca cagcgaacca cgatccacat ctctacttcc taccaccaac ccaccgtcca ccataaccgt taccctccaa ctacccatat cctactccac tgccacttac cctgccattc ctctaccatc catcatctgg tactcactat actgttgttc tacccaccat attgaaacgc taacaaatga tcgtaaataa tacacatata cttaccctaccactccaatc ccaccaccac atgccatact caccttcact tgtatattga tatgccatac gcccacggat gctatagtat ataccatctc aaacttaccc tactttcaca ttccactcca tggcccatct ctcactaaat cagtaaatat gcacccacat cattatgcac ggcgcttgcc tcagcggtct ataccctttg ccatttaccc ataaattcca tgattatcta cattttaata tctatatctc atttggcggc ccaaaatatt gtataactgc ccttaataca tacgttatac tattttacac cgtatactaa ccactcaatt tatatacact tatgtcaatg t Genomi al 4-2006FinitiIncompletiIn corsoTotale Procarioti330238342910 Funghi9332062 Altri eucarioti1141110162 Totale3503124721134

11 Assemblaggio Ricostruire un genoma da milioni di sequenze di DNA

12 Annotazione genomica Cercare geni e promotori allinterno di un genoma

13 10 Kb 200 bp 1 Mb 200 Mb Browser genomici

14 Genomica Comparata

15 altri "...omi" Proteoma Trascrittoma Interattoma Metaboloma Nuove tecnologie + dati - qualità

16 Analisi dei microarrays Classificare i geni a seconda di quando e dove sono trascritti in RNA

17 Systems biology Studio dei processi biologici (spesso a livello cellulare e molecolare) considerati come sistemi composti da molte parti interagenti Raccolta dati Modello matematico Simulazione e previsione Verifica

18 Reti di interazioni

19 Reti metaboliche


21 Simulazioni

22 in vivo in vitro in silicio Cellule virtuali

23 Analisi di testi Cercare di estrarre in modo automatico informazione scientifica dalla letteratura

24 Analisi di testi

25 Ontologie Classificare e ordinare la conoscenza biologica

Scaricare ppt "Bioinformatics Da wikipedia: Involve the use of techniques including: applied mathematics, informatics, statistics, computer science, artificial intelligence,"

Presentazioni simili

Annunci Google