La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Genomica e Bioinformatica - Sequenziamento genomi: Sequenziamento e assemblaggio - Annotazione genomi: Ricerca geni, promotori e altro - Banche dati genomiche.

Presentazioni simili

Presentazione sul tema: "Genomica e Bioinformatica - Sequenziamento genomi: Sequenziamento e assemblaggio - Annotazione genomi: Ricerca geni, promotori e altro - Banche dati genomiche."— Transcript della presentazione:

1 Genomica e Bioinformatica - Sequenziamento genomi: Sequenziamento e assemblaggio - Annotazione genomi: Ricerca geni, promotori e altro - Banche dati genomiche e browsers - Confronti fra genomi - Variabilità genomica: banche dati mutazioni e SNP

2 Progetti di sequenziamento

3 Banche dati genomiche Cromosoma n ATCTACACTACTCTCTGGGGCTACA..........GCGTACTAGTTAGCTAGCTGATCGA | | | | | 1 10 20 143.456.710 143.456.720 TipoIdCromo soma InizioFineFilamento GeneAGS_23GHI1001253410018434I GeneFHD_34GHIV1010346610112347II PromotoreHHTRE_EEII2342393323424233I SNPA/GIX34234723-I EsoneGFDDD_22II267567545267568667II Annotazioni

4 Visualizzazione annotazioni 10x

5 10 Kb 200 bp 1 Mb 200 Mb Browser genomici

6 Individuazione geni Metodi sperimentali Metodi bioinformatici Metodi Estrinseci Metodi Intrinseci Confronto più genomi

7 ATGCTACTACGGATAGTATAGATGA 53 Promoter Start codon Struttura di un gene Stop codon Procarioti Eucarioti gene medio 30K = 5' UTR 750 bp + 6 esoni 150 bp + 5 introni 5000 bp + 3' UTR 450 bp

8 Metodi estrinseci Uniprot Allineamento Trascritti cDNA, EST 3' UTR 5' UTR Genoma Proteina EST 3' UTR cDNA 3' UTR 5' UTR Proteina Omologa 3' UTR 5' UTR Altro Genoma no 5', 3' e promotori mancano esoni, diff.giunzioni no promotori manca regione 5'

9 Annotazione geni

10 Schemi di lettura 1' 2' 3' senso antisenso 6' 5' 4'

11 Schemi di lettura aperti ATG TAA, TGA o TAG ORF

12 Composizione di un genoma ProcariotiEucarioti Dimensioni max10M10G % Codificante85%1-3% Geni con introni-95% Numero introni-0-80 Lunghezza introni-3-100.00bp Predizione99%50%

13 Metodi intrinseci - Individuazione di contenuto - Individuazione di segnali

14 Contenuto regioni codificanti Batterio shewanella - Frequenze aminoacidiche - Frequenze dipeptidi - Preferenze per codoni diversi - Preferenza per G e C terminali in eucarioti superiori - Terza base tende ad essere la stessa

15 Frequenze esanucleotidi Intero Genoma Ricerca Esanucleotide AAATGA Sequenze codificanti Sequenze non Codificanti 1.01 Gb 10 Mb 1 Gb 10.000 Copie 500.000 Copie Frequenza AAATGA = Copie/Totale Nucleotidi fC 0.1% fN 0.05% Punteggio AAATGA = log (fC/fN) = Frequenza Non Codificanti +0.3 Frequenza Codificanti


17 Ricerca regioni codificanti +5 +4 +3 +2 +1 0 -2 -3 -4 -5 Posizione nella sequenza Punteggio della posizione Regione non codificante Regione codificante Regione non codificante ? ? Regioni a punteggio non significativo Dove inizia e dove termina la regione codificante? ATGTAGATCTAAATGACTCTCTGGGACTAGTTAGCTAGCTGATCGAATGATGTCTCGT

18 Esone Introne Esone --gaggcatcag|GTttgtagac-----A-----tgtgtttcAG|tgcacccact-- --ccgccgctga|GTgagccgtg-----A-----tctattctAG|gacgcgcggg-- --tgtgaattag|GTaagaggtt-----A-----atatctacAG|atggagatca-- --ccatgaggag|GTgagtgcca-----A-----ttatttgcAG|gtatgagacg-- Sito donatore di splicing Sito accettore di splicing Sito di ramificazione 99% Siti di splicing

19 Segnali + contenuto Introne Esone Introne Fine esone Inizio esone Regione non codificante Regione codificante Regione non codificante

20 Frame di lettura e esoni Fine esone 1...-ACT-TAA-ATG-ACT-CTGTGGGGATCGATCGAGCTAGA-ATA-GCT-GCT-GAT-... Introne Inizio esone 2...-ACT-TAA-ATG-ACT-CTA-ATA-GCT-GCT-GAT-... Splicing Rna Maturo...-ACT-TAA-ATG-ACT-CTGTGGGGATCGATCGAGCTAGAC-ATA-GCT-GCT-GAT-......-ACT-TAA-ATG-ACT-CTAC-ATA-GCT-GCT-GAT-... Giunzione scorretta Esone falso...-AGA-ACT-CTGTC..CCAGAC-ATA-...-GCG-GAGTG....CTAGA-ATA-CTG-... Esone 1 Introne 1 Esone 2 Introne 2 Esone 3...-AGA-ACT-CTA-ATA-CTG-... Rna Maturo Frame shift

21 Costruzione modello gene





26 Difficoltà - Numero di esoni: Distrofina 79 in 2.3 Mb - Lunghezza introni: Distrofina più di 100Kb più del 99% del gene - Esoni corti: Solo 3bp in Arabidopsis. - Vicini a estremità: 1bp dall'inizio codoni start e stop interrotti - Geni sovrapposti: in 3'-UTR, ma anche in introni. - mRna policistronici anche in Eucarioti. - Introni in regioni non codificanti 5' e 3' UTR - Splicing alternativo 35-60% geni umani ha più di un prodotto - Siti splicing non canonici - Siti multipli inizio trascrizione - Siti alternativi inizio traduzione ACG Arabidopsis, CUG uomo

27 Prestazioni attuali Previsione +ricerca mirata sta diventando alternativa a sequenziamento cloni cDNA random. M R = Esoni Reali S CC C P = Esoni Predetti Sensitività= C/R78 % Selettività= C/P81 % Mancati= M/R9% Sbagliati= S/P5% Esoni Mancati Esoni Sbagliati Esoni Corretti Intero gene: Arabidopsis 50%-66% Mammiferi 15-20%

28 Allineamenti di 2 genomi Uomo-topo 40% conservato solo 2% codificante

29 Allineamento con un genoma annotato

30 Allineamenti di due genomi non annotati - Distinzione coding/ non-coding Rapporto mut. sinonime e non sinonime Indels con cambio di frame O indels che recuperano il frame perso Introne Esone Introne

31 Allineamenti multipli

32 Ricerca promotori - Analisi del contenuto - Analisi dei segnali - Allineamento di più genomi

33 Analisi del Contenuto - Isole CpG 300-3000bp : (70% p. umani ne contiene) - Previsioni di ripiegabilità, stabilità e curvatura del DNA - Diverse fequenze di parole nucleotidiche

34 Analisi dei Segnali - TATA box a -30 dal TSS - Banche dati promotori eucariotici - Overpredizione di 1000 volte dei TFBS

35 Allineamento di genomi Allineamento geni ortologhi (no paraloghi)

Scaricare ppt "Genomica e Bioinformatica - Sequenziamento genomi: Sequenziamento e assemblaggio - Annotazione genomi: Ricerca geni, promotori e altro - Banche dati genomiche."

Presentazioni simili

Annunci Google