La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Corso di Biologia e Genetica dal 12-10-09 al 28-10-09 Prof. Elena Rossi Libro di testo: Fondamenti di Biologia Solomon Berg Martin Appunti; CD delle lezioni.

Presentazioni simili

Presentazione sul tema: "Corso di Biologia e Genetica dal 12-10-09 al 28-10-09 Prof. Elena Rossi Libro di testo: Fondamenti di Biologia Solomon Berg Martin Appunti; CD delle lezioni."— Transcript della presentazione:

1 Corso di Biologia e Genetica dal 12-10-09 al 28-10-09 Prof. Elena Rossi Libro di testo: Fondamenti di Biologia Solomon Berg Martin Appunti; CD delle lezioni

2 Biologia Studia gli organismi viventi e i loro rapporti con l’ambiente che li circonda

3 La Cellula…… …..e’ l’unita’ fondamentale degli organismi viventi

4 La teoria cellulare e’ uno dei concetti fondamentali della biologia ed afferma che: Tutte le forme di vita sono costituite da una o piu’ cellule · Le cellule derivano solo da cellule preesistenti · La cellula e’ la piu’ piccola forma di vita

5 Tutta la vita cellulare ha le seguenti caratteristiche in comune.  tutte le cellule hanno una membrana cellulare che separa il caos fuori da una cellula da un alto grado di organizzazione all’interno di essa.  tutta la vita cellulare contiene DNA come materiale genetico. Tutte le cellule contengono alcune varietà di molecole di RNA e proteine, molte delle quali sono enzimi.  tutte le cellule sono composte della stessa chimica di base: carboidrati, proteine, acidi nucleici, minerali, grassi e vitamine.

6  Tutte le cellule regolano il flusso di nutrienti e cataboliti che entrano e lasciano la cellula.  Tutte le cellule si riproducono e sono il risultato della riproduzione.  Tutte le cellule richiedono un supplemento di energia.  Tutte le cellule sono altamente regolate da un elaborato sistema sensoriale che le consente di essere consapevoli di ogni reazione che avviene all’interno di esse e attorno ad esse; queste informazioni sono continuamente processate per risponderne metabolicamente.


8 Le cellule sono tutte uguali???


10 ????????

11 H 2 O, ioni, piccole molecole 77% Macromolecole 23%


13 H2OH2O Legame covalente 70% della cellula

14 Legame covalente Il legame covalente comporta la condivisione degli elettroni tra gli atomi Legame covalente polare Legame covalente puro

15 Legame idrogeno Nell’acqua l'atomo d'idrogeno (fortemente polarizzato positivamente) è attratto dall'ossigeno (fortemente polarizzato negativamente) della molecola adiacente. La risultante è appunto la formazione di un ponte idrogeno tra due molecole adiacenti di acqua. Si forma, in tal modo, una sorta di macromolecola formata da numerosi ponti di idrogeno. I legami idrogeno sono interazioni di natura elettrostatica che si determinano tra le opposte cariche di due molecole adiacenti.

16 6% della cellula

17 Isomeri strutturali




21 solubili in solventi apolari composti da C, H, O. Poveri di O componenti strutturali delle membrane biologiche carburanti biologici alcuni sono ormoni



24 Le cellule umani e animali partendo da sostanze semplici possono sintetizzarne solo alcuni. Quelli che invece devono essere introdotti con la dieta si chiamano aminoacidi essenziali


26 Funzioni delle proteine Enzimi La regolazione dell’espressione dei geni e’ assicurata da proteine dette fattori di trascrizione Le proteine strutturali costituiscono l’impalcatura interna delle cellule Le proteine contrattili sono responsabili della capacita’ di movimento di tutte le cellule e degli organismi pluricellulari Il trasporto di ioni e di gran parte dei composti organici attraverso le membrane biologiche e’ assicurato dalle proteine di membrana che costituiscono le pompe e i canali ionici

27 Molti ormoni e fattori di crescita sono costituiti da proteine La maggior parte dei recettori sono proteine Il trasporto negli organismi cellulari, tramite i liquidi interni all’organismo, di sostanze insolubili in acqua e’ assicurato da proteine di trasporto In alcuni casi, proteine possono costituire, per certi organismi un deposito di materia e di energia o di particolari sostanze. Si parla allora di proteine di deposito Nei vertebrati, il riconoscimento e l’inattivazione di sostanze estranee all’organismo e’ mediato da proteine che costituiscono gli anticorpi


29 Nucleo Il nucleo è delimitato da una doppia membrana, dotata di pori che consentono le comunicazioni tra il nucleo e il resto della cellula (citoplasma). All'interno del nucleo sono conservati i cromosomi, strutture filamentose composte da DNA e proteine e solitamente presenti in coppie, in un numero variabile e caratteristico di ciascuna specie. All'interno del nucleo si trova una regione specializzata, detta nucleolo, che è deputata all'assemblaggio di particelle chiamate ribosomi, che contengono RNA e proteine e che, una volta sintetizzate, migrano nel citoplasma, dove presiedono alla sintesi proteica. Il nucleo controlla la sintesi proteica inviando nel citoplasma diverse molecole con funzione di messaggeri.








37 trinucleotide nucleotide 5’ 3’ legame fosfodiesterico

38 Legame forte: nucleotidi concatenati da un legame fosfodiesterico tra il fosfato in posizione 5’ di un nucleotide e il gruppo alcolico in posizione 3’ del nucleotide adiacente Legame debole: legame idrogeno tra basi azotate


40 Timina Guanina Citosina Adenina Guanina La sequenza di un gene e’ data dalla sequenza delle 4 basi azotate all’interno della doppia elica


42 * *: seguito alla trascrizione vengono prodotti anche RNA ribosomale e RNA transfer!!!!!!!






48 Dogma centrale: DNA RNA Proteine

49 Le cellule….. ….muoiono

50 Il numero delle cellule di un determinato tessuto e’ regolato dalla proliferazione, dal differenziamento, nonche’ dall’arresto della crescita e dalla morte cellulare La cellula va incontro ad una morte cellulare programmata APOPTOSI in base alle indicazioni di suoi specifici geni

51 Apoptosi Vengono prodotti enzimi che degradano organelli e macromolecole. La membrana plasmatica rimane temporaneamente integra ed espone segnali molecolari che inducono cellule specializzate ( macrofagi) a fagocitare la cellula apoptotica. E’ un processo che richiede energia Necrosi Processo che avviene senza la partecipazione “attiva” della cellula generalmente come conseguenza di un danno. Non richiede energia. La cellula si rigonfia, vengono distrutti tutti gli organelli, primi tra tutti i mitocondri, e il materiale cellulare viene espulso all’esterno della cellula con conseguente infiammazione tissutale

52 Apoptosi e Necrosi

53 Quali cellule vanno incontro ad apoptosi? - In generale : l'apoptosi ha anche una funzione di equilibrio sul numero delle cellule presenti, controbilanciando la proliferazione cellulare Nel corso dello sviluppo embrionale: le cellule di strutture temporanee. Nel sistema immunitario: gli elementi anomali che potrebbero aggredire l'organismo anziché gli elementi estranei ad esso. In numerosi tessuti: le cellule che hanno esaurito il loro ruolo o con DNA danneggiato.

54 L’apoptosi puo’ diventare un fenomeno anomalo per eccesso o per difetto: -Conoscere i meccanismi dell'apoptosi è un obiettivo importante della ricerca biomedica, poiché nuove scoperte in proposito potrebbero permettere di bloccare, ad esempio, la proliferazione di forme tumorali o di altre malattie degenerative -in certe malattie degenerative, come la sclerosi multipla, le cellule vanno incontro a morte troppo rapidamente. - in certe forme tumorali, come le leucemie, viene a mancare il controllo sulla proliferazione cellulare di un certo tessuto.

55 Genetica La Genetica (dal greco gennao γεννάω = dare vita, generare) e’ la scienza che studia i geni, l’ereditarieta’ e la variabilita’ genetica degli organismi

56 Che cos’è la genetica medica? Analizza le applicazioni della genetica nella pratica clinica riguardando un gran numero di malattie sia quelle di interesse pediatrico sia quelle dell’adulto Il principale impatto della Genetica medica sulla salute umana riguarda il controllo delle malattie attraverso la diagnosi e la prevenzione

57 In che cosa consiste la ricerca genetica oggi? La ricerca genetica degli ultimi vent’anni ha portato a identificare con successo un certo numero di geni che, quando mutati, sono la causa di malattie ereditarie rare (come la fibrosi cistica, diverse forme di distrofia muscolare,etc….). Un progresso simile non è stato ancora raggiunto per malattie genetiche molto comuni e ad alta frequenza nella popolazione, dette malattie genetiche complesse (diabete, ipertensione,malattie cardiovascolari, ecc.). Questa complessità è dovuta al fatto che esse sono causate non da mutazioni in un singolo gene ma in più geni e dalla loro interazione con l’ambiente (ad esempio la dieta e lo stile di vita per le malattie cardiovascolari).

58 Sequenziamento del Genoma Umano: primo passo per identificare la componente genetica di malattie come diabete, cancro, coronaropatie, ipercolesterolemia 1986 Il premio Nobel Renato Dulbecco e Leroy Hood lanciano l'idea di sequenziare l'intero genoma Umano.

59 La disponibilità della sequenza rende più semplice l’identificazione dei geni responsabili delle malattie mendeliane Sequenza completa di tutti i geni Possibilità di determinare la struttura esoni- introni Mappare i geni e le altre sequenze Rivelare le regioni di controllo non codificanti Identificare polimorfismi Scoprire l’inatteso Perchè? Progetto Genoma Umano

60 1953 James Watson e Francis Crick determinano la struttura del DNA (La doppia elica) 1977 Gli scienziati americani Allan Maxam and Walter Gilbert e l'inglese Frederick Sanger mettono a punto 2 diversi metodi per sequenziare il DNA, cioè per "leggere" la successione di basi nucleotidiche che lo compongono. Il metodo di Sanger, oggi automatizzato, è quello tuttora utilizzato. 1985 Lo scienziato americano Kary Mullis inventa la PCR, una tecnica che permette di moltiplicare artificialmente il DNA, anche se presente in quantità minima. 1986 Il premio Nobel Renato Dulbecco e Leroy Hood lanciano l'idea di sequenziare l'intero genoma Umano. 1990 Negli Stati Uniti nasce ufficialmente lo Human Genome Project (HGP), sotto la guida di James Watson. Negli anni successivi Regno Unito, Giappone, Francia, Germania, Cina si uniscono al progetto formando un consorzio pubblico internazionale. In Italia il progetto genoma nasce nel 1987 ma si interrompe nel 1995. 1992 Craig Venter lascia l'NIH e il progetto pubblico. Fonderà una compagnia privata, la Celera Genomics, portando avanti un progetto genoma parallelo. 1993 Francis Collins e John Sulston diventano direttori rispettivamente del National Human Genome Research Center negli USA e del Sanger Center in Inghilterra, i 2 principali centri coinvolti nel HGP. LE TAPPE DEL PROGETTO GENOMA

61 Craig VenterFrancis Collins National Human Genome Research Center Celera Genomics

62 1999 (Dicembre) Pubblicata su Nature la sequenza completa del cromosoma 22. 2000 (Maggio) pubblicata su Nature la sequenza completa del cromosoma 21. 2000 (Giugno) Francis Collins e Craig Venter annunciano congiuntamente di aver completato la "bozza" del genoma Umano. 2001 La bozza completa del genoma umano (che gli inglesi chiamano working draft) è pubblicata su Nature (quella del consorzio pubblico) e su Science (quella della Celera). 2000-2001 Il Genoma Umano completamente sequenziato e assemblato

63 Nella fase immediatamente successiva si tratterà di cercare di sapere la funzione del maggior numero possibile dei nostri geni. Averli individuati tutti e conoscere la funzione di alcuni di essi non è chiaramente sufficiente a soddisfare la nostra curiosità e a venire incontro alle nostre aspettative per quanto riguarda le applicazioni alla nostra salute. Va detto subito che questa fase sarà molto più lunga di quella che si sta per concludere e richiederà decenni, se non secoli. Il guadagno dovrebbe essere però straordinario soprattutto dal punto di vista conoscitivo. Sapremo che cosa fanno i geni di cui conosciamo qualcosa, cosa fanno qu elli che conosciamo appena e cosa fanno anche quelli che non conosciamo e che non immaginiamo nemmeno che possano esistere. venerdi, 07 aprile 2000 BIOLOGIA Un «libro delle istruzioni» Un «libro delle istruzioni», la cura dei tumori è più vicina Boncinelli Edoardo 3/5

64 Progetto Genoma Umano I nucleotidi sono quattro e sono le molecole di base con le quali è costruito il DNA, sono indicati anche con il termine di basi e sono l'adenina (A), la timina (T), la guanosina (G), la citosina (C). Sequenziare vuol dire quindi "leggere" l'ordine in cui sono disposte lungo il DNA le basi, cioè le lettere del codice genetico. Il Progetto Genoma Umano prevede l'analisi del genoma attraverso la tecnica del sequenziamento del DNA. Il sequenziamento consiste nell'individuare e ordinare tutti i nucleotidi che costituiscono il nostro patrimonio genetico così come sono posizionati nel genoma.

65 il DNA viene frammentato in tanti piccoli frammenti isolamento di un frammento di DNA inserimento in un vettore che consente di ottenerne una quantita’ illimitata sequenziamento Approcci Il DNA analizzato dal Progetto Genoma Umano proviene da piccoli campioni di sangue o di altri tessuti, ottenuti da molti individui diversi e sani.

66 -Sequenziamento di un numero SUFFICIENTEMENTE ALTO di frammenti selezionati in maniera random

67 In questo modo ovviamente si ottengono le sequenze di frammenti di DNA di cui non si conosce l'ordine. I frammenti, essendo stati generati in maniera casuale, saranno parzialmente sovrapponibili e pertanto sarà possibile, grazie sia ad un lavoro manuale che all'ausilio dei computer, ordinare tutti i frammenti e ottenere un'unica lunga sequenza di DNA, cioè la sequenza completa del genoma umano atgcaagcctacgtcctaccgcattaacagg U65747 U85746 gcattaacaggcgattagggcatcccagctgg atgccatgcaagcctacgtcctaccgcattaacagg gcattaacaggcgattagggcatcccagctgg Assemblaggio dei CONTIGS 28643 sequenze

68 Aprile 2003: Progetto Genoma Umano completato (99% sequence; accuracy 99.9%) Sequencing Centers: China, France, Germany, Japon, UK, USA Data from Human Genome Project: free on dedicated databases Data from Celera: available for a fee Human Genome Project: sforzi economici dei governi di diversi paesi CELERA: capitali privati americani

69 Questo tipo di conoscenze permetterà di identificare le eventuali differenze genetiche tra persone affette da patologie e persone sane, e in futuro l'individuazione di queste divergenze potrebbe essere utile non solo per diagnosticare una malattia prima dell'insorgenza, e pertanto prevenirla dove possibile, ma anche per ideare strategie per curare definitivamente questi soggetti correggendo l'alterazione direttamente a livello del genoma. Il sequenziamento non ci fornisce informazioni direttamente applicabili per conoscere i meccanismi alla base dei processi fisiologici e patologici dell'uomo, ma rappresenta uno strumento grazie al quale sarà più semplice in futuro identificare il ruolo delle diverse porzioni di DNA. Quali informazioni?????

70 Il Genoma Umano in numeri 23 paia di cromosomi paia di basi 30.000-40.000 geni Non si conosce la funzione di circa la meta’ dei geni scoperti

71 Che cosa ci dicono i risultati del Progetto Genoma Umano?? Piu’ del 50% del genoma e’ costituito da sequenze ripetute con funzione sconosciuta L’organizzazione del genoma umano 1.le regioni ricche di geni sono ricche in G e C 2.le regioni povere di geni sono ricche in A e T 3.Il cromosoma 1 ha il maggior numero di geni (2968), il cro mosoma Y il minor numero (231) Meno del 2% del genoma codifica per proteine


73 Il Genoma Umano rispetto agli altri organismi Che cosa ci dicono i risultati del Progetto Genoma Umano??

74 Non si può capire come è fatto il genoma umano e come funzionano i nostri geni se non li confrontiamo con quelli dei principali organismi modello: Gli altri progetti genoma E. Coli S. Cerevisiae Drosophila Melanogaster Danio Rerio (zebrafish) Mus musculus Rattus Norvegicus Primati non umani

75 I meccanismi che controllano la riparazione del DNA, importantissimi per comprendere la biologia del cancro, sono conservati fino ai batteri.

76 I meccanismi che controllano la duplicazione del DNA e le transizioni che accompagnano il ciclo cellulare sono ben conservati fino ai lieviti.

77 I meccanismi che determinano l’impostazione del piano di sviluppo corporeo sono sorprendentemente simili negli insetti e nei mammiferi.

78 Solo il confronto con gli organismi modello (genomica comparativa) ci permetterà di conoscere cosa ci accomuna alle altre specie e le ragioni delle nostre peculiarità. Inoltre i modelli sperimentali geneticamente trattabili sono fondamentali per lo studio della funzione genica in condizioni normali e patologiche Hs ATCTACGACTTCCAAGTCATCTGTAGTCCA 1 CTCTGCGACTTCCACGTCATCTGACGTGGA 2 AACTATGAATTCCAAGTCATCTGAAATGCT 3 ATGTACCACTTCCAAGTCATCTGAAGAGCA 4 TTCATCGCCTTCCAAGTCATCTGCAGTACA 5 AGCTAAGACTTCCATGTCATCTGACGTGTA 6 ATATACCAGTTCCAAGTCATCTGAATTGCG 7 ATCCACGGCTTCCAAGTCATCTGAAGCGCA

79 Il genoma umano e quello delle scimmie antropomorfe è identico per più del 98%

80 Il gene Foxp2 svolge un ruolo essenziale nello sviluppo della comunicazione sociale. L'associazione fra Foxp2 e il linguaggio era stata identificata per la prima volta in una famiglia nella quale metà dei membri avevano gravi disturbi della lingua e della grammatica. Gli studi avevano indicato che gli individui in questione presentavano tutti una mutazione nel gene Foxp2, che si trova sul braccio lungo del cromosoma 7. From Nature Reviews Neuroscience Febbraio 2005

81 Le persone con una sola copia di questo gene funzionante hanno problemi nell'articolare il linguaggio, nel seguire le regole grammaticali e nel muovere i muscoli del viso. FOXP2 e’ un gene presente anche nei topi e negli scimpanze’, ma che ha subito una mutazione recente nell’evoluzione (circa 120- 200 mila anni fa) producendo una nuova sequenza genica che si e’ fissata nella nostra specie Grazie alle proteine prodotte dalla nuova sequenza genica, bocca e laringe si sono perfezionate tanto da permettere l´articolazione di suoni complessi


83 Sebat et al, Science 2004; Iafrate et al, NG 2004 L’analisi dell’intero genoma, eseguita in PERSONE NORMALI, ha evidenziato centinaia di regioni,lunghe almeno 100 KB, presenti in piu’ copie (duplicazioni, triplicazioni) o delete rispetto alle due copie attese, una materna e una paterna 7

84 8 In alcune regioni il nostro genoma non e’ diploide

85 duplication deletion inversion from few Kb to some Mb [genomic variants database] Iafrate, 2004; Sebat, 2004; Tuzun, 2005; Redon, 2006 Migliaia di regioni genomiche (CNVs) sono state trovate delete o duplicate in individui normali

86 Almeno il 10% del nostro genoma e’ costituito da regioni presenti in piu’ o meno copie rispetto alle due attese secondo la genetica mendeliana C. Lee, 2008

87 Il numero di copie per ogni sequenza di DNA, sia genica che extragenica, e’ diverso in diversi individui e tale variabilita’ interessa almeno il 10% del nostro genoma

88 Come conseguenza la lunghezza del DNA di due individui sani puo’ differire anche di 20 Mb R. Redon, 2006; KK Wong, 2007

89 Che tipo di geni sono contenuti all’interno delle CNV benigne??  Geni per i recettori dell’olfatto  Geni per la risposta immune Oncosoppressori  Geni per il metabolismo degli ormoni e dei farmaci  Geni per I processi digestivi (i.e. amylase genes) 1212

90  sono associate a variabilita’ fenotipica e a una maggiore suscettibilita’ alla malattia??  subiscono una pressione selettiva?? Qual’e’ il significato e la funzione di queste varianti benigne????

91 1. Selezione positiva di una CNV Gene dell’amilasi, AMY gene, codifica per l’amilasi alpha salivare una delle componenti principali della saliva Il numero di copie del gene dell’amilasi salivare (AMY1) e’ correlato positivamente con la quantita’ della proteina salivare Si possono delineare diverse situazioni

92 Diet and the evolution of human amylase gene copy number variation George H Perry, NG 2007 E’ stata dimostrata una correlazione tra numero di copie del gene AMY1 e abitudini alimentari, in particolare l’ingestione di amido Maggiore e’ il contenuto di amido nella dieta, maggiore e’ il numero di copie del gene – maggiore quantita’ di amilasi salivare facilita la digestione di amido

93 Societa’ Biaka Raccoglitori e cacciatori Popolazioni artiche essenzialmente pescatori Basso numero di copie del gene AMY1

94 cibi che contengono amido come mais, riso, grano, legumi e tapioca e patate Popolazioni asiatiche Il numero di copie del gene AMY1 e’ maggiore

95 a- individuo giapponese che ha 14 copie del gene AMY1 10 su un cromosoma 1 e 4 sull’omologo Le sonde verde e rossa coprono il gene AMY1 b- individuo di razza Biaca cn 6 copie del gene c- scimpanze’, essenzialmente fruttivori, con sole due copie George H Perry, NG 2007

96 2. Il diverso numero di copie di una determinata sequenza di DNA puo’ agire come fattore di suscettibilita’ per specifiche malattie Ad es la regione 17q12 contiene numerosi geni che codificano per delle chemochine presenti in un numero di copie diverse in diversi individui Le chemochine sono una famiglia di proteine coinvolte nella risposta immunitaria. Hanno il compito di richiamare varie popolazioni cellulari che partecipano alla risposta immune, granulociti neutrofili ed eosinofili, linfociti e monociti

97 Il gene CCL3L1 e’ il piu’ potente ligando conosciuto per un recettore CCR5 che funziona da recettore anche per il virus HIV

98 CCL3L1 i recettori delle chemochine sono coinvolti in associazione con l’antigene CD4 nell’infezione da HIV un maggior numero di chemochine puo’ bloccare il legame del virus HIV al recettore e la sua entrata nella cellula

99 Gonzalez, Science, 2005 E’ stato dimostrato che il numero di copie del gene CCL3L1 e di conseguenza la quantita’ di proteina prodotta varia moltissimo tra gli individui e tra diverse popolazioni Gli individui con un maggior numero di copie del gene sono piu’ resistenti all’infezione da HIV, mentre quelli con un numero di copie minore sono piu’ suscettibili all’infezione del virus

100 Cosa ancora non sappiamo……… Esatto numero dei geni, localizzazione e funzione Regolazione dei geni Tipi di DNA non-codificante, distribuzione, che tipo di informazione contengono e relativa funzione Struttura e funzione di molte proteine Correlazione tra variazioni di sequenza tra singoli individui con la salute e la malattia ( predizione della suscettibilita’ a specifiche malattie a secondo della variabilita’ individuale) Geni coinvolti nelle malattie complesse

101 Benefici del progetto Genoma Umano migliorare la diagnosi di malattia identificazione di predisposizione genetica a specifiche malattie creazione di farmaci sulla base di informazioni molecolari possibilita’ di terapia genica produzione di “ farmaci personalizzati” sulla base dei profili genetici individuali Medicina

102 Studi sull’evoluzione studi sull’evoluzione e sulla migrazione di popolazioni sulla base dello studio dei genomi materni e paterni Benefici del progetto Genoma Umano

103 Identificazione delle vittime di crimini o catastrofi attraverso l’analisi del DNA Identificazione di potenziali sospetti paragonandone i profili di DNA con quelli ad esempio estratti da macchie organiche, (sangue, sudore), capelli o tracce organiche riscontrate sulla scena del crimine Scagionare persone accusate erroneamente di un crimine Identificare il piu’ adatto donatore nei trapianti d’organo Benefici del progetto Genoma Umano

104 Agricoltura Creazione di piante resistenti alle malattie e agli insetti Creazione di piante piu’ nutrienti Sviluppo di biopesticidi Benefici del progetto Genoma Umano

Scaricare ppt "Corso di Biologia e Genetica dal 12-10-09 al 28-10-09 Prof. Elena Rossi Libro di testo: Fondamenti di Biologia Solomon Berg Martin Appunti; CD delle lezioni."

Presentazioni simili

Annunci Google