La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Istologia. Livelli di organizzazione della sostanza vivente Organismo Apparato Organo Tessuto Cellula Organello Molecola Atomo nello studio della vita.

Presentazioni simili


Presentazione sul tema: "Istologia. Livelli di organizzazione della sostanza vivente Organismo Apparato Organo Tessuto Cellula Organello Molecola Atomo nello studio della vita."— Transcript della presentazione:

1 istologia

2 Livelli di organizzazione della sostanza vivente Organismo Apparato Organo Tessuto Cellula Organello Molecola Atomo nello studio della vita biologica sono identificabili numerosi livelli di organizzazione; le diverse discipline biomediche si concentrano su uno o più di tali livelli

3 Citologia Istologia Anatomia Ambiti di competenza delle scienze morfologiche hai notato che i contorni di ciascuna disciplina sono sfumati? Organismo Apparato Organo Tessuto Cellula Organello Molecola Atomo

4 uninconsueta introduzione alla peculiarità dello studio dellistologia

5 Dove ci troviamo? Si osservano numerose automobili disposte in modo molto ordinato; le auto appaiono regolarmente allineate, con le fiancate in stretto rapporto con quelle delle auto vicine; la vicinanza fra le fiancate è tale da lasciare solo uno stretto passaggio per raggiungere le portiere. Nellinsieme, le auto occupano la maggior parte della superficie asfaltata.

6 Dove ci troviamo? Si osservano automobili abbastanza distanziate fra loro e disposte in modo relativamente irregolare, salvo che tutte le automobili presentano il medesimo orientamento antero-posteriore; le automobili occupano una porzione di superficie asfaltata inferiore rispetto alla scena descritta in precedenza.

7 parcheggi e autostrade è facile assegnare ciascuna di queste immagini alle situazioni appena descritte…

8 altro insieme di automobili, altro luogo anche in questo caso, la descrizione dei rapporti spaziali fra automobili consente di identificare la natura della scena

9 descrizione degli epiteli di rivestimento Gli epiteli sono tessuti caratterizzati da cellule fittamente stipate, organizzate in lamine o ammassi, separate fra loro solo da un sottile strato di fluido extracellulare scarsamente provvisto di fibre.

10 descrizione dei tessuti connettivi I tessuti connettivi sono invece caratterizzati dalla presenza di scarsi elementi cellulari, spesso isolati, immersi in una abbondante quantità di sostanza extracellulare riccamente provvista di fibre di natura proteica

11 esempio di epitelio

12 esempio di connettivo

13 epiteli & connettivi Gli epiteli sono tessuti caratterizzati da cellule fittamente stipate, organizzate in lamine o ammassi, separate fra loro solo da un sottile strato di fluido extracellulare scarsamente provvisto di fibre.Gli epiteli sono tessuti caratterizzati da cellule fittamente stipate, organizzate in lamine o ammassi, separate fra loro solo da un sottile strato di fluido extracellulare scarsamente provvisto di fibre. I tessuti connettivi sono invece caratterizzati dalla presenza di scarsi elementi cellulari, spesso isolati, immersi in una abbondante quantità di sostanza extracellulare riccamente provvista di fibre di natura proteicaI tessuti connettivi sono invece caratterizzati dalla presenza di scarsi elementi cellulari, spesso isolati, immersi in una abbondante quantità di sostanza extracellulare riccamente provvista di fibre di natura proteica

14 RER RE L Golg i nucle o citoso l

15 le relazioni spaziali fra oggetti

16 RER RE L Golg i nucle o citoso l click me

17 Una cellula tipica tutte le cellule possiedono una membrana e un corredo di organelli sostanzialmente comune a tutti i tipi cellulari

18 la fabbrichètta

19 Le macchine e la stanza di controllo

20 la stanza di controllo: i manuali e la fotocopiatrice

21 46 non tutte le pagine dei 46 manuali sono accessibili: molte sembrano essere incollate fra loro.

22 TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAAATGC TAGTCGATCTATCGATCGGCTATTCGCAAAGCTGCGCGACTG CGATGCGCTAGCATGCGATTCGCGATCGCCGAGCGCTCGCG AGCGCGCTAGCGGAATACTATATAGCGCGGATCAGTCTAGA TCTATGAGATCGATAGCGATCTAGAGATAGGATCGAGATCG AGGCGAGATCATATGAGCGCGGCTATTTAGGCTTAGAGGAT TCGGAGATTCGGAGCTTAGGATTACAGAGAGCTTCTTAGGC GCTCCCGGTATCGCTCCCATCCCATATTAAAATCTATCGATC GAGCTCTCCAATGCGATCGATAGGACTAGTAGCTAGCTAGC TGAGCATGATAGGCTCGATGAGCATGAGATGCATGTACGAC TGCATAGGCATGACTGATCGACTGCATCATGACGCATGACT GCATGCATGACTGCATATGACGGACTCGCATTAGCACTACC GTATTTGCGCATTACCAGATTAGAGAAATGCTAGTCGATCTA TCGATCGGCTATTCGCAAAGCTGCGCGACTGCGATGCGCTA GCATGCGATTCGCGATCGCCGAGCGCTCGCGAGCGCGCTA GCGGAATACTATATAGCGCGGATCAGTCTAGATCTATGAGAT CGATAGCGATCTAGAGATAGGATCGAGATCGAGGCGAGATC ATATGAGCGCGGCTATTTAGGCTTAGAGGATTCGGAGATTC GGAGCTTAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTA TCGCTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCA ATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCATGAT AGGCTCGATGAGCATGAGATGCATGTACGACTGCATAGGCA TGACTGATCGACTGCATCATGACGCATGACTGCATGCATGAC TGCATATGACGGACTCGCATTAGCACTACCGTATTTGCGCAT TACCAGATTAGAGAAATGCTAGTCGATCTATCGATCGGCTAT TCGCAAAGCTGCGCGACTGCGATGCGCTAGCATGCGATTCG CGATCGCCGAGCGCTCGCGAGCGCGCTAGCGGAATACTATA TAGCGCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCGCGG CTATTTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAGGATT ACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCATCCC ATATTAAAATCTATCGATCGAGCTCTCCAATGCGATCGATAG GACTAGTAGCTAGCTAGCTGAGCATGATAGGCTCGATGAGC ATGAGATGCATGTACGACTGCATAGGCATGACTGATCGACT GCATCATGACGCATGACTGCATGCATGACTGCATATGACGG ACTCGCA

23 spesso, pagine non incollate dei libri vengono fotocopiate; le copie escono dalla stanza di controllo attraverso una delle finestre.

24 la fotocopia viene trasferita dalla stanza di controllo al resto del capannone attraverso una delle finestre

25 TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAA ATGCTAGTCGATCTATCGATCGGCTATTCGCAAAGCT GCGCGACTGCGATGCGCTAGCATGCGATTCGCGATC GCCGAGCGCTCGCGAGCGCGCTAGCGGAATACTATA TAGCGCGGATCAGTCTAGATCTATGAGATCGATAGCG ATCTAGAGATAGGATCGAGATCGAGGCGAGATCATAT GAGCGCGGCTATTTAGGCTTAGAGGATTCGGAGATTC GGAGCTTAGGATTACAGAGAGCTTCTTAGGCGCTCCC GGTATCGCTCCCATCCCATATTAAAATCTATCGATCGA GCTCTCCAATGCGATCGATAGGACTAGTAGCTAGCTA GCTGAGCATGATAGGCTCGATGAGCATGAGATGCATG TACGACTGCATAGGCATGACTGATCGACTGCATCATG ACGCATGACTGCATGCATGACTGCATATGACGGACTC GCATTAGCACTACCGTATTTGCGCATTACCAGATTAGA GAAATGCTAGTCGATCTATCGATCGGCTATTCGCAAA GCTGCGCGACTGCGATGCGCTAGCATGCGATTCGCG ATCGCCGAGCGCTCGCGAGCGCGCTAGCGGAATACT ATATAGCGCGGATCAGTCTAGATCTATGAGATCGATA GCGATCTAGAGATAGGATCGAGATCGAGGCGAGATC ATATGAGCGCGGCTATTTAGGCTTAGAGGATTCGGAG AAGGATTCGGAGATTCGGAGCTTAGGATTACAGAGAG CTTCTTAGGCGCTCCCGGTATCGCTCCCATCCCATATT AAAATCTATCGATCGAGCTCTCCAATGCGATCGATAG GACTAGTAGCTAGCTAGCTGAGCATGATAGGCTCGAT GAGCATGAGATGCATGTACGACTGCATAGGCATGACT GATCGACTGCATCATGACGCATGACTGCATGCATGAC TGCATATGACGGACTCGCA uno degli operai, seguendo alla lettera la fotocopia, produce un nuovo macchinario o un pezzo di ricambio

26 cellula nucleo cromosomi TTAGCACTACCGTATTTGCGCA TTACCAGATTAGAGAAATGCTA GTCGATCTATCGATCGGCTATT CGCAAAGCTGCGCGACTGCGA TGCGCTAGCATGCGATTCGCG ATCGCCGAGCGCTCGCGAGCG CGCTAGCGGAATACTATATAGC GCGGATCAGTCTAGATCTATGA GATCGATAGCGATCTAGAGATA GGATCGAGATCGAGGCGAGAT CATATGAGCGCGGCTATTTAGG CTTAGAGGATTCGGAGATTCG GAGCTTAGGATTACAGAGAGC TTCTTAGGCGCTCCCGGTATCG CTCCCATCCCATATTAAAATCT ATCGA acidi nucleici (DNA-RNA) ribosomi proteine

27 di tanto in tanto lintero set di manuali viene copiato, pagina per pagina, in modo da poter controllare il lavoro di due capannoni anziché di uno...

28 globuli rossi I globuli rossi rappresentano un sistema ideale per lo studio della membrana plasmatica

29 Plasmalemma di globulo rosso

30 Struttura della membrana (modello a mosaico fluido) Citoplasma Fluido extracellulare Doppio strato fosfolipidico proteine canale

31 Il doppio strato fosfolipidico coda non polare (idrofoba) testa polare (idrofila) …acqua… sigillo impermeabile

32 Diffusione semplice Citoplasma Fluido extracellulare la diffusione attraverso la membrana può avvenire attraverso il doppio strato fosfolipidico oppure attraverso i canali proteici

33 Quali sostanze passano per diffusione semplice? Citoplasma Alcol Glucoso Acqua sostanze polari come lacqua e piccoli ioni utilizzano invece specifici canali proteici alcune sostanze dotate di liposolubilità come lalcol possono attraversare il sigillo idrofobo rappresentato dalle code apolari dei fosfolipidi molte sostanze, tuttavia, non possono attraversare la membrana senza un aiuto speciale...

34 trasporto attivo

35 Pompa di scambio Na-K 3 Na + 2 K + ATPADP Canali per micron 2 : 4 K 100 Na 1000 pompe Na-K Fino al 40% dellenergia di una cellula a riposo

36 endocitosi

37 esocitosi

38 sistema membranoso del citoplasma

39 la centrale di controllo

40 nucleo di neurone

41 nucleo di leucocita

42 involucro nucleare membrana unitaria, simile al plasmalemma costituito da cisterne del reticolo endo- plasmatico rugoso poro nucleare …e da un foglietto esterno formato da un foglietto interno…

43 involucro e pori nucleari (TEM) citoplasmacitoplasma nucleonucleo poro

44 involucro e pori

45 NucleoplasmaETEROCROMATINA: DNA compattato, funzionalmente INATTIVO ETEROCROMATINA: EUCROMATINA: DNA disperso, funzionalmente ATTIVO EUCROMATINA: cariolinfacariolinfa nucleolonucleolo

46 sostanza tigroide o di Nissl

47 reticolo endoplasmatico rugoso in citoplasma di neurone (sostanza di Nissl) 1 µm

48 rer

49 rer e ribosomi liberi

50 Ribosoma 20 nm mRNA proteina

51 complesso di Golgi

52 la polarizzazione del Golgi il contenuto del complesso di Golgi matura man mano che viene trasferito dalla cisterna che si trova sul lato cis…...a quella posta sul lato trans del complesso (distante dal nucleo)

53 Golgi: maturazione e trasporto

54 Esocitosi


Scaricare ppt "Istologia. Livelli di organizzazione della sostanza vivente Organismo Apparato Organo Tessuto Cellula Organello Molecola Atomo nello studio della vita."

Presentazioni simili


Annunci Google