La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Una cellula tipica tutte le cellule possiedono una membrana e un corredo di organelli sostanzialmente comune a tutti i tipi cellulari.

Presentazioni simili


Presentazione sul tema: "Una cellula tipica tutte le cellule possiedono una membrana e un corredo di organelli sostanzialmente comune a tutti i tipi cellulari."— Transcript della presentazione:

1 Una cellula tipica tutte le cellule possiedono una membrana e un corredo di organelli sostanzialmente comune a tutti i tipi cellulari

2 RER RE L Golg i nucle o citoso l

3 principali costituenti chimici della cellula

4 carboidrati lipidi ioni proteine acidi nucleici

5 proteine le proteine sono costituite da catene di aminoacidi (polipeptidi)

6 aminoacidi questi sono i 20 aminoacidi che si trovano nellorga- nismo umano e che costituiscono le proteine

7 Proteina: conformazione in condizioni fisiologiche, le proteine assumono complesse conformazioni tridimensionali

8 Proteina: conformazione La forma tridimensionale della proteina è determinante per la sua funzione

9 batterio Il sito ad alta affinità di legame degli anticorpi Gli anticorpi, per esempio, sono proteine che possiedono una porzione di forma complementare a quella di un antigene (il bersaglio dellanticorpo)

10 le proteine sono certamente le molecole più versatili della cellula; ma cè una cosa importante che le proteine non sanno fare: replicare se stesse

11 Acidi nucleici

12 I geni risiedono nella doppia elica del DNA Coppie di basi Scheletro zucchero- fosfato

13 Carboidrati: monosaccaridi glucosio galattosio fruttosio

14 Carboidrati: disaccaridi glucosiogalattosio fruttosio glucosio lattosio saccarosio

15 Carboidrati: polisaccaridi glicogeno

16 lipidi

17 la cellula…...è lunità fondamentale della materia vivente

18 lezioni di citologia Durante il corso cercheremo di capire alcune cose sulla cellula. Cosè una cellula vivente? Come si distingue dal mondo circostante? Perché siamo fatti di cellule? Non potevamo essere fatti di qualcosaltro? Scopriremo presto che anche la cellula apparentemente più semplice è in realtà una macchina estremamente complessa, che osservata da vicino rivela una stupefacente organizzazione. La natura ha inventato sistemi per consentire alla cellula di nutrirsi, di liberarsi dalle sostanze di scarto, di ricevere messaggi e interagire con lambiente circostante, e infine di proliferare. Mentre la biologia e la biochimica si occupano specificamente di descrivere in dettaglio i meccanismi molecolari che hanno luogo allinterno della cellula, noi concentreremo lattenzione sugli aspetti morfologici, senza peraltro perdere di vista i correlati funzionali della struttura della cellula.

19 Le cellule… …sono le unità costitutive delle piante e degli animali …sono prodotte dalla suddivisione di preesistenti cellule …sono le più piccole unità che svolgono tutte le funzioni fisiologiche vitali …mantengono la propria omeostasi La tendenza dei sistemi fisiologici a stabilizzare le condizioni interne

20 Le funzioni tessutali, di organo, di apparato e di organismo le azioni coordinate di molte cellule riflettono

21 Una cellula tipica

22 la fabbrichètta

23 Le macchine e la stanza di controllo

24 la stanza di controllo: i manuali e la fotocopiatrice

25 46 non tutte le pagine dei 46 manuali sono accessibili: molte sembrano essere incollate fra loro.

26 TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAAATGC TAGTCGATCTATCGATCGGCTATTCGCAAAGCTGCGCGACTG CGATGCGCTAGCATGCGATTCGCGATCGCCGAGCGCTCGCG AGCGCGCTAGCGGAATACTATATAGCGCGGATCAGTCTAGA TCTATGAGATCGATAGCGATCTAGAGATAGGATCGAGATCG AGGCGAGATCATATGAGCGCGGCTATTTAGGCTTAGAGGAT TCGGAGATTCGGAGCTTAGGATTACAGAGAGCTTCTTAGGC GCTCCCGGTATCGCTCCCATCCCATATTAAAATCTATCGATC GAGCTCTCCAATGCGATCGATAGGACTAGTAGCTAGCTAGC TGAGCATGATAGGCTCGATGAGCATGAGATGCATGTACGAC TGCATAGGCATGACTGATCGACTGCATCATGACGCATGACT GCATGCATGACTGCATATGACGGACTCGCATTAGCACTACC GTATTTGCGCATTACCAGATTAGAGAAATGCTAGTCGATCTA TCGATCGGCTATTCGCAAAGCTGCGCGACTGCGATGCGCTA GCATGCGATTCGCGATCGCCGAGCGCTCGCGAGCGCGCTA GCGGAATACTATATAGCGCGGATCAGTCTAGATCTATGAGAT CGATAGCGATCTAGAGATAGGATCGAGATCGAGGCGAGATC ATATGAGCGCGGCTATTTAGGCTTAGAGGATTCGGAGATTC GGAGCTTAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTA TCGCTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCA ATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCATGAT AGGCTCGATGAGCATGAGATGCATGTACGACTGCATAGGCA TGACTGATCGACTGCATCATGACGCATGACTGCATGCATGAC TGCATATGACGGACTCGCATTAGCACTACCGTATTTGCGCAT TACCAGATTAGAGAAATGCTAGTCGATCTATCGATCGGCTAT TCGCAAAGCTGCGCGACTGCGATGCGCTAGCATGCGATTCG CGATCGCCGAGCGCTCGCGAGCGCGCTAGCGGAATACTATA TAGCGCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCGCGG CTATTTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAGGATT ACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCATCCC ATATTAAAATCTATCGATCGAGCTCTCCAATGCGATCGATAG GACTAGTAGCTAGCTAGCTGAGCATGATAGGCTCGATGAGC ATGAGATGCATGTACGACTGCATAGGCATGACTGATCGACT GCATCATGACGCATGACTGCATGCATGACTGCATATGACGG ACTCGCA

27 spesso, pagine non incollate dei libri vengono fotocopiate; le copie escono dalla stanza di controllo attraverso una delle finestre.

28 la fotocopia viene trasferita dalla stanza di controllo al resto del capannone attraverso una delle finestre

29 TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAA ATGCTAGTCGATCTATCGATCGGCTATTCGCAAAGCT GCGCGACTGCGATGCGCTAGCATGCGATTCGCGATC GCCGAGCGCTCGCGAGCGCGCTAGCGGAATACTATA TAGCGCGGATCAGTCTAGATCTATGAGATCGATAGCG ATCTAGAGATAGGATCGAGATCGAGGCGAGATCATAT GAGCGCGGCTATTTAGGCTTAGAGGATTCGGAGATTC GGAGCTTAGGATTACAGAGAGCTTCTTAGGCGCTCCC GGTATCGCTCCCATCCCATATTAAAATCTATCGATCGA GCTCTCCAATGCGATCGATAGGACTAGTAGCTAGCTA GCTGAGCATGATAGGCTCGATGAGCATGAGATGCATG TACGACTGCATAGGCATGACTGATCGACTGCATCATG ACGCATGACTGCATGCATGACTGCATATGACGGACTC GCATTAGCACTACCGTATTTGCGCATTACCAGATTAGA GAAATGCTAGTCGATCTATCGATCGGCTATTCGCAAA GCTGCGCGACTGCGATGCGCTAGCATGCGATTCGCG ATCGCCGAGCGCTCGCGAGCGCGCTAGCGGAATACT ATATAGCGCGGATCAGTCTAGATCTATGAGATCGATA GCGATCTAGAGATAGGATCGAGATCGAGGCGAGATC ATATGAGCGCGGCTATTTAGGCTTAGAGGATTCGGAG AAGGATTCGGAGATTCGGAGCTTAGGATTACAGAGAG CTTCTTAGGCGCTCCCGGTATCGCTCCCATCCCATATT AAAATCTATCGATCGAGCTCTCCAATGCGATCGATAG GACTAGTAGCTAGCTAGCTGAGCATGATAGGCTCGAT GAGCATGAGATGCATGTACGACTGCATAGGCATGACT GATCGACTGCATCATGACGCATGACTGCATGCATGAC TGCATATGACGGACTCGCA uno degli operai, seguendo alla lettera la fotocopia, produce un nuovo macchinario o un pezzo di ricambio

30 cellula nucleo cromosomi TTAGCACTACCGTATTTGCGCA TTACCAGATTAGAGAAATGCTA GTCGATCTATCGATCGGCTATT CGCAAAGCTGCGCGACTGCGA TGCGCTAGCATGCGATTCGCG ATCGCCGAGCGCTCGCGAGCG CGCTAGCGGAATACTATATAGC GCGGATCAGTCTAGATCTATGA GATCGATAGCGATCTAGAGATA GGATCGAGATCGAGGCGAGAT CATATGAGCGCGGCTATTTAGG CTTAGAGGATTCGGAGATTCG GAGCTTAGGATTACAGAGAGC TTCTTAGGCGCTCCCGGTATCG CTCCCATCCCATATTAAAATCT ATCGA acidi nucleici (DNA-RNA) ribosomi proteine

31 di tanto in tanto lintero set di manuali viene copiato, pagina per pagina, in modo da poter controllare il lavoro di due capannoni anziché di uno...

32 il nucleo svolge un ruolo cruciale nel controllo della vita della cellula e nel processo di divisione cellulare entrambe le funzioni dipendono strettamente dallacido desosiribonucleico (DNA) contenuto nel nucleo

33 Filosofia della vita cellulare Geni Geni Geni proteine proteine proteineproteineproteine

34 Acidi nucleici

35 Il duplice ruolo del DNA DNA proteine DNA proteine controllo cellulare ereditarietà

36 I geni risiedono nella doppia elica del DNA Coppie di basi Scheletro zucchero- fosfato

37 Acido desossiribonucleico Il segreto del DNA risiede nella sua struttura…

38 DNA S P N S P N S P N S P N nucleotide S P N Zucchero (desossiribosio) Gruppo fosfato Base azotata 53

39 Le 4 basi azotate del DNA AdeninaAdenina TiminaTimina CitosinaCitosina GuaninaGuanina

40 La doppia elica

41 Il messaggio cifrato TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAAA TGCTAGTCGATCTATCGATCGGCTATTCGCAAAGCTGC GCGACTGCGATGCGCTAGCATGCGATTCGCGATCGCC GAGCGCTCGCGAGCGCGCTAGCGGAATACTATATAGC GCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCG CGGCTATTTAGGCTTAGAGGATTCGGAGATTCGGAGCT TAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTATCG CTCCCATCCCATATTAAAATCTATCGATCGAGCTCTCCA ATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCAT GATAGGCTCGATGAGCATGAGATGCATGTACGACTGCA TAGGCATGACTGATCGACTGCATCATGACGCATGACTG CATGCATGACTGCATATGACGGACTCGCA leccezionalmente lunga sequenza di basi azotate nel DNA costituisce il messaggio cifrato contenuto nei manuali (cromosomi) conservati nel locale di controllo (nucleo) della fabbrica cellulare

42 Dallanticodon alla catena peptidica ATGTTTGTTGCCTAA TACAAACAACGGATT AUGUUUGUUGCCUAA UACAAACAACGGAUU MetPheValAlaStop DNA mRNA peptide tRNA

43 il ciclo cellulare le cellule si riproducono attraverso un processo detto mitosile cellule si riproducono attraverso un processo detto mitosi prima della mitosi, lintero genoma produce una copia di se stesso tramite la replicazione del DNAprima della mitosi, lintero genoma produce una copia di se stesso tramite la replicazione del DNA

44 la mitosi replicazione DNA e mitosi

45 Le cellule sono tutte uguali? Tutte le cellule fanno questo (e altro) ma:

46 cellule del tessuto connettivo

47 cellule muscolari lisce

48 cellula dellosso

49 cellule ematiche

50 cellule epiteliali di rivestimento 100 µm

51 differenziamento cellulare Cellula nervosa del cervelletto 100 µm

52 differenziamento cellulare Adipocita 100 µm

53 differenziamento cellulare Cellula uovo e spermatozoo 100 µm

54 differenziamento cellulare Cellula nervosa del midollo spinale 100 µm

55 differenziamento cellulare Cellula muscolare scheletrica 100 µm

56 Ma allora, le cellule sono tutte completamente diverse fra loro? Sì e no…

57 citosol nucleo organelli membranosi

58 Una distinzione importante Eucarioti o cellule superioriEucarioti o cellule superiori –Tutte le cellule degli organismi pluricellulari, nonché alcuni organismi monocellulari (protozoi) Procarioti o batteriProcarioti o batteri –Cellule vere ma prive di membrana nucleare e di organuli citoplasmatici Virus e batteriofagiVirus e batteriofagi –Forme di vita non cellulari –Composti unicamente da un acido nucleico e un capside proteico


Scaricare ppt "Una cellula tipica tutte le cellule possiedono una membrana e un corredo di organelli sostanzialmente comune a tutti i tipi cellulari."

Presentazioni simili


Annunci Google