La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Francesco Piva Istituto di Biologia e Genetica Università Politecnica delle Marche Introduzione alla bioinformatica Novembre 2003.

Presentazioni simili


Presentazione sul tema: "Francesco Piva Istituto di Biologia e Genetica Università Politecnica delle Marche Introduzione alla bioinformatica Novembre 2003."— Transcript della presentazione:

1 Francesco Piva Istituto di Biologia e Genetica Università Politecnica delle Marche Introduzione alla bioinformatica Novembre 2003

2 Obiettivi della bioinformatica Banche dati: raccolta dati, ordinamento, correlare quelli che trattano i diversi aspetti di uno stesso tema, renderli fruibili in modo semplice, unificare le banche adti. Ricerca dei geni in un genoma Inferire la funzione delle proteine a partire dalla sequenza del gene, da qui la possibilità di creare nuove proteine con nuove funzioni Prevedere lo splicing dellmRNA a partire dalla sequenza del pre-mRNA, capire leffetto delle mutazioni Descrivere la rete genica di una cellula, chi attiva o reprime chi, da chi si fa attivare o reprimere. Prevedere al computer leffetto di uno stimolo esogeno… sapere come compensarlo. Sapere che stimolo generare per produrre certi effetti Capire levoluzione delle specie Poter prevedere la ricombinazione nel DNA Francesco Piva Ist Biologia e Genetica, Ancona

3 Metodi della bioinformatica database Risorse umane, formazione, mezzi Teoria dellinformazione, studio dei linguaggi, ridondanza, entropia, correlazione… Metodi statistici Data mining Reti neurali Algoritmi matematici: FFT, Wavelet, ICA, PCA, teoria delle reti… … Francesco Piva Ist Biologia e Genetica, Ancona

4 cromosoma mRNA Cloni di cDNA cDNA Il trascrittoma: quanti e quali geni? Quanti e quali geni sono contenuti in un genoma? Quali geni sono espressi in un tessuto? E in un tessuto patologico? Cellule o tessuti Sequenziamento …EST Francesco Piva Ist Biologia e Genetica, Ancona

5 TTTTTT AAAAAA3UTR 5UTRESONE 1ESONE 2 mRNA TTTTTT 3 GGGGGG Rimozione dellRNA e attacco di un poly (G) al cDNA TTTTTT Le sequenze di cDNA ottenute dallmRNA sono generalmente tronche La costruzione del cDNA Francesco Piva Ist Biologia e Genetica, Ancona

6 AAAAAA 3 TTTTTT 5 GGGGGG CCCCCC Produzione del cDNA complementare Metilazione dei due cDNA per proteggere i siti di restrizione CH 3 AAAAAA TTTTTT GGGGGG CCCCCC GAATTC CTTAAG GAATTC CTTAAG Aggiunta di siti di restrizione Eco RI Francesco Piva Ist Biologia e Genetica, Ancona

7 Digestione con Eco RI AAAAAA TTTTTT GGGGGG CCCCCC GAATTC CTTAAG GAATTC CTTAAG AAAAAA TTTTTT GGGGGG CCCCCC AATTC G G CTTAA vector Ligazione del cDNA nei plasmidi Francesco Piva Ist Biologia e Genetica, Ancona

8 La potenzialità di una libreria di cDNA è in relazione al numero di inserti di cDNA indipendenti che siamo riusciti a clonare. Supponendo di prelevare unaliquota di batteri trasformati, il titolo è dato dal numero di colonie per unità di volume di batteri ricombinanti Francesco Piva Ist Biologia e Genetica, Ancona

9 Come stimare la potenzialità di una libreria di cDNA? Si potrebbe digerire il DNA plasmidico con enzimi di restrizione e analizzare i frammenti tagliati 3kb vettore inserti I cloni 7, 8, 9 e 13 non sono ricombinanti: quindi 4/16 = 25% Esempio di una libreria: Titolo: 100 unità formanti colonia/microlitri % cloni non ricombinanti: 10% Volume totale di batteri trasformati: 1 ml Potenzialità: ( cloni totali – non ricombinanti) = inserti di cDNA

10 Calcolo delle probabilità applicato alle librerie di cDNA Che probabilità abbiamo di trovare il clone A2B che ha frequenza dell 1% (f=0.01) in una libreria di 100 (N=100) cloni? Dalla formula Ricaviamo P = 63.4% Quanti cloni devo sequenziare (N = ?) per essere abbastanza sicuro (99% P=0.99) di trovare il clone A2B che ha una frequenza dell1% (f=0.01)? Dalla stessa formula ricaviamo N = 458 Francesco Piva Ist Biologia e Genetica, Ancona

11 Un caso reale Quanti cloni devo sequenziare per avere il 99% delle probabilità di trovare un particolare clone di mio interesse? In una cellula ho circa molecole di mRNA quelli più abbondanti sono rappresentati in – copie per cellula f=10000/ quelli mediamente abbondanti in 200 – 500 copie per cellula f=500/ quelli rari in 1 – 15 per cellula f=15/ per gli abbondanti risulta… N=230 per i mediamente abbondanti… N=4600 per i rari… N= Francesco Piva Ist Biologia e Genetica, Ancona

12 Anziché mettersi a sequenziare in modo furioso, si può cercare di operare sulla libreria in modo di aumentare la probabilità di trovare il cDNA di interesse. Questo lo si può fare in vari metodi : Metodo di arricchimento Frazionamento in gel Clonazione per sottrazione Francesco Piva Ist Biologia e Genetica, Ancona

13 Metodo di arricchimento P er arricchire la libreria del cDNA di interesse si può - selezionare in partenza le cellule o i tessuti più ricchi del trascritto - rimuovere dalla libreria le sequenze che non interessano - indurre o aumentare la trascrizione del particolare gene con stimoli specifici Francesco Piva Ist Biologia e Genetica, Ancona

14 Frazionamento in gel Se si sa la lunghezza del cDNA che stiamo cercando, si possono selezionare su gel prima di legarli al vettore Francesco Piva Ist Biologia e Genetica, Ancona

15 Clonazione per sottrazione Linea cellulare + Linea cellulare - Sintesi del cDNA dallmRNA Eliminazione dellmRNA Ibridazione mRNA non appaiati cDNA non appaiati Recupero del cDNA non appaiato tramite colonnine di idrossiapatite. Ottengo solo quello non comune alle due linee mRNA Francesco Piva Ist Biologia e Genetica, Ancona

16 Tipo di cDNA N° di copie Normalizzazione delle librerie di cDNA Tipo di cDNA N° di copie Supponendo di avere il cDNA di 8 geni espressi con intensità diversa, mostriamo il grafico dellabbondanza di copie di cDNA prima e dopo la normalizzazione della libreria Si perdono le informazioni sul livello di espressione dei geni Al fine di trovare con la stessa probabilità sia le sequenze abbondanti che quelle rare si attua una normalizzazione delle librerie di cDNA. Per far questo si sfrutta il fatto che i cDNA più abbondanti, si appaiano o ibridizzano più rapidamente e possono essere rimossi dallinsieme di cDNA di partenza. In questo modo linsieme rimanente si svuota delle sequenze più abbondanti ovvero si arricchisce di quelle più rare. Francesco Piva Ist Biologia e Genetica, Ancona

17 Generazione delle sequenze EST: etichette di sequenza espressa AAAAAAA cDNA clone sequencing primers 3 EST 5 EST Francesco Piva Ist Biologia e Genetica, Ancona

18 Scarsa qualità delle sequenze: errori dovuti ad un sequenziamento automatizzato, senza la supervisione di un operatore, sequenza a passaggio singolo. Quello che importa è determinare la presenza di un trascritto non la sua sequenza. In questo modo si perdono le informazioni sulle mutazioni. >T27784 g | T27784 CLONE_LIB: Human Endothelial cells. LEN: 337 b.p. FILE gbest3.seq 5-PRIME DEFN: EST16067 Homo sapiens cDNA 5' end AAGACCCCCGTCTCTTTAAAAATATATATATTTTAAATATACTTAAATATATATTTCTAATATCTTTAAATATA TATATATATTTNAAAGACCAATTTATGGGAGANTTGCACACAGATGTGAAATGAATGTAATCTAATAGANGCCT AATCAGCCCACCATGTTCTCCACTGAAAAATCCTCTTTCTTTGGGGTTTTTCTTTCTTTCTTTTTTGATTTTGC ACTGGACGGTGACGTCAGCCATGTACAGGATCCACAGGGGTGGTGTCAAATGCTATTGAAATTNTGTTGAATTG TATACTTTTTCACTTTTTGATAATTAACCATGTAAAAAATG Francesco Piva Ist Biologia e Genetica, Ancona

19 Problemi con gli EST Le sequenze provenienti dallo stesso trascritto vanno raggruppate clustering Questa operazione non è banale perchè bisogna tener conto dei seguenti problemi: - presenza di polimorfismi, le mie EST potrebbero non allineare con la sequenza genomica poiché le EST sono del mio organismo, il genomico è di un organismo diverso da quello che sto studiando - un gene può avere anche centinaia di varianti di splicing - i geni paraloghi (fisicamente in posizioni cromosomiche diverse ma con trascritti quasi identici) - presenza negli EST di pezzi di vettore plasmidico - presenza di sequenze genomiche batteriche - presenza di sequenze ripetute come le Alu - artefatti dovuti al fatto che due inserti di cDNA entrano in tandem in un vettore plasmidico e io li leggo come un unico trascritto In generale questi problemi sono completamente superabili solo quando si conosce la sequenza genomica della specie che sto studiando Francesco Piva Ist Biologia e Genetica, Ancona

20 cDNA, EST e banche dati dbEST (pronuncia the best) Divisione di GenBank che contiene tutte le sequenze EST, classificate per specie, tessuto, patologia… Francesco Piva Ist Biologia e Genetica, Ancona

21 dbEST release Summary by Organism - October 31, 2003 Number of public entries: 18,971,362 Homo sapiens (human) 5,427,521 Mus musculus + domesticus (mouse) 3,915,334 Rattus sp. (rat) 538,251 Triticum aestivum (wheat) 500,902 Ciona intestinalis 492,488 Gallus gallus (chicken) 451,565 Zea mays (maize) 383,759 Danio rerio (zebrafish) 362,445 Hordeum vulgare + subsp. vulgare (barley) 348,233 Xenopus laevis (African clawed frog) 344,747 Glycine max (soybean) 341,578 Bos taurus (cattle) 329,387 Drosophila melanogaster (fruit fly) 261,414 Oryza sativa (rice) 260,890 Saccharum officinarum 246,301 Caenorhabditis elegans (nematode) 215,200 Silurana tropicalis 209,240 Arabidopsis thaliana (thale cress) 190,732 Medicago truncatula (barrel medic) 187,763 Sus scrofa (pig) 171,920 Francesco Piva Ist Biologia e Genetica, Ancona

22 1: BM ie94h04.y1 Melton...[gi: ] IDENTIFIERS dbEST Id: EST name: ie94h04.y1 GenBank Acc: BM GenBank gi: CLONE INFO Clone Id: IMAGE: (5') Source: University of Pennsylvania & Harvard University (HHMI) & Washington University (GSC) Other ESTs on clone:ie94h04.x1 DNA type: cDNA PRIMERS PolyA Tail: Unknown SEQUENCE GCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATA ACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAA ATATGGAAAGTTGCAGATGAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACA AGCAGTTGATGTGCTTGGCTAGATCTGTTCCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACATACCAAATAATTAGAAGAACTCT AAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGTGAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGGTCATAGAAGAGAACAAAGTGCGGCAGTACG ATTCC Quality: High quality sequence stops at base: 429 Entry Created: Nov Last Updated: Mar COMMENTS Library was constructed by Dr. Douglas Melton DNA sequencing by: Washington University Genome Sequencing Center For information on obtaining a clone please contact: Juliana Brown This sequence now available from the IMAGE consortium, for clone orders contact: PUTATIVE ID Assigned by submitter SW:CFTR_HUMAN P13569 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR ; LIBRARY Lib Name: Melton Normalized Human Islet 4 N4 - HIS 1 Organism: Homo sapiens Sex: Both Organ: Pancreas Tissue type: Islets of Langerhans Develop. stage: Adult Lab host: DH10B R. Site 1: Not 1 R. Site 2: Sal 1 Inserendo homo sapiens e CFTR Francesco Piva Ist Biologia e Genetica, Ancona

23 Integrated Molecular Analysis of Genomes and their Expressions Francesco Piva Ist Biologia e Genetica, Ancona

24

25 Attenzione: la ricerca è case sensitive quindi se digitate cftr non trova nulla, si deve digitare CFTR maiuscolo. Francesco Piva Ist Biologia e Genetica, Ancona

26 Geni noti in NCBI Reference Sequence Geni non noti in NCBI Reference Sequence In IMAGE si trovano due tipi di cluster di geni a seconda che corrispondano a geni già noti Full: Cluster i cui cloni allineano pienamente con un gene noto Predicted full: Cluster che contengono una ORF completa ma il cui gene è stato solo predetto sperimentalmente Unknown: Cloni di cui non si sa se rappresentano lintera ORF (perché è stato determinato un solo EST del clone) Partial: Cloni che non rappresentano lintera ORF (gli EST al 5 e al 3 non coprono lintera regione del clone) Empties: Cluster già noto ma di cui in questa libreria non ci sono cloni Multi-member: Cluster contenente più cloni e il cui gene non è ne noto ne predetto Singletons: Singolo clone che non si può raggruppare con altri già noti e contiene almeno 50 nucleotidi in cui non ci sono sequenze ripetute Francesco Piva Ist Biologia e Genetica, Ancona

27 descrizione del gene Identificativo del cluster, attenzione perché può cambiare Numero di cloni che coprono interamente la sequenza codificante, se ne esiste almeno uno allora abbiamo un full cluster

28 E possibile vedere gli allineamenti dei cloni che compongono il cluster o quello delle singole sequenze EST Francesco Piva Ist Biologia e Genetica, Ancona

29 In questa schermata troviamo i dati sui cloni e sugli EST Il bottone restituisce la descrizione del gene Francesco Piva Ist Biologia e Genetica, Ancona

30 clone EST Classificazione di un clone: predicted full, unknown, partial… Provenienza del clone Mammalian Gene Collection Lunghezza del clone: dimensione determinata, se si conosce un solo EST si indica la lunghezza minima chi ha verificato il clone A volte è ambiguo stabilire a quale cluster appartiene un certo clone, il numero a fianco indica a quanti altri cluster (oltre a questo) appartiene questo clone Bento Soares Columbia University Lavora alla creazione di librerie di EST normalizzate Francesco Piva Ist Biologia e Genetica, Ancona

31 Francesco Piva Ist Biologia e Genetica, Ancona

32 Si possono fare ricerche per identificativo dell librera, tassuto, stadio di sviluppo… Francesco Piva Ist Biologia e Genetica, Ancona

33 o per patologia… Francesco Piva Ist Biologia e Genetica, Ancona

34 Identificato un gene, mostra la descrizione della proteina

35 gli allineamenti… Francesco Piva Ist Biologia e Genetica, Ancona

36 Gli omologhi Francesco Piva Ist Biologia e Genetica, Ancona

37 UniGene Sviluppato da NCBI, contiene i cluster corrispondenti ai geni Gli EST sono stati filtrati, verificati con MegaBlast, tutti i cluster sono confrontati con i nuovi EST e verificati settimanalmente Nota: non fare riferimento agli ID (identificativi) dei cluster poiché possono cambiare settimanalmente Francesco Piva Ist Biologia e Genetica, Ancona

38 Francesco Piva Ist Biologia e Genetica, Ancona

39 Dalla schermata precedente cè un collegamento a questo sito Vengono fornite le sequenze di 10 basi (etichette) in ordine di occorrenza decrescente nel cluster per il gene di interesse

40 STACK Sviluppato dal South African National Bioinformatics Institute, contiene i dati sui cluster, il criterio di allineamento è un po diverso da quello di UniGene perché inizialmente si verifica se due EST sono parzialmente sovrapposti controllando se hanno parti in comune Francesco Piva Ist Biologia e Genetica, Ancona

41 TIGR In generale i dati di clustering differiscono da una banca dati allaltra a causa dei diversi criteri adottati Francesco Piva Ist Biologia e Genetica, Ancona

42 Francesco Piva Ist Biologia e Genetica, Ancona

43 ORF nelle tre fasi, nel filamento diretto e inverso Zona e direzione in cui allineano gli EST Per ciscun EST e possibile avere informazioni dal sito TIGR, da GenBank Nucleoride e da IMAGE Francesco Piva Ist Biologia e Genetica, Ancona

44 Francesco Piva Ist Biologia e Genetica, Ancona

45 Noi possiamo allineare i trascritti sul DNA genomico tramite programmi disponibili su siti internet Questi programmi tengono conto che - il trascritto deve essere completamente contenuto nel DNA genomico - lappaiamento potrebbe non essere perfetto - lappaiamento può essere interrotto da introni Francesco Piva Ist Biologia e Genetica, Ancona

46 Francesco Piva Ist Biologia e Genetica, Ancona

47 Francesco Piva Ist Biologia e Genetica, Ancona

48 Francesco Piva Ist Biologia e Genetica, Ancona

49 Predizione teorica dei geni in un genoma metodi Analisi discriminante lineare e quadratica Modelli di Markov a variabili nascoste Metodo del perceptron Stima degli esameri codificanti Metodo della matrice di pesi e del vettore di pesi Decomposizione secondo le direzioni di massima dipendenza Alberi di decisione Reti neurali artificiali Francesco Piva Ist Biologia e Genetica, Ancona

50 Analisi discriminante lineare e quadratica Lobiettivo di questo metodo è: Identificare le variabili e le relazioni tra di esse che permettono di differenziare due o più gruppi di dati Classificare nuovi casi nei gruppi ricavati (predittività) Concentrazione di A Concentrazione di B Es: distinguere gli individui sani e malati in base alla misura della concentrazione di due enzimi. Con il metodo dei minimi quadrati si minimizza lerrore di classificazione e si ottiene una relazione lineare tra le due variabili Concentrazione di A Concentrazione di B Nel caso del riconoscimento degli esoni in una sequenza di pre-mRNA, come variabili si sceglie la frequenza di certe triplette nei siti di splicing in 5 e in 3. lineare quadratico Francesco Piva Ist Biologia e Genetica, Ancona

51 Modelli di Markov a variabili nascoste Un sistema viene descritto da una successione di stati discreti e dalla probabilità di transizione da uno stato allaltro A A C C G T G T 0,32 0,31 0,18 0,36 0,37 0,35 0,260,20 0,15 0,20 0,17 0,16 0,18 0,15 0,36 A C G T A Data una sequenza esonica: …catga… Possiamo rappresentarla come la successione di stati di un sistema e ricavare un modello descrittivo che a partire da un certo stato indichi la probabilità di transizione verso un altro stato. La parola nascosti indica che uno stato non può essere osservato Gli schemi di transizione sono caratteristici delle zone codificanti e non. Francesco Piva Ist Biologia e Genetica, Ancona

52 Date le cinque sequenze sotto, cerchiamo di ricavare un modello di Markov Si ricava questo modello E.g. P(ACACATC) = (0.8 * 1)*(0.8*1)*(0.8*0.6)*(0.4*0.6)*(1*1)*(0.8*1)*(0.8) A C A C A T C (S = logP(sequenza) - lunghezza(sequenza)*log0.25 ) Inserzione di uno stato (regioni altamente variabili) Stati principali Francesco Piva Ist Biologia e Genetica, Ancona

53 Lattuale modello di predizione di un gene Stati principali Inserzione di uno stato (regioni altamente variabili) Stati particolari (es: n) - si possono rappresentare regole semplici - non si considera la frequenza dei dinucleotidi - non si considera la dipendenza (correlazione) fra i nucleotidi - in realtà ci vorrebbe un modello di Markov per gli esoni, uno per gli introni, uno per le regioni non tradotte Francesco Piva Ist Biologia e Genetica, Ancona

54 Perceprton w1w1 w2w2 w3w3 wnwn x1x1 x2x2 x3x3 xnxn b bias weights inputs non linear function assoni sinapsi dendriti assone corpo E un algoritmo realizzato con una rete neurale artificiale che realizza lanalisi discriminante lineare, questo prova iterativamente vari piani di separazione cercando ad ogni passo di minimizzare lerrore di discriminazione. Francesco Piva Ist Biologia e Genetica, Ancona

55 Stima degli esameri Le sequenze vengono trattate come successioni di parole. Ciascuna parola è un insieme di basi, ad esempio sei simboli formano un esamero La distinzione tra sequenze codificanti e non, si basa sulla frequenza con cui si trovano certi esameri Alcune parole sono caratteristiche delle sequenze codificanti Es: CAGCAG Altre sono caratteristiche di quelle non codificanti Es: TAATAA Dallosservazione dei geni si ricava un punteggio che viene assegnato ad ogni esamero. Il punteggio può essere positivo o negativo a seconda che sia indizio di una sequenza codificante o meno. In fase di analisi, data una sequenza che potrebbe rappresentare un potenziale gene, si estraggono tutti gli esameri e si ricava un punteggio totale. Francesco Piva Ist Biologia e Genetica, Ancona

56 Metodo della marice di pesi Questo metodo è usato per assegnare un punteggio ad un sito di DNA o RNA per indicare quanto questo sia affine a legare una proteina o altro Punto debole: non si tiene conto delle correlazioni tra basi in diversa posizione Es: Punteggio (gtcacgt) = = 3,54 GTCACGT GTCACTT Questi siti di legame differiscono solo per la sesta posizione. Non è detto che il punteggio in posizione 4 (A) dipenda solo dal nucleotide che si trova in quella posizione: potrebbe dipendere da quali altri nucleotidi sono presenti nelle vicinanze. In altre parole, a volte non vale la semplice proprietà additiva per calcolare laffinità di legame Il metodo del vettore dim pesi associa un punteggio ad unintera parola anziché ad una singola base

57 Decomposizione secondo la direzione di massima dipendenza Francesco Piva Ist Biologia e Genetica, Ancona

58 Reti neurali artificiali Francesco Piva Ist Biologia e Genetica, Ancona


Scaricare ppt "Francesco Piva Istituto di Biologia e Genetica Università Politecnica delle Marche Introduzione alla bioinformatica Novembre 2003."

Presentazioni simili


Annunci Google