La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Biotecnologie Vegetali per Diegnare la Pianta del Futuro Antonio Michele Stanca U N A S A- AISSA-UNIMORE Orvieto 28 settembre2013.

Presentazioni simili


Presentazione sul tema: "Biotecnologie Vegetali per Diegnare la Pianta del Futuro Antonio Michele Stanca U N A S A- AISSA-UNIMORE Orvieto 28 settembre2013."— Transcript della presentazione:

1 Biotecnologie Vegetali per Diegnare la Pianta del Futuro Antonio Michele Stanca U N A S A- AISSA-UNIMORE Orvieto 28 settembre2013

2 Norman Borlaug Nazareno Strampelli Mendel

3 Model of the Breeding progress in the last 100 years

4 Neolitico 500 semi/m q/ha Periodo Romano semi/m q/ha Rinasciment Pre-Mendel semi/m q/ha Post-Mendel semi/m 2 25 q/ha semi/m 2 50 q/ha Oggi semi/m q/ha

5 GENETICA GENOMICA studia il Genoma (lintero contenuto di DNA di una Cellula)

6

7 The DNA based knowledge can lead to: identify the POSITION of genes controlling useful traits and tag them with molecular markers; ISOLATE the genes encoding for useful traits for further gene- improvement ACCGTTGGACCATGGATACTAATGG

8

9 12/06/0828/11/07 MAS=Molecular Assisted Selection

10

11

12

13 Organismo geneticamente modificato (OGM) (OGM) Un organismo il cui materiale genetico è stato modificato in modo diverso da quanto si verifica in natura mediante incrocio o con la ricombinazione genetica naturale

14

15 Il T-DNA è trasferito nel genoma della pianta IntegrationTransferExpression 3'- LB- T-DNA -RB-5' A) Malattie iperplastiche Agenti: A. tumefaciens e rhizogenes, P. syringae savastanoi e avellanea

16

17 PLANT TRANSFORMATION

18

19

20

21

22

23

24 Bt or non Bt? 5 Stati 14 anni Riduzione della popolazione di piralide sino al 70% nei campi convenzionali NON Bt Hutchison et al Science

25 1998 COSTANZA«tradizionale» «isogenico Bt» Lodi, azienda Bianchini-Elias (oggi Assessore allAgricoltura in Lombardia) 5 ottobre (foto Maggiore)

26 LARVA PIRALIDE FUSARIUM spp

27 Landriano (PV), Az. Menozzi, settembre 2005 (foto Maggiore) P66 P67 (Bt)

28 IbridiResa dt/haU%Fori stocco n° Fori spigaFori pedunc.GallerieFusariumFumosi- 14% Un° cm/piantaspiga %na (ppb) ELGINA14123,50,8 0,060,150, CECILIA11021,36,31 1,361,6619, P ,70,75 0,020,160,70 60 P ,39,54 3,262,5868, MEDIA130,2523,24,354,71,1422,

29 P66 P67 Visione del campo al momento della raccolta dopo aver eliminato il bordo centrale

30 Oltre i Transgenici Nature Biotec (marzo 2012) Lingegneria genetica di prima generazione ha permesso di inserire tratti di DNA a random nel genoma Cellule vegetali ingegnerizzate per produrre molecole utili-non OGM- Zinc Finger Nucleasi-ZFN- Inserimento del gene in modo mirato mediante riconoscimento di siti specifici nel genoma Cisgenesi ( non OGM?) e Intragenesi GRAFTING Modificazione Epigenetica ( metilazione-silenziamento)

31 MORE EFFICIENT AGRICULTURE Herbicide tolerance Insect resistance HEALTHIER NUTRITION and QUALITY Aminoacids, oil, starch PEST PROTECTION Virus, nematode, fungi, insects PLANTS AS FACTORIES Vitamins, long-chained fatty acids, omega 3 fatty acids, enzymes, biopolimers, Pigments, pharmaceuticals, fiber. STRESS PROTECTION Cold, drought, salinity

32 Seralini et al Maize NK603 EFSA Insufficient Scientific Quality

33

34

35 BREEDING by DESIGN Integration of GENETICS Molecular Genetics Molecular Breeding Physiology Food Technology Bioinformatics and Statistics Agronomy SYSTEMS BIOLOGY

36 GENOTYPING PHENOTYPING,

37 Centrodi Ricerca per la Genomica GAS = Genomic Assisted Selection Selezione basata su migliaia/decine di migliaia di tratti di DNA

38 METAGENOMIC PLANT-soil-microbe- interaction ROOTS NUE e WUE MIRNA PLANT for the Future Potenzialità e Stabilità semi/m q/ha

39 SYSTEMS BIOLOGY and Beyond Vibrant and Competitive Research More SCIENCE in AGRICULTURE SCIENCE FOR FARMING Breeding is not Art Breeding is SCIENCE

40

41 Filmato RNA

42 A molecular clock model explains the basis of heterosis. In the hybrids, the allelic interactions between parent 1 (P1) and parent 2 (P2) induce epigenetic repression of CCA1 and LHY expression amplitudes (red dashed line) and upregulation of TOC1 expression amplitudes (green dashed line) relative to the expression values in the parents (solid red and green lines, respectively), whereas the periodicity of the clock remains the same because maintaining clock periodicity and rhythm is important for plant growth and fitness Molecular mechanisms of polyploidy and hybrid vigor. Trends Plant Sci.Trends Plant Sci Feb;15(2):57-71.

43 Effect of elevated CO2 on oat yield and quality traits? A rings of the FACE facility installed in Fiorenzuola dArda with its control unit FACE-Free-Air CO2 Enrichment- is considered the most advanced technology to investigate experimentally the impact of rising atmospheric CO 2 on terrestrial ecosystems

44 SCIENZA e AGRICOLTURA Complementari……………………90.2% Incompatibili…………………..…….9.8% Chi SONO?

45 Pontecorvo e la Scperta del Neutrino Giovani Studenti e Professori DOMANDA:Ma i neutrini cosa portano ai Kolkhoziani di RYAZAN? Risposta:Per ora il neutrino non dà nulla ai Kolkhoziani né a chiunque altro Modo per affermare che la ricerca spesso non dà un risultato immediato ai contadini e agli operai Modo elegante per affermare lautonomia della ricerca

46 22 maggio 2009


Scaricare ppt "Biotecnologie Vegetali per Diegnare la Pianta del Futuro Antonio Michele Stanca U N A S A- AISSA-UNIMORE Orvieto 28 settembre2013."

Presentazioni simili


Annunci Google