La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Corso di Formazione Siracusa 28 maggio 2005 La Biologia Molecolare nel Laboratorio di Patologia Clinica Geni e Malattie Dipartimento di Scienze Biomediche.

Presentazioni simili


Presentazione sul tema: "Corso di Formazione Siracusa 28 maggio 2005 La Biologia Molecolare nel Laboratorio di Patologia Clinica Geni e Malattie Dipartimento di Scienze Biomediche."— Transcript della presentazione:

1 Corso di Formazione Siracusa 28 maggio 2005 La Biologia Molecolare nel Laboratorio di Patologia Clinica Geni e Malattie Dipartimento di Scienze Biomediche Sezione di Biologia generale, cellulare e di Genetica molecolare Università di Catania Cinzia Di Pietro

2 GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGGAGCTGAGGA GCGGGGCCCGGCCAGGGCTGGAGACTTTGCGCCCGGGGGCACCGGGGCTGCGCGCGGTCGCACACATCCACCGGC GCGGCTTCCCTCGGCGGCCCGGGCTCCGCTCATCCTGCGGCGGGCGGCGCCGCTCAGGGGCGGGAAGAGGAGGCG GTAGACGCGACCACAGAAGATGTCGGGCCAAACGCTCACGGATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCT CTGCTGTAGCAAGAGCGGTCTGCAAAGCCACTACTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGAT CCAGGCTACCAACGAGACCAATGTTAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGG GTGGTTGTGTTTAAGGCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTC TAGAAATACACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAAGGCG CTATAGTAGATATTTGAATGAAAAGGCTTTTTCTTACAGACAGATGGCCTTTGATTTTGCCAGGGTGAAGAAAGGGGCC GATGGTGTAATGAGGACAATGGCTCCCGAAAAGCTGCTAAAGAGTATGCCAATACTACAGGGACAAATTGATGCACTGC TTGAATTTGATGTGCATCCAAATGAACTAACAAATGGTGTCATAAATGCAGCATTTATGCTTCTTTTCAAAGATCTTATCA AACTTTTTGCTTGCTACAATGATGGTGTTATTAACTTACTCGAAAAGTTTTTTGAAATGAAGAAAGGACAATGTAAAGATG CTCTAGAAATTTACAAACGATTTCTAACTAGAATGACACGAGTGTCTGAATTTCTCAAGGTTGCAGAGCAAGTTGGTATT GATAAAGGTGACATTCCTGACCTCACACAGGCTCCCAGCAGTCTTATGGAGACGCTTGAACAGCATCTAAATACATTAG AAGGAAAGAAACCTGGAAACAATGAAGGATCTGGTGCTCCCTCTCCATTAAGTAAGTCTTCTCCAGCCACAACTGTTAC GTCTCCTAATTCTACACCAGCTAAAACTATTGACACATCCCCACCGGTTGATTTATTTGCAACTGCATCTGCGGCTGTCC CAGTCAGCACTTCTAAACCATCTAGTGATCTCCTGGACCTCCAGCCAGACTTTTCCTCTGGAGGGGCAGCAGCAGCCG CAGCACCAGCACCACCACCACCTGCTGGAGGAGCCACTGCATGGGGAGACCTTTTGGGAGAGGATTCTTTGGCTGCA CTTTCCTCTGTTCCCTCTGAAGCACAGATTTCAGATCCATTTGCACCAGAACCTACCCCTCCTACTACAACTGCTGAAAT TGCAACCACTACTGCTGCCACCGCCGCTGCCACCACCACTACCATTCATCTCTTGCCAGCTTAGTAGGCAATCTTGGAA TTTCTGGTACCACAACAAAAAAGGGAGATCTTCAGTGGAATGCTGGAGAGAAAAAGTTGACTGGTGGAGCCAACTGGC AGCCTAAAGTAGCTCCAGCAACCTGGTCAGCAGGCGTTCCACCAAGTGCACCTTTGCAAGGAGCTGTACCTCCAACCA GTTCAGTTCCTCCTGTTGCCGGGGCCCCATCGGTTGGACAACCTGGAGCAGGATTTGGAATGCCTCCTGCTGGGACAG GCATGCCCATGATGCCTCAGCAGCCGGTCATGTTTGCACAGCCCATGATGAGGCCCCCCTTTGGAGCTGCCGCTGTAC CTGGCACGCAGCTTTCTCCAAGCCCTACACCTGCCAGTCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGG ATCTTAACATCAAGGATTTCTTGTAAACAATTTAAGCTGCAATATTTGTGACTGAATAGGAAAATAAATGAGTTTGGAGAC TTCAAATAAGATTGATGCTGAGTTTCAAAGGGAGCCACCAGTACCAAACCCAATACTTACTCATAACTTCTCTTCCAAAAT GTGTAACACAGCCGTGAAAGTGAACATTAGGAATATGTACTACCTTAGCTGTTATCCCTACTCTTGAAATTGTAGTGTAT TTGGATTATTTGTGTATTGTACGATGTAAACAATGAATGGATGTTACTGATGCCGTTAGTGCTTTTTTGGACTTCACCTGA GGACAGATGATGCAGCTGTTGTGTGGCGAGCTATTTGGAAAGACGTCTGTGTTTTTGAAGGTTTCAATGTACATATAAC TTTTGAACAAACCCCAAACTCTTCCCATAAATTATCTTTTCTTCTGTATCTCTGTTACAAGCGTAGTGTGATAATACCAGA TAATAAGGAAAACACTCATAAATATACAAAACTTTTTCAGTGTGGAGTACATTTTTCCAATCACAGGAACTTCAACTGTTG TGAGAAATGTTTATTTTTGTGGCACTGTATATGTTAAGAAATTTTATTTTAAAAAATATAAAGGTTAACGTCCATAATAAAT ACTTCTCTTTGAAGCTACCTTATCAAGAACGAAAAATCGTATGGGAAGAATCCCCTATTTATCACTGCTATATTAAAATAT ATATATTTTAATTATATTTGACAGGTTTTGCATCTAAATTGACCTATTTATTCATTCTTGATTAAATGCACTGAAAAGTAAAA TTTAAAAGTGGTTGTATCTGAATTTACTGTGGGGATAACATACACTGTAATGGGGAAAAATTACCTAAAACCAATTTCAAA ATGGCTTTCTTTGTATTTCAGTTTAAAAACCCAGTGCATGTACGCCCTCTGAGATGCAATAAACACCTTGAACAAAG 3*10 9 bp 150*10 6 bp 1-5*10 6 bp

3 Proteine costitutive Indispensabili per la sopravvivenza La loro concentrazione deve rimanere costante Proteine adattative Cambiamenti delle condizioni ambientali Produrre risposte metaboliche a specifici segnali Proteine del differenziamento Assunsione ed espressione permanente di nuove funzioni specifiche Fenotipo

4

5

6 In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. Lodish et al Molecular Cell Biology

7

8

9 In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. According to this definition, a gene includes more than the nucleotides encoding the amino acid sequence of a protein, referred to as the coding region.

10 Nei geni degli eucarioti gli enhancers possono distare dalla regione codificante anche più di 50 Kb. Enhancers

11 La struttura primaria delle proteine Presenza o assenza della proteina in un determinato tipo cellulare o in un determinato momento della vita cellulare Destinazione delle proteine allinterno della cellula La struttura primaria di RNA non tradotti Il Genoma cellulare specifica :

12 Alcune sequenze di DNA sono trascritte in RNA che non codifica proteine (e.g., tRNAs, rRNAs, miRNAs)

13

14 Geni di I classe Geni di II classe Geni di III classe rRNA 28S, rRNA 18S, rRNA 5.8S mRNA, U1, U2, U4, U5 snRNAs rRNA5S, tRNA, snRNAU6, scRNAs

15 Un gene………più catene polipeptidiche

16

17

18 Variazioni della sequenza nucleotidica correlate ad alterazioni del fenotipo cellulare Mutazioni

19 Variabilità Genetica Evoluzione

20 Variazioni della sequenza nucleotidica correlate ad alterazioni del fenotipo cellulare Malattie genetiche Ad eredità mendeliana Talassemia, falcemia, fibrosi cistica Fenotipi complessi Neoplasie, malattie degenerative

21

22 Mutazioni somatiche e germinali

23 Oncogeni Geni che controllano la proliferazione, il differenziamento cellulare e lapoptosi Geni che controllano la stabilità del genoma Metabolismo cellulare

24 Mutazioni geniche Variazioni di una singola coppia di basi (single nucleotide polymorphisms SNPs) o di alcune coppie di basi in un tratto della molecola di DNA.

25 Le mutazioni geniche che determinano una variazione quantitativa o qualitativa di una proteina possono causare la comparsa di un fenotipo patologico

26 Le conseguenze che una mutazione genica avrà sullorganismo dipendono: Da quanto è cambiata la sequenza aminoacidica della proteina; Dalla variazione della sua concentrazione intracellulare

27 Extragenica Promotore Introni Siti di splicing Sequenza codificante Localizzazione

28 CDS

29 Tipo di mutazione Sostituzione (silent, synonymous, missense nonsense) Inserzione o Delezione (frameshift mutations)

30

31

32

33 Scientists are now learning that many polymorphisms actually do affect a person's characteristics, though in more complex and sometimes unexpected ways. SNP Single nucleotide polymorphism

34 Variations Causing Latent Changes They may also explain why one person responds to a drug treatment while another does not. Finally, there are genetic variations that have "latent" effects. These variations, found in coding and regulatory regions, are not harmful on their own, and the change in each gene only becomes apparent under certain conditions. Such changes may eventually cause some people to be at higher risk for cancer, but only after exposure to certain environmental agents.

35

36 Autosomal X- Linked Y- Linked Mitochondria l Total * Gene with known sequence Gene with known sequence and phenotype # Phenotype description, molecular basis known % Mendelian phenotype or locus, molecular basis unknown Other, mainly phenotypes with suspected mendelian basis Total OMIM Statistics for May 18, 2005

37 Identificazione e Caratterizzazione di Oncogeni

38 Cancer Genome Anatomy Project

39 Dividere la popolazione in gruppi in base a specifici profili di SNPs e ricercare le associazioni con la risposta a specifiche terapie

40 Human Genome Project 1990 – 2001 – 20?? Principale Obiettivo: Studio delle malattie genetiche Determinare la sequenza completa del genoma umano e conservare questa informazione nei data-bases; Identificare tutti i geni presenti nel DNA di Homo sapiens sapiens; Ideare e/o migliorare i tools per lanalisi dei dati; Applicazioni biotecnologie

41 Tutte le malattie hanno una componente genetica, oltre alle classiche malattie genetiche, la risposta a stress ambientali, a virus a tossine dipendono dal genoma individuale. Variazioni della sequenza del genoma quindi causano o contribuiscono allinsorgenza di malattie.

42 Diagnosi Cura Prevenzione

43 carrier screening, which involves identifying unaffected individuals who carry one copy of a gene for a disease preimplantation genetic diagnosis prenatal diagnostic testing newborn screening presymptomatic testing for predicting adult-onset disorders such as Huntington's disease presymptomatic testing for estimating the risk of developing adult-onset cancers and Alzheimer's disease confirmational diagnosis of a symptomatic individual forensic/identity testing

44 Identificare nuovi farmaci per la cure di specifiche malattie Farmacogenomica Terapia Genica Terapia

45

46

47 Identificazione di mutazioni di tumor suppressor genes che predispongono allinsorgenza di neoplasie Prevenzione

48 International Human Genome Sequencing Consortium Nature ottobre 2004

49 A B D Genes Functions C

50 This form of combinatorial coding endows an organism with n genes to create, in theory, 2 n different cell-specific gene batteries. This rationalization provides an easy explanation for the fact that the absolute number of genes in a genome does not correlate with organismal complexity Create cellular complexity by differential genes expression Hobert (2004) TIBS

51

52 International Human Genome Sequencing Consortium Nature ottobre 2004

53 Conserved non genic sequence Emmanouil et al. (2005) Nature Reviews Genetics

54 Conserved non genic sequence

55 Prossimi obiettivi da raggiungere Identificazione di tutti i polimorfismi genetici della popolazione umana, per facilitare lo studio della loro associazione con fenotipi patologici Identificazione di tutti gli elementi funzionali del genoma umano, cioè geni, proteine di regolazione dellespressione genica, sequenze regolatrici e sequenze strutturali.

56 Proteoma Interactoma Genoma Proteoma

57 Mappa delle principali vie di segnalazione importanti per il cancro in cellule umane. Indica le posizioni cellulari di alcune proteine modificate da mutazioni e coinvolte nella patogenesi di tumori.

58

59 Ruolo fondamentale della Biologia in Medicina

60 More Powerful Medicines Better, Safer Drugs the First Time More Accurate Methods of Determining Appropriate Drug Dosages Better Vaccines Improvements in the Drug Discovery Decrease in the Overall Cost of Health Care

61 Terapia genica


Scaricare ppt "Corso di Formazione Siracusa 28 maggio 2005 La Biologia Molecolare nel Laboratorio di Patologia Clinica Geni e Malattie Dipartimento di Scienze Biomediche."

Presentazioni simili


Annunci Google