La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Nanostrutture statiche e ramificate basate sulla stabilità e specificità negli accoppiamenti fra le basi del DNA DNA is every designers dream, being at.

Presentazioni simili


Presentazione sul tema: "Nanostrutture statiche e ramificate basate sulla stabilità e specificità negli accoppiamenti fra le basi del DNA DNA is every designers dream, being at."— Transcript della presentazione:

1 Nanostrutture statiche e ramificate basate sulla stabilità e specificità negli accoppiamenti fra le basi del DNA DNA is every designers dream, being at the same time the blueprint of the structure and the structure itself [N.C. Seeman]

2 The nucleic-acid system that operates in terrestrial life is optimized (through evolution) chemistry incarnate. Why not use it... to allow human beings to sculpt something new, perhaps beautiful, perhaps useful, certainly unnatural. Roald Hoffmann, su American Scientist, 1994 Il DNA è il perfetto mattone per nanotech: 2 nm diametro, 3.4 nm ripetizione, 50 nm persistence length, pienamente nel campo dei nanometri, come dimensioni e struttura. La coesione delle sticky-ends è probabilmente lesempio migliore di riconoscimento molecolare programmabile:cè una significativa diversità per le possibili sticky ends (4 N per code lunghe N) e il prodotto formato nel punto di coesione è la classica doppia elica. Inoltre, la convenienza della sintesi su supporto solido rende accessibile la programmazione di sequenze differenti di code coesive. In conclusione, le sticky ends permettono la previsione dellassociazione intermolecolare e il controllo della geometria al punto di coesione. PERCHÉ GLI ACIDI NUCLEICI. È possibile che si possa ottenere una simile affinità utilizzando antigeni ed anticorpi, ma, a differenza del DNA, lorientazione relativa di antigene e anticorpo dovrebbe essere determinata volta per volta. Per questo gli acidi nucleici sono unici, forniscono un sistema programmabile e facilmente trattabile con controllo delle interazioni intermolecolari ed una struttura nota per i complessi formati. Perché costruire con il DNA? (ma magari non con quello lineare) Una via generale alla cristallizzazione di molecole refrattarie

3 Watson-Crick Model of the DNA

4 DNA Denaturing

5 Correlation diagram between experimental melting temperatures [1] and theoretically evaluated stacking energies of dinucleotide steps in B-DNA conformation. Total stacking energies were obtained by quantum chemical calculations [2,3]. [1] Gotoh, O.; Tagashira, Y. Biopolymers 1981, 20, [2] Ornstein, R. L.; Rein, R.; Breen, D. L.; Macelroy, R. D. Biopolymers 1978, 17, [3] Saenger, W. Principles of nucleic acid structure, , C. R. Cantor, Editor,Springer-Verlag- NY The melting temperatures correlate with the staking energies

6 G-G Base Stacking

7 3 legami idrogeno invece di 2?

8 Ma qual è il ruolo del legame idrogeno?

9

10

11 DNA Denaturing and Renaturing

12

13 Dal DNA lineare a quello ramificato: la giunzione di Holliday come elemento per nanocostruzioni DNA Duplex, la maggior parte degli acidi nucleici è sotto forma di molecole lineari La giunzione di Holliday, un intermedio della ricombinazione

14 J1 JUNCTION J1 = Holliday junction con sequenza modificata in modo da interrompere la simmetria che ne causa la migrazione nei cromosomi omologhi. STRUTTURA STABILE Importante per: 1- studi sulla struttura della giunzione di Holliday 2- mattone strutturale nelle Nanotecnologie basate su DNA Nadrian C. Seeman (Seeman, N. C. (1982) J. Theor. Biol. 99, ) È lunica forma in cui queste catene possono appaiarsi completamente e fare eliche di W-C.

15

16 A parallelogram can be obtained by ligation of J1 junctions terminated with sticky-ends Tailoring a parallelogram

17 Or, alternatively, by the self-assembly of a smaller number of longer oligonucleotides of properly designed sequence.

18 What do we need? 1.Designing the sequences 2.Synthesis of the oligos 3.Purification of the oligos by PAGE

19 Designing the sequences The design problems of these sequences are not exclusive to structural DNA nanotechnology but also arise in other fields such as probe selection for DNA microarrays or primer design for PCR. However, the complexity of the self-assembly required to form even the most simple DNA architectures is usually much higher than that required by other such applications. The design of more than just a handful of sequences meeting the desired criteria makes the use of computer programs indispensable. (71 A. Brenneman and A. Condon, Strand design for biomolecular computation, Theor. Comput. Sci. 287 (2002), pp. 39–58. The pipeline for the design of a DNA nanostructure begins with the definition of the number, length and mutual connections of all the component oligonucleotides, keeping the intended topology of the assembly clear in mind. Then the base sequences are chosen, obeying a set of criteria most commonly based on the minimization of sequence symmetry and energy. ( N.C. Seeman, Nucleic acid junctions and lattices, J. Theor. Biol. 99 (1982), pp. 237–247.; N.R. Kallenbach et al., An immobile nucleic acid junction constructed from oligonucleotides, Nature 305 (1983), pp. 829–831). Sometimes, however, sequence symmetry can be intentionally included and exploited advantageously. The ongoing development also tries to take into account the kinetic features of the energy landscape of the assembly in order to avoid trapping the assembling structures into unwanted stable by-products that would be alternative to the target structure. We foresee the need for design tools that could also implement the concepts of hierarchical assembly and permit the organization of different stability regions for different hierarchy levels within one superstructure. Additional characteristics that could be required are the inclusion or exclusion of sub- sequences of biological or biochemical relevance (e.g. promoters, restriction sites and deoxyribozymes)

20 What do we need? 1.Designing the sequences 2.Synthesis of the oligos 3.Purification of the oligos by PAGE

21 PAGE monoacrilammide N,N metilen bisacrilammide Ammonio persolfato (donatore di radicali) TEMED (catalizzatore formazione radicali)

22 What do we need? 1.Synthesis of the oligos 2.Purification of the oligos by PAGE 3.Thermal annealing (TAE buffer + Mg 2+ ions)

23 StrandsTilesPolymers [E.A.Fogleman, et.al Angew. Chem. Int. Ed. 41 (2002) ] Once the desired set of strands is appropriately designed and synthesized, the assembly of the complete structure can be as simple as mixing all the components at high temperature and then letting them cool down over periods of time up to a few days, in a near-equilibrium regime.

24 What do we need? 1.Synthesis of the oligos 2.Purification of the oligos by PAGE 3.Thermal annealing (TAE buffer + Mg 2+ ions) 4.Characterization of the construct by PAGE

25 Gel non denaturante 10% poliacrilammide, 4°C pBR322 marker M Caratterizzazione mediante PAGE

26 Gel non denaturante 10% poliacrilammide, 4°C pBR322 marker M Caratterizzazione mediante PAGE

27 Gel non denaturante 10% poliacrilammide, 4°C pBR322 marker M Caratterizzazione mediante PAGE

28 Gel non denaturante 10% poliacrilammide, 4°C pBR322 marker M Caratterizzazione mediante PAGE

29 1 3 Gel non denaturante 10% poliacrilammide, 4°C pBR322 marker M Caratterizzazione mediante PAGE

30 5 Gel non denaturante 10% poliacrilammide, 4°C pBR322 marker M Caratterizzazione mediante PAGE

31 What do we need? 1.Synthesis of the oligos 2.Purification of the oligos by PAGE 3.Thermal annealing (TAE buffer + Mg 2+ ions) 4.Characterization of the construct by PAGE 5.Characterization of the construct by AFM imaging

32 Hierarchic Polymerization Level 0 (Strands) Level 1 (Tiles) Level 2 (Polymers) Joining of sides Joining of sticky ends Joining of sides Joining of sticky ends Brucale M, Zuccheri G, Rossi L, et al. Characterization and modulation of the hierarchical self-assembly of nanostructured DNA tiles into supramolecular polymers ORGANIC & BIOMOLECULAR CHEMISTRY 4 (18): origami

33 Progettazione e sintesi di costrutti supramolecolari di DNA

34

35

36

37

38 (Shih et al. Nature 2004) Un ottaedro autoassemblante fatto di 1.7 kb di DNA Una struttura formata da un tratto di DNA di 1669 nt che si autoassembla assieme a 5 oligo di 40 nt (azzurri) per dare una struttura ottaedrica. Di notevole interesse la dimensione della struttura risultante ed il fatto che il costituente fondamentale della struttura può essere amplificato con la DNA polimerasi non avendo alcun blocco topologico. DX PX

39

40 (da RASHID AMIN et al. NANO: Vol. 4, No. 3 (2009) 119–139)

41 Most of the ongoing development of DNA-based nanostructures aims to expand their complexity over spatial and temporal dimensions through hierarchical integrations of elementary structural and functional units. Nature Mar 16;440(7082):

42 | | | | | | | | | | | | Un tessuto molecolare ottenuto mediante assemblaggio di crossover su un lungo DNA naturale, grazie allaggiunta di oligo di sintesi si sequenza opportuna. proposto da John Reif

43 a 7-kilobase single-stranded scaffold + over 200 short oligonucleotide staple strands to hold the scaffold in place (Rothemund, Nature 2006). structures are roughly 100 nm in diameter and approximate desired shapes, with pixel of 6-nm, The structural programmability of DNA for large-scale surface nanopattering glue

44 ES Andersen et al. Nature 459, (2009) doi: /nature07971 Design of a DNA origami box.

45

46 NANOMOTORI A DNA La dimensione temporale per le DNA nanotechnologies È importante sviluppare metodi che permettano una funzionalità delle nanostrutture. Queste possono avere proprietà modulabili mediante stimoli esterni, determinati dalloperatore o dalla presenza od assenza di reagenti che dipendono da altri processi. Questa funzionalità può servire per mettere in movimento parti di una nanostruttura (per spostate nano-oggetti in una nanofabbrica o per accendere o spegnere reazioni) o per permettere o vietare reazioni a carico di una struttura. È fiorente la ricerca di interruttori molecolari di nuovo tipo per applicazioni di nanoelettronica. Unaltra applicazione importante è la sensoristica: avere strutture che si comportino in modo diverso in presenza di una proteina o una sequenza di un acido nucleico è un modo per rilevarli, lamplificazione di un segnale biochimico può essere ottenuta per via nanotecnologica.

47 Il principio dello strand-exchange isotermo tra molecole di DNA È possibile sostituire uno strand accoppiato in una doppia elica con un altro in soluzione lavorando a temperatura costante (al di sotto della temperatura di melting) e senza denaturanti. Si sfrutta il fenomeno della nucleazione ed, in seguito, la reazione procede grazie alla spinta di una maggiore stabilità termodinamica di una nuova doppia elica più lunga (e più stabile) che si forma. Serve che ci sia una coda spaiata che possa servire da sito di nucleazione stabile termicamente più stabile termicamente

48 Il primo nanomotore a DNA: Bernard Yurke e Andrew Turberfield (2000) Un motore costituito di oligonucleotidi che si riorganizzano in risposta allintroduzione di oligo in soluzione, aprendo e chiudendo le punte di una pinzetta molecolare. Il movimento è visualizzato mediante FRET. Il metodo per togliere un componente dalla struttura è molto furbo ed efficiente: è stato copiato da molti successori. Sfrutta la presenza di una coda a ssDNA nelloligo poi da estrarre per fare nucleare una nuova catena ed estrarre loligo (assieme a quello complementare) come dsDNA a temperatura ambiente, senza dover disassemblare niente altro: apertura sequenza specifica (anche nel caso della presenza di altri motori analoghi)

49 Il motore di Yurke alterna tra due strutture, una che contiene uno snodo a singola catena per cui la sua forma non è rigidamente definita, ed una in cui la struttura è tenuta bloccata ed è quasi tutta a doppia elica. Nella prima pinzetta, la forma rigida è quella con piccola distanza tra le code. In una versione alternativa del motore (qui mostrata) Yurke e collaboratori realizzano un nanomotore simila in cui la forma rigida, essenzialmente dsDNA è quella con alta distanza tra le code, mentre quella flessibile, con estese parti ssDNA ha le code (ed i fluorofori) più vicini. Anche per questo motore, i segnali di apertura e chiusura sono laggiunta di oligo sequenza-specifici. Ugualmente, si accumulano rifiuti di dsDNA ciclo dopo ciclo. Negli schemi, F sta per fuel strand il carburante del motore.

50 Svantaggi dei principali tipi di Macchine Molecolari basate sul DNA 1.Produzione di molecole rifiuto progressivo peggioramento delle prestazioni 2.Necessità di eventi bi-macromolecolari dipendenza del funzionamento dalla concentrazione dipendenza del funzionamento dalla mobilità di molecole ingombranti (funzionamento influenzato dallintorno della macchina) segnali di apertura e chiusura affidati a molecole costose.

51 Progettazione di un nanomotore basato sulla triplex Marco Brucale et al.

52 Progettazione / 2 Il rifiuto accumulato non interferisce con il funzionamento del motore fino a concentrazioni nellordine dell1M o più.

53 Caratterizzazioni statiche Spettro CD del costrutto a differenti pH. Assorbanza a 260 nm a differenti pH. Mobilità elettroforetica del costrutto con TFO e di un analogo senza TFO (oligo C non può ripiegare)

54 Caratterizzazioni dinamiche / 1 Emissione di fluorescenza di A+B* con pH alternante tra 5 e 9 Intensità dipendente esclusivamente dalla separazione della coppia E-Q Diminuzione dellintensità = lineare (pendenza = diluizione) nessuna diminuzione di rendimento dovuto allaccumulo di rifiuto E Q E Q

55 Caratterizzazioni dinamiche / 2 Ripetizione dellesperimento ad alta diluizione Si evidenzia il medesimo comportamento.

56 Seeman e coll.: una macchina molecolare basata su una transizione B Z. Un tratto di DNA di opportuna sequenza per effettuare la transizione da B a Z è stato inserito tra due strutture DX rigide (che portavano fluoroforo e quencher). Allaggiunta di un opportuno reagente, la transizione ha luogo, facendo ruotare le strutture DX tra loro e spostando i fluorofori Svantaggi: difficile eseguire il movimento avanti e indietro tante volte; tutte le sequenze presenti che possono fare B Z lo fanno in quelle condizioni: poco specifico.

57 Un bipede di DNA che cammina lungo un marciapiede (Sherman e Seeman, NanoLetters 2004) Un modo per avere un accurato controllo spaziale della posizione e del moto di un nanomotore semovente. Sfrutta il metodo di Yurke e Turberfield per rimuovere oligo da doppie eliche a T

58 Pioneering work by Leonard M. Adleman of USC To build a computer, it is necessary to have (1) a method to store information (2) a few simple operations to act on that information Modern electronic computers store information as sequences of zeroes and ones in memory and manipulate this information using the operations available on the processor chip Early Turing machines (1930s) stored information as sequences of letters on tape and manipulated that information with simple instructions in the finite control

59 Turing wrote that the Turing machine, here called a Logical Computing Machine, consisted of:..an infinite memory capacity obtained in the form of an infinite tape marked out into squares, on each of which a symbol could be printed. At any moment there is one symbol in the machine; it is called the scanned symbol. The machine can alter the scanned symbol and its behavior is in part determined by that symbol, but the symbols on the tape elsewhere do not affect the behavior of the machine. However, the tape can be moved back and forth through the machine, this being one of the elementary operations of the machine. Any symbol on the tape may therefore eventually have an innings.(Turing 1948) Turing machine The "Turing" machine was described by Alan Turing in 1937 Alan Turing

60 DNA is a multicode information system. The code is any pattern or bias in the sequence which corresponds to one or another specific biological function or interaction (Trifonov,1989) triplet code, transcription code, gene splicing code, translation framing code……. DNA is a great way to store information Molecular biology operates on this information

61 In particular enzymes such as polymerases and ligases operate on this information. This is the basis for DNA computing. Adleman solved the Hamitonian Path problem using this idea.

62 DETROIT BOSTON ATLANTA CHICAGO Consider the map of cities (called graph) The arrows (directed edges) represent nonstop flights between the cities (vertices) Determine if a sequence of connecting flights (path) exists that starts in Atlanta (the start vertex) and ends in Detroit (the end vertex), while passing through each of the remaining cities - Boston & Chicago - only once. Hamiltonian Path Proble The case shown here is trivial; a Hamiltonian path does exist: Atlanta, Boston, Chicago, Detroit If the start city was Detroit and the end city, Atlanta, then, no Hamiltonian Path exists

63 Given a graph with directed edges, and a specified start vertex and an end vertex, -There is a Hamiltonian Path if and only if -There is a path that starts on the start vertex and ends on a end vertex and passes through each remaining vertex only once Hamiltonian path problem is to decide for any given graph with any number of vertices and with start and end vertices specified, if a Hamiltonian path exists or not No efficient algorithm exists -Even with best algorithms and computers, some graphs with about 100 vertices for which solving Hamiltonian path problem would take hundreds of years!

64 Given a graph with N vertices (1)Generate a set of random paths through the graph (2)For each path in the set (a)Check if that path starts on the start vertex and ends with the end vertex; if not, remove that path from the set (b)Check if that path passes through exactly N vertices; if not, remove that path from the set (c)For each vertex, check if that path passes through that vertex; if not, remove that path from the set (3)If the set is not empty, there is a Hamiltonian path; if the set is empty, then there is no Hamiltonian path Generation of paths should be random and the resulting set should be large enough

65 The approach Encoding: Map problem instance onto set of biological molecules and molecular biology protocols Molecular Operations: Let molecules react to form potential solutions Extraction/Detection: Use protocols to extract result in molecular form

66 Suppose that I live in LA, and need to visit four cities: Houston, Chicago, Miami, and NY, with NY being my final destination. The airline Im taking has a specific set of connecting flights that restrict which routes I can take (i.e. there is a flight from L.A. to Chicago, but no flight from Miami to Chicago). What should my itinerary be if I want to visit each city only once? Starting from L.A. you need to fly to Chicago, Dallas, Miami and then to N.Y. Any other choice of cities will force you to miss a destination, visit a city twice, or not make it to N.Y.

67 Adleman first generated all the possible itineraries and then selected the correct itinerary. This is the advantage of DNA. Its small and there are combinatorial techniques that can quickly generate many different data strings. Since the enzymes work on many DNA molecules at once, the selection process is massively parallel. Specifically, the method based on Adlemans experiment would be as follows: 1 Generate all possible routes. 2 Select itineraries that start with the proper city and end with the final city. 3 Select itineraries with the correct number of cities. 4 Select itineraries that contain each city only once. All of the above steps can be accomplished with standard molecular biology techniques.

68 Part I: Generate all possible routes Strategy: Encode city names in short DNA sequences. Encode itineraries by connecting the city sequences for which routes exist. DNA can simply be treated as a string of data. For example, each city can be represented by a "word" of six bases: Los Angeles: GCTACG Chicago: CTAGTA Dallas: TCGTAC Miami: CTACGG New York: ATGCCG The entire itinerary can be encoded by simply stringing together these DNA sequences that represent specific cities. For example, the route from L.A -> Chicago -> Dallas -> Miami -> New York would simply be GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could be represented in double stranded form with its complement sequence.

69 Encode the routes between cities by encoding the compliment of the second half (last three letters) of the departure city and the first half (first three letters) of the arrival city. For example the route between Miami (CTACGG) and NY (ATGCCG) can be made by taking the second half of the coding for Miami (CGG) and the first half of the coding for NY (ATG). This gives CGGATG. By taking the complement of this you get, GCCTAC, which not only uniquely represents the route from Miami to NY, but will connect the DNA representing Miami and NY by hybridizing itself to the second half of the code representing Miami (...CGG) and the first half of the code representing NY (ATG...). For example:

70 Random itineraries can be made by mixing city encodings with the route encodings. Finally, the DNA strands can be connected together by an enzyme called ligase. What we are left with are strands of DNA representing itineraries with a random number of cities and random set of routes. For example: We can be confident that we have all possible combinations including the correct one by using an excess of DNA encodings, say copies of each city and each route between cities.

71 Part II: Select itineraries that start and end with the correct cities Strategy: Selectively copy and amplify only the section of the DNA that starts with LA and ends with NY by using the Polymerase Chain Reaction. After Part I, we now have a test tube full of various lengths of DNA that encode possible routes between cities. What we want are routes that start with LA and end with NY. To accomplish this we can use a technique called Polymerase Chain Reaction (PCR), which allows you to produce many copies of a specific sequence of DNA. So to selectively amplify the itineraries that start and stop with our cities of interest, we use primers that are complimentary to LA and NY. What we end up with after PCR is a test tube full of double stranded DNA of various lengths, encoding itineraries that start with LA and end with NY.

72 Part III: Select itineraries that contain the correct number of cities. Strategy: Sort the DNA by length and select the DNA whose length corresponds to 5 cities. Our test tube is now filled with DNA encoded itineraries that start with LA and end with NY, where the number of cities in between LA and NY varies. We now want to select those itineraries that are five cities long. To accomplish this we use Gel Electrophoresis We can then cut out the band of interest to isolate DNA of a specific length. Since we known that each city is encoded with 6 base pairs of DNA, knowing the length of the itinerary gives us the number of cities. In this case we would isolate the DNA that was 30 base pairs long (5 cities times 6 base pairs).

73 Part IV: Select itineraries that have a complete set of cities Strategy: Successively filter the DNA molecules by city, one city at a time by affinity purification: the compliment of the sequence in question to a substrate like a magnetic bead. The beads are then mixed with the DNA. DNA, which contains the sequence you're after then hybridizes with the complement sequence on the beads. These beads can then be retrieved and the DNA isolated. So we now affinity purify fives times, using a different city complement for each run. If an itinerary is missing a city, then it will not be "fished out" during one of the runs and will be removed from the candidate pool. What we are left with are the are itineraries that start in LA, visit each city once, and end in NY. This is exactly what we are looking for. If the answer exists we would retrieve it at this step.

74 Reading out the answer: simply sequence the DNA strands. However, since we already have the sequence of the city encodings we can use an alternate method called graduated PCR. Here we do a series of PCR amplifications using the primer corresponding to L.A., with a different primer for each city in succession. By measuring the various lengths of DNA for each PCR product we can piece together the final sequence of cities in our itinerary. For example, we know that the DNA itinerary starts with LA and is 30 base pairs long, so if the PCR product for the LA and Dallas primers was 24 base pairs long, you know Dallas is the fourth city in the itinerary (24 divided by 6). Finally, if we were careful in our DNA manipulations the only DNA left in our test tube should be DNA itinerary encoding LA, Chicago, Miami, Dallas, and NY. So if the succession of primers used is LA & Chicago, LA & Miami, LA & Dallas, and LA & NY, then we would get PCR products with lengths 12, 18, 24, and 30 base pairs.

75

76

77 DNA Computing: DNA vs. Silicon ( For DNA computing, though, the power comes from the memory capacity and parallel processing. For example, let's look at the read and write rate of DNA. In bacteria, DNA can be replicated at a rate of about 500 base pairs a second. But this is only 1000 bits/sec, which is a snail's pace when compared to the data throughput of an average hard drive. But if you allow many copies of the replication enzymes to work on DNA in parallel. First of all, the replication enzymes can start on the second replicated strand of DNA even before they're finished copying the first one. So already the data rate jumps to 2000 bits/sec. But look what happens after each replication is finished - the number of DNA strands increases exponentially (2^n after n iterations). With each additional strand, the data rate increases by 1000 bits/sec. So after 10 iterations, the DNA is being replicated at a rate of about 1Mbit/sec; after 30 iterations it increases to 1000 Gbits/sec. This is beyond the sustained data rates of the fastest hard drives.

78 Extremely dense information storage -1 gm of DNA (when dried, occupies 1 cm 3 ) equivalent to 1 trillion CDs (but using his method to solve a 200 city HP problem would take an amount of DNA that weighed more than the earth) Enormous parallelism Error correcting codes are needed -Biological operations are imperfect ( are not deterministic but stochastically driven: error rate of 1% is fine for 10 iterations, giving less than 10% error, but after 100 iterations this error grows to 63% )

79 CONCLUSION: So will DNA ever be used to solve a traveling salesman problem with a higher number of cities than can be done with traditional computers? Well, considering that the record is a whopping 13,509 cities, it certainly will not be done with the procedure described above. It took this group only three months, using three Digital AlphaServer 4100s (a total of 12 processors) and a cluster of 32 Pentium-II PCs. The solution was possible not because of brute force computing power, but because they used some very efficient branching rules. This first demonstration of DNA computing used a rather unsophisticated algorithm, but as the formalism of DNA computing becomes refined, new algorithms perhaps will one day allow DNA to overtake conventional computation and set a new record

80 On the side of the "hardware" (or should I say "wetware"), improvements in biotechnology are happening at a rate similar to the advances made in the semiconductor industry. For instance, look at sequencing; what once took a graduate student 5 years to do for a Ph.D thesis takes Celera just one day. With the amount of government funded research dollars flowing into genetic-related R&D and with the large potential payoffs from the lucrative pharmaceutical and medical-related markets, this isn't surprising. Just look at the number of advances in DNA-related technology that happened in the last five years: "DNA chips," the Human Genome Project is producing rapid innovations in sequencing technology. The future of DNA manipulation is speed, automation, and miniaturization.

81 Considering all the attention that DNA has garnered, it isnt too hard to imagine that one day we might have the tools and talent to produce a small integrated desktop machine that uses DNA, or a DNA-like biopolymer, as a computing substrate along with set of designer enzymes. Perhaps it wont be used to play Quake IV or surf the web -- things that traditional computers are good at -- but it certainly might be used in the study of logic, encryption, genetic programming and algorithms, automata, language systems, and lots of other interesting things that haven't even been invented yet.

82 What are the long-term prospects? Cross-fertilization among evolutionary computing, DNA computing, molecular biology, and computational biology Niche uses of DNA computers for problems that are difficult for electronic computers In Vitro Translation and Transcription Computing-Two-Lectures-Combined

83 DNA Computing in Cells Source:

84 DNA computer chip By Paul W. K. Rothemund (CalTech) and Gregory M. Wallraff (IBM) and coll. Nature Nanotech 2009 combination of DNA origami directed self- assembly with todays fabrication technology Positioned DNA nanostructures can serve as scaffolds, or miniature circuit boards, for the precise assembly of components – such as carbon nanotubes, nanowires and nanoparticles – at dimensions significantly smaller than possible with conventional semiconductor fabrication techniques

85 The semiconductor industry is currently faced with the challenges of developing lithographic technology for feature sizes below 22 nm exploring new classes of transistors that use carbon nanotubes or silicon nanowires.

86 Macro Microscopic Sub-micro Nanoscopic Sub-nano 1 mm 1,000 m 100 m 10 m 1 m 1,000 nm 100 nm 10 nm 1 nm 0.1 nm 1 A Bulk Materials Microfabrication Miniaturization Nanostructured Materials Nanofabrication Molecular Manufacturing Nanotechnology Microtechnology Top-Down Approach Bottom-Up Approach A major goal

87 Artificial DNA can be synthesized with attachment groups (such as biotin or single-stranded DNA hooks) at defined locations, which can bind objects such as gold nanoparticles. Easily designed in arbitrary shapes, DNA origami typically carry 200 such independently addressable sites at a resolution of 6 nm.

88 Random deposition on mica of the self-assembled triangular DNA origami in solution (a technique ill-suited for integration with microfabrication) DNA origami are just large enough (here 127-nm-sided triangles are used) that their largest feature, their outline, can match the smallest features generated by lithography.

89 Trimethylsilyl (TMS) monolayer and diamond-like carbon (DLC) films + substrate + photoresist The photoresist is exposed with the desired pattern of DNA origami binding sites (features), and developed to reveal the template layer at those sites. A dry oxidative etch step is then used to differentiate the template layer and render it sticky for DNA origami.. Silanol groups occur in oxidized areas of the TMS monolayers. Next, the photoresist is stripped to uncover areas designated non-sticky (background) Create sticky patches, in the shape and size of a DNA origami, by chemically differentiating lithographic features

90 Finally, nanomolar concentrations of origami are bound to the patterned substrate with high concentrations of divalent cations, here MgCl2 (in Tris-acetate-EDTA [TAE] buffer), with incubation times of minutes to hours.

91 Alignment of DNA origami on SiO2 and diamond-like carbon (DLC) surfaces Untreated TMS surfaces remain hydrophobic, whereas those areas exposed to O2 plasma (a) or UV-ozone (b) become hydrophilic (contact angle,108, presumably due to silanol groups) and exhibit high selectivity for binding DNA origami.

92 Dynamic binding of DNA origami under atomic force microscopy (AFM). Frames from an AFM height movie show the dynamics of binding at sites of different sizes. AFM is performed under 10 TAE buffer with 100–125 mM MgCl2

93 Placement of triangles onto a variety of shapes.

94 The adsorption of origami to dry etch-oxidized features is highly sensitive to salt concentration on both TMS/SiO2 and DLC/DLC surfaces. No binding when origami were deposited in 12.5 mM MgCl2 with 1 TAE buffer (40 mM Tris acetate, 1 mM EDTA, 2 mM Na+), the conditions under which DNA origami are formed and bind well to mica. A 10-fold more concentrated buffer (100–125 mM MgCl2/9–10 TAE) gave quantitative adsorption of origami to binding sites on both surfaces Binding on line features decreased as MgCl2 increased to 1 M These decreases in adsorption are similar to that observed for duplex DNA on mica when Mg2+ is increased to 1 M. Salt concentration effects

95 IBM scientists create DNA computer chip The cost involved in shrinking features to improve performance is a limiting factor in keeping pace with Moores Law and a concern across the semiconductor industry,……. The combination of this directed self-assembly with todays fabrication technology eventually could lead to substantial savings in the most expensive and challenging part of the chip-making process,

96 I legami chimici sfruttati per accoppiare gli acidi nucleici con altri oggetti possono essere i più svariati: sicuramente la nanotecnologia abbisogna di nuove tipologie di funzionalizzazione, per cercare di ottenere la maggiore varietà ed il maggiore controllo di funzionalizzazioni alternative Ad esempio, per legare un oligo ad una superficie si può utilizzare il legame tra lo zolfo e loro. Questo porta alla creazione di strati regolari autoassemblati nel giro di poche ore/giorni. Altre funzionalizzazioni del DNA che si possono sfruttare sono quelle con il gruppo amminico. Sulle superfici si può ad esempio utilizzare la chimica dei silani. Per legare le proteine, si possono impiegare cisteine esposte, o code istidiniche (attraverso lNTA). Le superfici a volte pongono problemi per le proteine, che interagendo con esse si denaturano. Il DNA può avere interazioni non specifiche, che limitano la sua disponibilità per legami specifici: é importante il trattamento superficiale.

97 Putting the device on a surface Si O O O SH R 1 SS(L)-Oligo A pH 9.0 buffer 16h Si O O O SS(L) glass Si O O O SS(L) Oligo B* pH 5.0 buffer 16h glass MPTS 95% EtOH 5% H 2 O pH h 2h 150°C 0.05 torr MPTS gas phase a) b) glass

98 Costruzioni sulle superfici La localizzazione su superfici rappresenta un modo facile per immobilizzare un nano-oggetto in una posizione precisa e fissata dello spazio, per poterlo utilizzare ma anche per poterlo studiare. La presenza stessa della superficie comporta delle alterazioni del comportamento delle molecole, che non sono più libere di muoversi come nello spazio della soluzione (effetti di volume escluso). In condizioni di equilibrio, la riduzione della dimensionalità del sistema dovuto alla presenza della superficie comporta un incremento drastico della concentrazione delle molecole reagenti. Ecco due esempi di uso del DNA per creare strati di proteine su superfici o per localizzare in modo specifico proteine per fare protein-chip.

99 La rivelazione della presenza di sequenze di DNA grazie alla formazione di addotti più grandi a partire da particelle colloidali (laboratori di Mirkin e Alivisatos) Il colore delle particelle colloidali, a parità di altre condizioni, dipende dalla loro dimensione (fenomeno della risonanza superficiale di plasmoni): particelle di oro di nm di diametro sono di colore rosso, mentre aggregati più grandi hanno colore apparente azzurrino. Questo può essere usato per fare un test colorimetrico della presenza di un tratto di DNA.

100 Scanometric detection of DNA hybridization (Chad Mirkin) Secondo lo stesso schema, sferette di oro colloidale possono essere attaccate ad una sequenza sonda legata alla superficie solo se in soluzione è presente una sequenza di DNA con tratti complementari ad entrambi (loligo sulla particella non è complementare a quello sulla superficie). La presenza di particelle di diversa dimensione, legate precedentemente ad oligo diversi propone un metodo colorimetrico per determinare quale sequenza è presente (ad esempio permette di visualizzare su un singolo pozzetto polimorfismi del tratto di sequenza complementare a quella sulla nanoparticella). In seguito al legame, è possibile fare crescere di dimensioni le particelle doro, mediante riduzione di Ag + in soluzione: lo strato di argento metallico cresce solo dove cè loro, ingrossando la particella presente in corrispondenza della sequenza riconosciuta. Dopo opportuna crescita le particelle si fondono e creano una zona di colore scuro, visibile ad occhio nudo: è un modo di leggere i microarray mediante un semplice ed economico scanner ottico da computer!


Scaricare ppt "Nanostrutture statiche e ramificate basate sulla stabilità e specificità negli accoppiamenti fra le basi del DNA DNA is every designers dream, being at."

Presentazioni simili


Annunci Google