La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

T G C A Sequenziamento enzimatico del DNA (Sanger)

Presentazioni simili


Presentazione sul tema: "T G C A Sequenziamento enzimatico del DNA (Sanger)"— Transcript della presentazione:

1 T G C A Sequenziamento enzimatico del DNA (Sanger)

2 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 53 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 35

3 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 53 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 35

4 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 53 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 35 TTACGTAACGTCA 53

5 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 53 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 35 TTACGTAACGTCA 53

6 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 53 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 35 TTACGTAACGTCA 53 dATP dCTP dGTP dTTP + DNA Polimerasi

7 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 53 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 35 TTACGTAACGTCAGAACGTCCGGAACGTAGGGGTCGCGCGTT 5 3

8 53 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA 35 TTACGTAACGTCA 53 dA dC dG dT + DNA Polimerasi ddATP ddCTP ddGTP ddTTP dATP dCTP dGTP dTTP + DNA Polimerasi

9 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAG 14 AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAA AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAAC AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACG AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACGT AATGCATTGCAGTCTTGCAGGCCTTGCATCCCCAGCGCGCAA TTACGTAACGTCAGAACGTC

10 Laser Elettroforesi Fluorimetro - +

11 Laser Elettroforesi Fluorimetro - + Lettura ACGTACGT G

12 Laser Elettroforesi Fluorimetro - Lettura ACGTACGT GAAC +

13 Elettroferogramma

14 T G C A Sequenziamento enzimatico del DNA (Sanger)

15

16 Metodi di marcatura degli acidi nucleici

17 Traccianti utilizzati Nucleotidi marcati con isotopi radioattivi

18 Traccianti utilizzati Nucleotidi marcati con sostanze non radioattive

19 Traccianti utilizzati Nucleotidi marcati con sostanze non radioattive - Fluorocromi (marcatura diretta) - Enzimi (perossidasi, fosfatasi alcalina) - Digossigenina (riconosciuta da anticorpi specifici marcati con fluorocromi o enzimi) - Biotina (riconosciuta da avidina marcata con fluorocromi o enzimi)

20 Traccianti utilizzati Fluorocromi

21 Strategie di marcatura Marcatura delle estremità mediante polinucleotide chinasi

22 Strategie di marcatura Sintesi di DNA mediante random priming

23 Strategie di marcatura Nick Translation DNAsi I E. Coli Pol I Attività esonucleasica nucleotidi marcati Attività polimerasica

24 Strategie di marcatura PCR Vantaggi: elevata attività specifica, necessarie poche molecole di stampo

25 Strategie di marcatura Sintesi di RNA antisenso mediante RNA polimerasi

26 Strategie di marcatura Sintesi di cDNA mediante transcrittasi inversa

27 Tecniche di rivelazione degli acidi nucleici basate su ibridazione dopo separazione elettroforetica mediante gel di agarosio. Il Southern blot analizza il DNA, il Northern blot lRNA.

28 Strategia generale

29 Dot blot ABCD Altra forma di ibridazione su membrana: il dot blot (sia con campioni di RNA che di DNA)

30 Preparazione dei campioni prima della corsa elettroforetica 1.Nel southern blot il DNA (sia genomico che plasmidico) viene digerito con enzimi di restrizione. 2.Nel northern lRNA deve essere denaturato. Si può usare RNA totale o RNA messaggero purificato (PolyA + )

31 Cella elettroforetica per gel di agarosio

32 M E6E4 + mRNA DNA satellite 18S 28S 7S - RNA totale DNA genomico

33 Trasferimento capillare da gel di agarosio

34 Trasferimento elettrico da gel di agarosio

35 Membrana dopo trasferimento

36 Marcatura della sonda tramite random priming

37 SOUTHERN BLOT

38 RFLP= restriction fragment length polymorphism

39 Individuazione diretta di mutazioni patogene tramite identificazione di RFLP In rari casi la mutazione patogena può abolire o creare un sito di restrizione

40 I polimorfismi delle VNTR (Variable number of Tandem Repeat) -DNA genomico viene digerito con enzimi ben conservati che Fiancheggiano uno specifico locus VNTR. -Lo schema di RFLP non dipende da RSP, bensì da numero di volte un cui una unità è ripetuta in tandem -sonda: sequenza unica del locus

41 DNA FINGERPRINT (impronta digitale del DNA) -Se il locus VNTR fa parte di una famiglia di DNA ripetitivo, si può usare come sonda una unità ripetuta, al posto di una seq unica del locus -Si produce uno schema polimorfico complesso che permette di discriminare tra due individui qualsiasi che non siano gemelli identici


Scaricare ppt "T G C A Sequenziamento enzimatico del DNA (Sanger)"

Presentazioni simili


Annunci Google