La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Polimorfismi, mutazioni e metodi per evidenziarli.

Presentazioni simili


Presentazione sul tema: "Polimorfismi, mutazioni e metodi per evidenziarli."— Transcript della presentazione:

1 Polimorfismi, mutazioni e metodi per evidenziarli

2 Unità da 5 a 200 bp. Segmenti lunghi fino a qualche centinaio di chilobasi DNA satellite

3 Polimorfismi del DNA: microsatelliti Allele A TACCAAGGTACACACACGGTACCATGG Allele B TACCAAGGTACACACACACGGTACCATGG Allele CTACCAAGGTACACACACACACGGTACCATGG Allele D TACCAAGGTACACACACACACACGGTACCATGG Minisatelliti Unità fino a 5 bp. Segmenti lunghi fino a 25 kb Microsatelliti Unità < 4bp. Segmenti lunghi fino150 bp Allele A TACCAAGGTACGGACGGACGGACGGGGTACCATGG Allele B TACCAAGGTACGGACGGACGGACGGACGGGGTACCATGG

4 Perché i microsatelliti sono così polimorfici?

5 Polimorfismi del DNA: SNP (single nucleotide polymorfism) ---ATGTTGAAGTTCAAGAATTCTGTGCGGAAC ATGTTGAAGTTCAAGTATTCTGTGCGGAAC ATGTTGAAGTTCAAGCATTCTGTGCGGAAC ATGTTGAAGTTCAAGGATTCTGTGCGGAAC---

6 Come evidenziare i polimorfismi? RFLP= restriction fragment length polymorphism

7 Gli RFLP possono evidenziare sia polimorfismi dovuti a mutazione di singoli nucleotidi (che fanno comparire o scomarire siti di restrizione) sia polimorfismi di tipo minisatellite (VNTR = Variable Number of Tandem Repeats)

8 I polimorfismi di tipo microsatellite possono essere evidenziati mediante PCR (STR = Short Tandem Repeat) Due vantaggi principali rispetto agli RFLP: più facili da evidenziare (PCR), e molto più polimorfici (elevato tasso di eterozigosità)

9 I marcatori polimorfici (soprattutto gli STR) sono stati estremamente utili per ottenere una prima mappa globale del genoma umano

10 La mappa genetica ottenuta con i marcatori è fondamentale per mappare i geni responsabili di patologie umane (positional cloning) La posizione di un gene malattia viene definita valutando la frequenza di ricombinazione del carattere fenotipico rispetto ai marcatori polimorfici disponibili (rivedere il concetto di linkage dalla genetica)

11 I marcatori polimorfici sono molto usati nelle indagini di medicina legale (identificazionie di indivudui, attribuzione di paternità/maternità). In passato si usavano gli RFLP, oggi soprattutto gli STR (Test del DNA standard messo a punto dallFBI= analisi di 13 marcatori STR altamente polimorfici). Luso della PCR consente di fare diagnosi su tracce. Quando il materiale biologico è troppo scarso o di qualità scadente, può essere utile analizzare i polimorfismi del DNA mitocondriale (moltissime copie per cellula)

12 Metodi per evidenziare polimorfismi di singoli (o pochi) nucleotidi Amplificazione della regione mediante PCR con oligonucleotidi fiancheggianti il punto di interesse e successiva digestione con enzimi di restrizione

13 Lutilizzo combinato della PCR e dellanalisi di restrizione permette di diagnosticare specifiche mutazioni molto più facilmente che con il Southern Blot Metodi per evidenziare polimorfismi di singoli (o pochi) nucleotidi

14 Amplificazione, mediante PCR, dot-blot e ibridazione con oligonucleotidi allele-specifici A P1 P2 S P1 P2 PCR Metodi per evidenziare polimorfismi di singoli (o pochi) nucleotidi

15 Amplificazione, mediante PCR, dot-blot e ibridazione con oligonucleotidi allele-specifici Metodi per evidenziare polimorfismi di singoli (o pochi) nucleotidi

16 Amplificazione allele-specifica Metodi per evidenziare polimorfismi di singoli (o pochi) nucleotidi

17 Amplificazione (di DNA genomico o cDNA) e sequenziamento diretto. Metodi per evidenziare polimorfismi di singoli (o pochi) nucleotidi

18 Lutilizzo simultaneo della PCR e di traccianti fluorescenti consente lanalisi simultanea (multiplex) di moltissimi polimoprfismi

19 Diagnosi genetica pre-impianto

20

21 Possibile già oggi per malattie monogeniche per cui sia nota la mutazione In futuro, almeno in teoria, è probabile che questa tecnica, in combinazione con lanalisi simultanea di moltissimi polimorfismi, possa permettere una valutazione di tratti genetici complessi. Quali i vantaggi, e quali i pericoli?


Scaricare ppt "Polimorfismi, mutazioni e metodi per evidenziarli."

Presentazioni simili


Annunci Google