La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Il progetto genoma umano. Perché sequenziare il genoma umano? La disponibilità della sequenza rende più semplice lidentificazione dei geni responsabili.

Presentazioni simili


Presentazione sul tema: "Il progetto genoma umano. Perché sequenziare il genoma umano? La disponibilità della sequenza rende più semplice lidentificazione dei geni responsabili."— Transcript della presentazione:

1 Il progetto genoma umano

2 Perché sequenziare il genoma umano? La disponibilità della sequenza rende più semplice lidentificazione dei geni responsabili delle malattie mendeliane Sequenza completa di tutti i geni Possibilità di determinare la struttura esoni-introni Mappare i geni e le altre sequenze Rivelare le regioni di controllo non codificanti Identificare polimorfismi Scoprire linatteso

3 Il progetto originale (1984): fasi 1.Ottenere una mappa genetica a bassa risoluzione (1987, mappa con marcatori RFLP) 2.Ottenere una mappa genetica ad alta risoluzione (1994, mappa con microsatelliti altamente polimorfici, risoluzione 1 cM) Ricadute immediate: marcatori per il positional cloning e per linvestigazione forense.

4 Il progetto originale (1984): fasi 3.Ottenere una mappa fisica a diversi livelli di risoluzione DNA Genomico Subclonaggio in vettori YAC, BAC, P1 o PAC e assemblaggio di contigs con minimo di ridondanza Subclonaggio in vettori da sequenziamento Sequenziamento 4.Ottenere una sequenza con 99,99 % di accuratezza

5 Il progetto originale era fortemente condizionato dalla difficoltà di sequenziare il DNA, e quindi dalla necessità di ridurre al minimo il quantitativo di sequenze da effettuare. Lo sviluppo di sequenziatori automatici capaci di produrre basi/giorno ha largamente superato qesto ostacolo.

6 Craig VenterFrancis Collins

7 Prima obiezione di Venter: perché sequenziare tutto subito se la maggior parte di ciò che interessa sono le sequenze codificanti? Picking singoli cloni Preparazione DNA Primer 5 3 Sequenziamento automatico Deposito in banca dati ( bp) Sequenziamento delle sole regioni esoniche (Expressed Sequence Tags)

8 In questo modo Venter cominciò ad avere in mano un quantitativo di sequenze geniche superiore a chiunque altro prima di lui. Quando tentò di brevettarle, il governo americano decise che non si può brevettare una sequenza, ma solo la conoscenza che si ha su di essa. Differenza tra scoperta e invenzione. Quindi per brevettare un gene è importante conoscerne la funzione o almeno la potenziale rilevanza. Sulla scia di Venter, anche il consorzio pubblico cominciò a produrre valanghe di sequenze EST e ad adottare massicciamente i nuovi sequenziatori automatici.

9 Seconda obiezione di Venter: è possibile una strategia alternativa per ottenere la sequenza completa? DNA Genomico Frammenti casuali lunghi (5-20 kb) e corti ( kb) derivanti da rottura meccanica del DNA clonati in vettori da sequenziamento Sequenziamento automatico bidirezionale Ricostruzione computerizzata della sequenza genomica Approccio whole genome shotgun

10 Sequenziamento del genoma di Hemophilus Influenzae (1.8 Mb) frammenti di 1,6-2 kb saggi di sequenziamento 11,6 Mb di sequenza totale 30 ore per assemblare la sequenza su un calcolatore con 512 Mb di RAM

11 Inizialmente si stimava che la sequenza sarebbe stata completa nel 2005, poi nel La combinazione dellapproccio del consorzio pubblico con quello di Venter hanno portato alla pubblicazione di due seqeunze (più o meno indipendenti) nel 2000

12 Siccome le sequenze finali sono state ottenute sovrapponendo la sequenza di individui diversi, è stato possibile individuare un numero (milioni) molto alto di polimorfismi di singoli nucleotidi (SNPs). ---ATGTTGAAGTTCAAGAATGGTGTGCGGAAC ATGTTGAAGTTCAAGTATGGTGTGCGGAAC ATGTTGAAGTTCAAGCATGGTGTGCGGAAC ATGTTGAAGTTCAAGGATGGTGTGCGGAAC--- Marcatori ad altissima densità (1/1000 basi), che saranno fondamentali per dissezionare i tratti complessi.

13 Non si può capire come è fatto il genoma umano e come funzionano i nostri geni se non li confrontiamo quelli dei principali organismi modello: Gli altri progetti genoma E. Coli S. Cerevisiae Drosophila Melanogaster Caenorhabditis Elgans Fugu Danio Rerio (zebrafish) Mus musculus Rattus Norvegicus Primati non umani

14 I meccanismi che controllano la riparazione del DNA, importantissimi per comprendere la biologia del cancro, sono conservati fino ai batteri.

15 I meccanismi che controllano la duplicazione del DNA e le transizioni che accompagnano il ciclo cellulare sono ben conservati fino ai lieviti.

16 I meccanismi che determinano limpostazione del piano di sviluppo corporeo sono sorprendentemente simili negli insetti e nei mammiferi.

17 EGF EGF-R Grb2 Conservazione evolutiva di intere vie biochimiche

18 Solo il confronto con gli organismi modello (genomica comparativa) ci permetterà di conoscere cosa ci accomuna alle altre specie e le ragioni delle nostre peculiarità.

19 Altre ricadute dei progetti genoma: genomica funzionale (analisi del trascrittoma)

20 Applicazioni: studio delle basi molecolari del cancro

21 Analisi del proteoma mediante spetrometria di massa


Scaricare ppt "Il progetto genoma umano. Perché sequenziare il genoma umano? La disponibilità della sequenza rende più semplice lidentificazione dei geni responsabili."

Presentazioni simili


Annunci Google