Il genoma umano 09_26_noncoding.jpg. Il genoma umano 09_26_noncoding.jpg.

Presentazione sul tema: "Il genoma umano 09_26_noncoding.jpg. Il genoma umano 09_26_noncoding.jpg."— Transcript della presentazione:

1

2 Il genoma umano 09_26_noncoding.jpg

3 Cromatina e Nucleosoma

4 Sintesi del DNA REPLICAZIONE Sintesi RNA TRASCRIZIONE Sintesi delle proteine TRADUZIONE

5 Perché l’informazione genetica possa essere trasferita alle cellule figlie e/o alle generazioni successive occorre che il DNA sia replicato.

6 Esperimento di Meselson-Stahl
Bisogna trovare un modo per PESARE il DNA NUOVO-VECCHIO

7 The Meselson-Stahl Experiment
Transfer to normal N14 media Bacteria grown in N15 media for several replications After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge Semi-conservative model prediction Dispersive model prediction Conservative model prediction X

8 Esperimento di Meselson-Stahl

9 The Meselson-Stahl Experiment
Transfer to normal N14 media Bacteria grown in N15 media for several replications After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge Semi-conservative model prediction Conservative model prediction Dispersive model prediction X The conservative and dispersive models make predictions that do not come true thus, by deduction, the semi-conservative model must be true. X Prediction after 2 or more replications

10

11 Cromatina e Nucleosoma

12 DNA replication is “semi-conservative”
(Meselson & Stahl, 1958)

13 “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.” J.D. Watson F.H.C. Crick Nature (1953) p 737.

14 Sintesi del DNA - REPLICAZIONE
Arthur Kornberg DNA Polimerasi 3-dNTPs 2- Primer 3’OH 1- DNA Stampo

15 3’ end 5’end 5’ end 3’ end O 3’end

16 La replicazione del DNA
La DNA polimerasi (DNA pol) è il complesso enzimatico responsabile della sintesi di DNA Tutte le polimerasi note non sono in grado di sintetizzare DNA de novo, ma estendono eliche preesistenti (primers) Non è in grado di denaturare il dsDNA nelle due eliche da copiare Le due eliche di una molecola di DNA hanno polarità chimiche opposte (antiparallele)

17 ERROR RATES USA POST First class mail 13 late deliveries
per 100 parcels Airline luggage 1 lost bag per 200 Driving a car in USA 1 death/104 people/ year DNA replication (without mismatch repair) 1 per 107 nucleotides DNA replication (with mismatch repair) 1 per 109 nucleotides DNA polymerase has a proof-reading activity

18 In 20 Km di strada non posso fare neppure un errore
di 3 mm (1 BASE)

19 GTGCACCTGACTCCTGAGGAG Glu
Single point mutation GTGCACCTGACTCCTGAGGAG Glu GTGCACCTGACTCCTGTGGAG Val Sickle-cell anemia

20

21 3’ end 5’end 5’ end 3’ end O 3’end

22 DNA POLIMERASI

23 Le DNA polimerasi The human genome encodes at least 14 DNA-dependent DNA polymerases--a surprisingly large number. These include the more abundant, high-fidelity enzymes that replicate the bulk of genomic DNA, together with eight or more specialized DNA polymerases that have been discovered in the past decade

24 Le DNA polimerasi

25

26

27

28

29 3’ end 5’end 5’ end 3’ end O 3’end

30 06_05_replic.origin.jpg Origine di Replicazione Replication Bubble

31 Replication Fork DNA POLIMERASI 3’ 5’ 5’ 3’

32

33 La più frequente replicazione del DNA umano è bidirezionale

34 Sequenza consensus di Ori di E.coli
La replicazione del DNA inizia in siti cromosomici specifici: Origini di Replicazione Sequenza consensus di Ori di E.coli In genere, in tutti gli organismi, le Ori sono: (1)segmenti di DNA unici costituiti da multiple corte sequenze ripetute, (2) riconosciute da proteine multimeriche (multimeric origin-binding proteins) (3) sono ricche di A-T.

35

36 06_09_Replic.forks.jpg 06_09_Replic.forks.jpg

37 La DNA ELICASI Video elicasi

38 Replication Fork DNA POLIMERASI 3’ 5’ 5’ 3’

39 5’ 3’ 5’ 3’ ELICASI 3’ 5’ 5’ 3’ SINTESI DEL FILAMENTO “GUIDA”

40 SINTESI DEL FILAMENTO “GUIDA”
5’ 3’ 5’ 3’ DNA POLIMERASI 3’ 3’ 5’ 5’ 3’ 5’ SINTESI DEL FILAMENTO “GUIDA”

41 SINTESI DEL FILAMENTO “GUIDA”
5’ 3’ 5’ 3’ 3’ 5’ DNA POLIMERASI 3’ DNA POLIMERASI 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 5’ SINTESI DEL FILAMENTO “GUIDA”

42 La sintesi all’estremità 5’
3’ 5’ 3’ NON e’ POSSIBILE La sintesi all’estremità 5’ DNA POLIMERASI 3’ 5’ 3’ 5’ 5’ 3’ 5’ 3’

43 5’ 3’ 5’ 3’ ELICASI 3’ 5’ 5’ 3’ SINTESI DEL FILAMENTO “LENTO”

44 La sintesi del secondo filamento avviene in modo DISCONTINUO
5’ 3’ 5’ 3’ La sintesi del secondo filamento avviene in modo DISCONTINUO Filamento “LENTO” DNA POLIMERASI 3’ 5’ 200 basi 3’ 5’ 3’ 5’ 3’ 5’ DNA POLIMERASI

45 La sintesi avviene in modo DISCONTINUO
5’ 3’ 5’ 3’ 5’ 3’ DNA POLIMERASI 200 basi 3’ DNA POLIMERASI 5’ 3’ 5’ 3’ 5’ 3’ 5’ 5’ 3’ 3’ 5’ 3’ 3’ 5’ 5’ La sintesi avviene in modo DISCONTINUO

46 La sintesi avviene in modo DISCONTINUO
5’ 3’ 5’ 3’ 5’ 3’ DNA POLIMERASI 3’ 5’ DNA POLIMERASI 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 5’ 3’ 3’ 5’ 3’ 3’ 5’ 5’ La sintesi avviene in modo DISCONTINUO

47 La replicazione avviene in modo - continuo per un filamento (GUIDA-LEADING) - discontinuo per l’altro (LENTO-LAGGING) Forca crescente Eliche parentali Movimento della Forca

48

49 Video DNA polimerasi

50 06_12_asymmetrical.jpg 06_12_asymmetrical.jpg

51 Sintesi della lagging strand

52

53 06_12_asymmetrical.jpg 06_12_asymmetrical.jpg

54 La processività della DNA polimerasi è incrementata dal dimero della subunità  “clamp”

55 Which enzyme synthesizes the primer?
PRIMASI Synthesizes RNA primer!

56 06_12_asymmetrical.jpg 06_12_asymmetrical.jpg

57

58 Sintesi della lagging strand

59 I frammenti di Okazaki sono “chiusi” mediante l’azione di una LIGASI

60 I frammenti di Okazaki della lagging strand vengono legati per creare un’elica continua

61

62 06_12_asymmetrical.jpg 06_12_asymmetrical.jpg

63

64 Le leading e lagging strands sono sintetizzate contestualmente

65

66 06_12_asymmetrical.jpg 06_12_asymmetrical.jpg

67

68 2. Movie –

69 DNA topoisomersi I

70 DNA TOPOISOMERASI II

71 Replicazione e ISTONI

72 06_12_asymmetrical.jpg 06_12_asymmetrical.jpg

73

74 06_12_asymmetrical.jpg 06_12_asymmetrical.jpg

75 Video-telomerasi

76

77 La replicazione eucariota è molto simile a quella di E. coli