Engrafted maternal T cells in human severe combined immunodeficiency: Evidence for a T H2 phenotype and a potential role of apoptosis on the restriction.

Slides:



Advertisements
Presentazioni simili
Emilin1 Links TGF-β Maturation to Blood Pressure Homeostasis Luca Zacchigna, Carmine Vecchione, Antonella Notte, Michelangelo Cordenonsi, Sirio Dupont,
Advertisements

Identification of a New Locus for Medullary Cystic Disease, on Chromosome 16p12 Francesco Scolari, Daniela Puzzer, Antonio Amoroso, Gianluca Caridi, Gian.
Long-term clinical evaluation in patients with Parkinson's disease and early autonomic involvement  Claudio Lucetti, Gianna Gambaccini, Paolo Del Dotto,
The CC genotype of transforming growth factor-��1 increases the risk of late-onset Alzheimer's disease and is associated with AD-related depression  Filippo.
Transcatheter Aortic Valve Implantation in Patients With Advanced Chronic Kidney Disease  Federico Conrotto, MD, Stefano Salizzoni, MD, Alessandro Andreis,
How to manage children who have come into contact with patients affected by tuberculosis  Laura Lancella, Andrea Lo Vecchio, Elena Chiappini, Marina Tadolini,
Granulocyte-colony stimulating factor for large anterior ST-elevation myocardial infarction: Rationale and design of the prospective randomized phase.
Current challenges in HER2-positive breast cancer
Volume 56, Issue 6, Pages (December 1999)
Volume 126, Issue 5, Pages (November 2004)
Heart failure and anemia: Effects on prognostic variables
Assessing the role of eptifibatide in patients with diffuse coronary disease undergoing drug-eluting stenting: The INtegrilin plus STenting to Avoid myocardial.
A 15-year experience of two hundred and twenty five consecutive right hepatectomies  Giovanni Battista Levi Sandri, Marco Colasanti, Giovanni Vennarecci,
S. Rizza, M. Copetti, C. Rossi, M. A. Cianfarani, M. Zucchelli, A
A Cytologic Assay for Diagnosis of Food Hypersensitivity in Patients With Irritable Bowel Syndrome  Antonio Carroccio, Ignazio Brusca, Pasquale Mansueto,
Volume 126, Issue 1, Pages (January 2004)
OA24.02 Locally Advanced Non-Small Cell Lung Cancer: RadioTherapy with Adaptive Strategy (LARTIA Trial)  Sara Ramella, Michele Fiore, Sonia Silipigni,
Volume 132, Issue 7, Pages (June 2007)
Volume 119, Issue 1, Pages (July 2000)
Volume 117, Issue 5, Pages (November 1999)
Growth trend of small uterine fibroids and human chorionic gonadotropin serum levels in early pregnancy: an observational study  Andrea Ciavattini, M.D.,
MP84-13 A NEW APPROACH FOR AN IMPROVED PSA DOUBLING TIME COMPUTATION FOR SELECTING PATIENTS CANDIDATE TO TIMELY SALVAGE RADIOTHERAPY FOR A BIOCHEMICAL.
Association Between Prostate Imaging Reporting and Data System (PI-RADS) Score for the Index Lesion and Multifocal, Clinically Significant Prostate Cancer 
Volume 57, Issue 6, Pages (June 2010)
Volume 47, Issue 3, Pages (March 2005)
Positive Selection and Transplantation of Autologous Highly Purified CD133+ Stem Cells in Resistant/Relapsed Chronic Lymphocytic Leukemia Patients Results.
MP11-18 THE ROLE OF PRIMARY SURGERY AND EXTERNAL BEAM RADIATION THERAPY IN THE MANAGEMENT OF NON-METASTATIC DUCTAL PROSTATE CANCER: 20-YEAR OUTCOMES.
Long-Term Outcome After Antiviral Therapy of Patients With Hepatitis C Virus Infection and Decompensated Cirrhosis  Angelo Iacobellis, Francesco Perri,
A Predictive Model Identifies Patients Most Likely to Have Inadequate Bowel Preparation for Colonoscopy  Cesare Hassan, Lorenzo Fuccio, Mario Bruno, Nico.
Volume 56, Issue 6, Pages (December 1999)
Switching from Transdermal Drugs: An Observational “N of 1” Study of Fentanyl and Buprenorphine  Sebastiano Mercadante, MD, Giampiero Porzio, MD, Fabio.
Lacosamide in pediatric and adult patients: Comparison of efficacy and safety  Alberto Verrotti, Giulia Loiacono, Antonella Pizzolorusso, Pasquale Parisi,
A method for chest drainage after pediatric cardiac surgery: A prospective randomized trial  Salvatore Agati, MD, Carmelo Mignosa, MD, FETCS, Placido.
Polydeoxyribonucleotide administration improves the intra-testicular vascularization in rat experimental varicocele  Salvatore Arena, Ph.D., Letteria.
Safety for Patients With Celiac Disease of Baked Goods Made of Wheat Flour Hydrolyzed During Food Processing  Luigi Greco, Marco Gobbetti, Renata Auricchio,
NF1 Gene Mutations Represent the Major Molecular Event Underlying Neurofibromatosis-Noonan Syndrome  Alessandro De Luca, Irene Bottillo, Anna Sarkozy,
Posterior Reversible Encephalopathy Syndrome after Hematopoietic Cell Transplantation in Children with Hemoglobinopathies  Javid Gaziev, Simone Marziali,
Neuropsychological and behavioural aspects in children and adolescents with idiopathic epilepsy at diagnosis and after 12 months of treatment  Paolo Piccinelli,
A Cytologic Assay for Diagnosis of Food Hypersensitivity in Patients With Irritable Bowel Syndrome  Antonio Carroccio, Ignazio Brusca, Pasquale Mansueto,
Volume 117, Issue 5, Pages (November 1999)
Culture-based Selection Therapy for Patients Who Did Not Respond to Previous Treatment for Helicobacter pylori Infection  Giulia Fiorini, Nimish Vakil,
Diagnostic Performance of Low-Dose Computed Tomography Screening for Lung Cancer over Five Years  Giulia Veronesi, MD, Patrick Maisonneuve, DipEng, Lorenzo.
Activation of immune responses in patients with relapsed-metastatic head and neck cancer (CONFRONT phase I-II trial): Multimodality immunotherapy with.
Prevalence of Hyperhomocysteinemia in Adult Gluten-Sensitive Enteropathy at Diagnosis: Role of B12, Folate, and Genetics  Simone Saibeni, Anna Lecchi,
A Simplified Psychometric Evaluation for the Diagnosis of Minimal Hepatic Encephalopathy  Oliviero Riggio, Lorenzo Ridola, Chiara Pasquale, Ilaria Pentassuglio,
Growth trend of small uterine fibroids and human chorionic gonadotropin serum levels in early pregnancy: an observational study  Andrea Ciavattini, M.D.,
An outbreak of severe invasive meningococcal disease due to a capsular switched Neisseria meningitidis hypervirulent strain B:cc11  P. Stefanelli, C.
Predictors of Changes in Sentimental and Sexual Life After Traumatic Spinal Cord Injury  Patrizio Sale, MD, Federica Mazzarella, Sc, Maria Cristina Pagliacci,
‘Money for nothing’. The role of robotic-assisted laparoscopy for the treatment of endometriosis  Nicola Berlanda, Maria Pina Frattaruolo, Giorgio Aimi,
A randomized study on eversion versus standard carotid endarterectomy: Study design and preliminary results: The Everest Trial  Piergiorgio Cao, MD, Giuseppe.
Preliminary results of endovascular aneurysm sealing from the multicenter Italian Research on Nellix Endoprosthesis (IRENE) study  Bruno Gossetti, MD,
P Role of microRNAs as Biomarkers of Malignant Mesothelioma in Patients with Pleural Effusion  Alessandro Palleschi, Valentina Bollati, Chiara.
Appropriateness of learning curve for carotid artery stenting: An analysis of periprocedural complications  Fabio Verzini, MD, Piergiorgio Cao, MD, FRCS,
Clinical and Translational Radiation Oncology
High Rate of Advanced Adenoma Detection in 4 Rounds of Colorectal Cancer Screening With the Fecal Immunochemical Test  Sergio Crotta, Nereo Segnan, Simona.
Triazole resistance in Aspergillus fumigatus isolates from patients with cystic fibrosis in Italy  Anna Prigitano, Maria Carmela Esposto, Arianna Biffi,
Handgrip Strength Predicts Persistent Walking Recovery After Hip Fracture Surgery  Elisabetta Savino, MD, Emilio Martini, MD, Fulvio Lauretani, MD, Giulio.
Volume 56, Issue 6, Pages (December 1999)
Predictors of outcome in ICU patients with septic shock caused by Klebsiella pneumoniae carbapenemase–producing K. pneumoniae  M. Falcone, A. Russo, A.
Food Hypersensitivity as a Cause of Rectal Bleeding in Adults
Is there a role for soy isoflavones in the therapeutic approach to polycystic ovary syndrome? Results from a pilot study  Daniela Romualdi, M.D., Barbara.
MA01.09 Mortality, Survival and Incidence Rates in the ITALUNG Randomised Lung Cancer Screening Trial (ITALY)  Eugenio Paci, Donella Puliti, Andrea Lopes.
AAN 9. Influence of Earthquakes on the Occurrence of Aortic Aneurysm Ruptures  Edoardo Pasqui, MD, Gianmarco de Donato, MD, Emiliano Chisci, MD, Stefano.
A 10-day levofloxacin-based therapy in patients with resistant Helicobacter pylori infection: A controlled trial  Claudio Bilardi, Pietro Dulbecco, Patrizia.
OA24.02 Locally Advanced Non-Small Cell Lung Cancer: RadioTherapy with Adaptive Strategy (LARTIA Trial)  Sara Ramella, Michele Fiore, Sonia Silipigni,
Evidence of Persistent Cognitive Impairment After Resolution of Overt Hepatic Encephalopathy  Oliviero Riggio, Lorenzo Ridola, Chiara Pasquale, Silvia.
Traumatic rupture of the thoracic aorta: Ten years of delayed management  Davide Pacini, MD, Emanuela Angeli, MD, Rossella Fattori, MD, Luigi Lovato, MD,
Switching from Transdermal Drugs: An Observational “N of 1” Study of Fentanyl and Buprenorphine  Sebastiano Mercadante, MD, Giampiero Porzio, MD, Fabio.
Outcomes of Children with Hemophagocytic Lymphohistiocytosis Given Allogeneic Hematopoietic Stem Cell Transplantation in Italy  Chiara Messina, Marco.
Hybrid treatment of anastomotic pseudoaneurysm of the isthmus portion of the thoracic aorta  Maurizio Taurino, MD, Cristiano Fantozzi, MD, Nazzareno Stella,
Transcript della presentazione:

Engrafted maternal T cells in human severe combined immunodeficiency: Evidence for a T H2 phenotype and a potential role of apoptosis on the restriction of T-cell receptor variable β repertoire  Alessandro Plebani, MDa, Maddalena Stringa, MDa, Ignazia Prigione, PhDc, Paola Facchetti, PhDc, Fabio Ghiotto, PhDc, Irma Airoldi, PhDc, Raffaella Giacchino, MDb, Emilio Cristina, MDb, Fulvio Porta, MDe, Carlo E. Grossi, MDd, Vito Pistoia, MDc  Journal of Allergy and Clinical Immunology  Volume 101, Issue 1, Pages 131-134 (January 1998) DOI: 10.1016/S0091-6749(98)70207-6 Copyright © 1998 Mosby, Inc. Terms and Conditions

FIG. 1 A, mRNA cytokine expression in the mother's CD3 (a) and in the patient's CD3+ (b) and CD3+ cells (c). B, Profile of TCRV-β family (numbers) expression in the mother's (a) and patient's (b) CD3+ cells. C, Early to late stages (a to d) of apoptosis observed on microscopic examination of the monocytes in the patient's CD3– cell fraction (magnification ×700). Enrichment was performed with magnetic microbeads coated with specific monoclonal antibodies (Dynabeads M-450). The primers and the amplification conditions for IL-3, GM-CSF, and TGF-β1 were, respectively: F 5 ́ AGCCACCTTTGCCTTTGCTC, R 5 ́ TGTTGAGCCTGCGCATTCTC, 1 minute at 94° C and 2 minutes at 70° C; F 5 ́ ATCTCTGCACCCGCCCGCTCG, R 5 ́ CCCTGCTTGTACAGCTCCAGG, 1 minute at 94° C and 2 minutes at 70° C; F 5 ́ GCCCTGGACACCAACTATTGC, R 5 ́ GCAGGAGCGCACGATCATGT, 1 minute at 94° C, 1 minute at 65° C, and 1 minute at 72° C. Journal of Allergy and Clinical Immunology 1998 101, 131-134DOI: (10.1016/S0091-6749(98)70207-6) Copyright © 1998 Mosby, Inc. Terms and Conditions