Bioinformatic Analysis of Chromatin Genomic Data Giulio Pavesi University of Milano giulio.pavesi@unimi.it

“Nucleosome” The nucleosome core particle consists of approximately 147 base pairs of DNA wrapped in 1.67 left-handed superhelical turns around a histone octamer Octamer: 2 copies each of the core histones H2A, H2B, H3, and H4 Core particles are connected by stretches of "linker DNA", which can be up to about 80 bp long

Epigenetics Modern experimental techniques and technologies allow for the genome-wide study of different types of histone modifications, shedding light on the role of each one

The histone code Example H3K4me3 H3 is the histone K4 is the residue that is modified and its position (K lysine in position 4 of the sequence) me3 is the modification (three-methyl groups attached to K4) If no number at the end like in H3K9ac means only one group

Different chromatin states Chromatin structure (and thus, gene expression) depend also on the post-translational modifications associated with histones forming nuclesomes

“ChIP” If we have the “right” antibody, we can extract (“immunoprecipitate”) from living cells the protein of interest bound to the DNA And - we can try to identify which were the DNA regions bound by the protein Can be done for transcription factors But can be done also for histones - and separately for each modification

ChIP-Seq Histone ChIP TF ChIP

Many cells- many copies of the same region bound by the protein

After ChIP Size selection: only fragments of the “right size” (200 bp) are kept Identification of the DNA fragment bound by the protein Sequencing

So - if we found that a region has been sequenced many times, then we can suppose that it was bound by the protein, but…

Only a short fragment of the extracted DNA region can be sequenced, at either or both ends (“single” vs “paired end” sequencing) for no more than 35 (before) / 50 (now) / 75 (now) bps Thus, original regions have to be “reconstructed” …and, once again, bioinformaticians can be of help…

Read Mapping Each sequence read has to be assigned to its original position in the genome A typical ChIP-Seq experiment produces from 6 (before) to 100 million (now) reads of 50-70 and more base pairs for each sequencing “lane” (Solexa/Illumina) Research in read alignment algorithms is booming (who is going to be the next BLAST?) There exist efficient “sequence mappers” against the genome for NGS read

Read Mapping “Typical” Output @12_10_2007_SequencingRun_3_1_119_647 (actual sequence) TTTGAATATATTGAGAAAATATGACCATTTTT +12_10_2007_SequencingRun_3_1_119_647 (“quality” scores) 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 27 40 40 4 27 40

Read Mapping Reads mapping more than once (repetitive regions) can be discarded: Never, use all matches everywhere If they map more than a given maximum number of times If they do not map uniquely in the best match If they do not map uniquely with 0, 1, or 2 substitutions

Read Mapping Sequence quality tends to be lower toward the 3’end of sequence reads Trick: if too few read map, “trim” the reads: Map reads with standard parameters (two substitutions will do) Take all the reads that haven’t been mapped, and re-map them trimming away the first and the last nucleotides Repeat until no significant improvement/increase in mapped reads is obtained Discard reads mapping on different locations of the genome

“Peak finding” The critical part of any ChIP-Seq analysis is the identification of the genomic regions that produced a significantly high number of sequence reads, corresponding to the region where the protein (nucleosome) of interest was bound to DNA Since a graphical visualization of the “piling” of read mapping on the genome produces a “peak” in correspondence of these regions, the problem is often referred to as “peak finding” A “peak” then marks the region that was enriched in the original DNA sample

“Peak finding” Peaks: How tall? How wide? How much enriched?

“Peak finding” The main issue: the DNA sample sequenced (apart from sequencing errors/artifacts) contains a lot of “noise” Sample “contamination” - the DNA of the PhD student performing the experiment DNA shearing is not uniform: open chromatin regions tend to be fragmented more easily and thus are more likely to be sequenced Repetitive sequences might be artificially enriched due to inaccuracies in genome assembly Amplification pushed too much: you see a single DNA fragment amplified, not enriched As yet unknown problems, that anyway seem to produce “noisy” sequencings and screw the experiment up

ChIP-Seq histone data Histone modifications tend to be located at preferred locations with respect to gene annotations/transcribed regions Hence, enrichment can be assessed in two ways Enrichment with respect a the control experiment and peak identification “Local” enrichment in given regions with respect to gene annotations Promoters (active/non active) Upstream of transcribed/non transcribed genes Within transcribed/not transcribed regions Enhancers, whatever else

Esperimento Eseguire una ChIP-Seq per diverse modificazioni istoniche, partendo da quelle più “classiche” Verificare: Se ciascuna modifica ha una sua localizzazione “preferenziale” sul genoma o rispetto ai geni (es. nel promotore, nella regione trascritta, etc.) Se ciascuna modifica è “correlata” in qualche modo alla trascrizione/espressione dei geni

Genome wide histone modifications maps through ChIP-Seq Barski et.al - Cell 129 823-837, 2007 20 histone lysine and arginine methylations in CD4+ T cells H3K27 H3K9 H3K36 H3K79 H3R2 H4K20 H4R3 H2BK5 Plus: Pol II binding H2A.Z (replaces H2A in some nucleosomes) insulator-binding protein (CTCF)

Genome wide histone modifications maps through ChIP-Seq

Esperimento ChIP-Seq associata a una particolare modificazione (es, H3K4me3) Domanda: la modificazione è “correlabile” alla trascrizione dei geni? Ovvero, la modificazione “marca” particolari nucleosomi rispetto all’inizio della trascrizione, o alla regione trascritta Esempio: potrebbero esserci modificazioni che: Marcano l’inizio della trascrizione Marcano tutta e solo la regione trascritta “Silenziano” particolari loci genici impedendo la trascrizione

Esperimento Sequenze ottenute da ChIP-Seq per la modificazione studiata Input: coordinate genomiche delle posizioni in ciascuna delle sequenze mappa (vedi file di esempio) Input: coordinate genomiche dei geni RefSeq annotati Un nucleosoma marcato dalla modificazione dovrebbe corrispondere a un “mucchietto” di read che si sovrappongono (“picco”) Andiamo a contare, nucleosoma per nucleosoma, quanto alto è il “mucchietto”, ovvero quanti read sono associabili al nucleosoma

Esempio: se si trovasse la modifica nel nucleosoma a monte del TSS dei geni trascritti, troveremmo un “mucchietto” così Modificazione Nucleosoma

Esempio: se si trovasse la modifica nei nucleosomi associati alle regioni trascritte, troveremmo “mucchietti” così Modificazione Nucleosoma

Analisi: primo esempio Input Lista ordinata delle coordinate genomiche dei TSS associati ai geni trascritti Lista ordinata delle coordinate genomiche dei TSS associati ai geni NON trascritti Lista ordinata delle coordinate genomiche dove mappa ciascuna sequenza della ChIP-Seq Output: calcolare la distribuzione (i “mucchietti”) rispetto ai TSS delle due categorie: Geni trascritti Geni NON trascritti

Algoritmo! -1000 +1000 TSS Dato ciascun TSS, calcolare quante sequenze mappano tra -1000 e +1000 bp rispetto al TSS Contare quante sequenze mappano a -1000, -999, -998...-1,0 +1,+2,...+998,+999,+1000 Sommare per tutti i TSS i conteggi a ciascuna distanza (-1000, -999, -998,...,-1,0,+1,+2,...+998,+999,+1000)

Attenzione! -1000 +1000 TSS +1000 -1000 TSS Le coordinate rispetto al TSS dipendono dalla direzione della trascrizione!!

Output: histone modifications at TSS Read count (peak height) -1000 +1000 Distance from TSS

I risultati!

PolII is found bound to DNA at the TSS of transcribed genes

H3K4me3 is found just before and after the TSS of transcribed genes

H3K4me2 (not me3!) is found just before and after the TSS of transcribed genes, but farther away than H3K4me3

H3K4me1 is found just before and after the TSS of transcribed genes, but farther away than H3K4me3 and H3K4me2

H3K27me3 covers the whole locus of “silent” genes - no transcription here

H3K27me1 (not me3!) is vice versa associated before and after loci of transcribed genes

H3K36me3 is found within the transcribed region - a bit downstream of the TSS - as if it “lets” polymerase proceed with transcription

H3K9me1 is similar in profile to H3K4me3

Barski et. al. High-Resolution Profiling of Histone Methylations in the Human Genome, Cell 129(4)

Histone modifications at transcribed regions Read count (peak height) High Low Expression level