La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

ESERCIZIO SULLA SINTESI PROTEICA Immaginiamo una sequenza di nucleotidi del DNA: TACTAAGAGCTATACGGTCGAATC che è la prima elica di un segmento di DNA: Immaginiamo.

Presentazioni simili


Presentazione sul tema: "ESERCIZIO SULLA SINTESI PROTEICA Immaginiamo una sequenza di nucleotidi del DNA: TACTAAGAGCTATACGGTCGAATC che è la prima elica di un segmento di DNA: Immaginiamo."— Transcript della presentazione:

1 ESERCIZIO SULLA SINTESI PROTEICA Immaginiamo una sequenza di nucleotidi del DNA: TACTAAGAGCTATACGGTCGAATC che è la prima elica di un segmento di DNA: Immaginiamo una sequenza di nucleotidi del DNA TACTAAGAGCTATACGGTCGAATC ATGATTCTCGATATGCCAGCTTAG Una molecola di RNA-polimerasi si inserisce sulla prima elica e inizia a produrre l’mRNA, aggiungendo le basi omologhe: Prima elica: TACTAAGAGCTATACGGTCGAATC A UGAUUCUCGAUAUGCCAGCUUAG mRNA:

2 ESERCIZIO SULLA SINTESI PROTEICA Anche se sappiamo che non è rappresentativo della realtà, possiamo aggiungere un segno di interpunzione per separare le triplette di DNA e di mRNA, in modo da poterle leggere più facilmente Prima elica: TAC-TAA-GAG-CTA-TAC-GGT-CGA-ATC mRNA: AUG-AUU-CUC-GAU-AUG-CCA-GCU-UAG A questo punto, possiamo trovare gli aminoacidi corrispondenti ai codoni dell’mRNA mRNA: AUG-AUU-CUC-GAU-AUG-CCA-GCU-UAG AA: Met-Ile-Leu-Asp-Met-Pro-Ala-STOP Ovviamente, nessuna proteina è così corta. Ma quasi tutte iniziano con Met e terminano quando l’mRNA ha un codone non-senso.

3 ESERCIZIO SULLA SINTESI PROTEICA Adesso, proviamo a ipotizzare che il DNA, invece di essere composto dai nucleotidi che danno origine a una proteina funzionante, possa contenere alcuni errori: Immaginiamo che la terza base sia “saltata” (delezione). L’mRNA diventa: UUUUAGCCACAGAAUAC Se lo scriviamo coi trattini è più evidente: UUU-UAG-CCA-CAG-AAU-AC Il secondo codone, invece di inserire l’amminoacido previsto, fa interrompere la sintesi e la proteina non è funzionante. Prima elica: AAATATCGGTGTCTTATG mRNA: UUUAUAGCCACAGAAUAC

4 ESERCIZIO SULLA SINTESI PROTEICA Consideriamo un’altra sequenza di nucleotidi col suo mRNA: TACTAAGAGCTATACGGTCGA AUGAUUCUCGAUAUGCCAGCU Questa è la sequenza di AA: MetIleLeuAspMetProAla Ipotizziamo che la quinta base del DNA (che è una A) venga sostituita da una T: TACTATGAGCTATACGGTCGA L’mRNA diventa: AUGAUACUCGAUAUGCCAGCU Ma la sequenza degli amminoacidi non cambia, perché sia il codone AUU che il codone AUA corrispondono alla Isoleucina (fenomeno detto “vacillamento della terza base”, che conferisce la proprietà della degenerazione al codice genetico.


Scaricare ppt "ESERCIZIO SULLA SINTESI PROTEICA Immaginiamo una sequenza di nucleotidi del DNA: TACTAAGAGCTATACGGTCGAATC che è la prima elica di un segmento di DNA: Immaginiamo."

Presentazioni simili


Annunci Google