La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Programma 1. Equilibrio e fattori di scostamento: linkage disequilibrium e mutazione 2. Equilibrio e fattori di scostamento: deriva, flusso genico e selezione.

Presentazioni simili


Presentazione sul tema: "Programma 1. Equilibrio e fattori di scostamento: linkage disequilibrium e mutazione 2. Equilibrio e fattori di scostamento: deriva, flusso genico e selezione."— Transcript della presentazione:

1 Programma 1. Equilibrio e fattori di scostamento: linkage disequilibrium e mutazione 2. Equilibrio e fattori di scostamento: deriva, flusso genico e selezione 3. Mantenimento dei polimorfismi 4. Introduzione al coalescente

2 Programma 3 1.Generalità sul coalescente 2.Unapplicazione

3 La genetica studia la trasmissione ereditaria dal passato al presente forward

4 Ma quando si lavora su popolazioni si raccolgono dati sul presente e si cerca di risalire al passato ? ? backward

5 Cosè un modello? La teoria coalescente è un modello di evoluzione, vista come processo genealogico Nella teoria coalescente la trasmissione ereditaria viene trattata indipendentemente dal processo di mutazione Definire il modello Esplorarne le proprietà Stimare parametri dai dati Confrontare dati osservati e attese del modello

6 Costruiamo (procedendo verso il passato) la genealogia materna di un gruppo di individui Due possibilità: o ogni individuo ha una madre diversa: O due individui hanno la stessa madre Chiamo questo fenomeno coalescenza

7 Assunzioni del coalescente classico (Kingman 1982) 1.Neutralità 2.Siti infiniti 3.Se gli individui sono diploidi e le dimensioni della popolazione sono N, il modello vale per 2N copie aploidi e indipendenti del gene 4.Unione casuale entro la popolazione 5.Dimensioni della popolazione costanti (*) 6.Generazioni non sovrapposte Parliamo di caratteri a trasmissione uniparentale

8 Ricostruire la storia di una popolazione Passato Presente

9 Genealogie N = 10 N costante n = 6 9 generazioni

10 Genealogie MRCA

11 Genealogie MRCA

12 Mutazione

13 1 CAATG CAATA CAGTG TAATA CAATGCAGTG CGGTG TAACA TAATA TAACA

14 Non sempre lalbero ricostruito sulla base delle mutazioni è molto informativo CAATGCGGTGCAGTGTAATATAACA Possiamo capire qualcosa di più?

15 Nel risalire dal presente al passato incontriamo una successione di eventi di coalescenza. Conseguenze: 1. In un campione di r individui alla generazione 0, il numero di antenati 1, 2,…n generazioni fa (ξ 1, ξ 2,..ξ n ) decresce fino ad arrivare a 1: r = ξ 0 ξ 1 ξ 2,..ξ n Ogni genealogia viene ricondotta necessariamente a un singolo antenato comune (MRCA). Non è possibile discriminare fra monofilia e polifilia

16 Nel risalire dal presente al passato incontriamo una successione di eventi di coalescenza. Conseguenze: 2. Se la popolazione è stazionaria (N costante), N donne hanno una madre fra le N donne della generazione precedente. La probabilità di coalescenza è vicina a 1/N N 1 =8 N 0 =8 ?

17 Nel risalire dal presente al passato incontriamo una successione di eventi di coalescenza. Conseguenze: 3. La probabilità P(n) che n alleli abbiano n antenati distinti alla generazione precedente diminuisce con le dimensioni del campione (più grande il campione, più grande la P di almeno un evento di coalescenza) campione P(ant.com)P(n) 21/N1-(1/N) 3 2/N 1-(2/N) n n /N 2 1- n /N 2

18 Dimensioni effettive A A Y X X X mt A A Y X X X mt 4. La dimensione effettiva della popolazione è proporzionale a: N C = 2 N eA = 4 N eX = 3 N eY = 1 N e mt = 1

19 Nel risalire dal presente al passato incontriamo una successione di eventi di coalescenza. Conseguenze: 5. I tempi medi di coalescenza aumentano procedendo verso il passato

20 Nel risalire dal presente al passato incontriamo una successione di eventi di coalescenza. Conseguenze: 6. Il tempo atteso fra due eventi di coalescenza è distribuito esponenzialmente. E(T)=4N: Wright-Fisher Tempo atteso per passare da k a (k-1) antenati: T k = 4N/[k(k-1)], o 2N per geni a trasm. uniparentale

21 1. Possiamo stimare alcuni parametri: E(T MRCA )=2N= 20 generazioni 2. Possiamo simulare genealogia e mutazioni 1 CAATGCAGTG CGGTG TAACA TAATA

22 Programma 3 1.Generalità sul coalescente 2.Unapplicazione

23 SE-NW gradients in European allele frequencies (Piazza, 1993) The starting point: genetic variation

24 Correlations with archaeology A map describing the diffusion of Neolithic industries from Cavalli-Sforza et al. (1994)

25 Estimated ages of mitochondrial haplogroups (Kyrs) Richards Sykes Richards et al et al H(1) HV J(2A) T(2B) IWX(3) X: 20.0 I: K(4) U(5) : Major extant lineages throughout Europe predate the Neolithic expansion

26 Is the European gene pool derived from the genes of the first Paleolithic colonisers? Or did the ancestors of most Europeans live in the Levant before the Neolithic period? W E

27 There are significant practical implications Frequency of the F-508 mutation on total CF mutations (from CFGAC 1994) approx. age 52,000 years

28 Why are genes distributed the way they are? Because they could not be distributed otherwise: selection Because their distribution reflects demographic history: random genetic drift and migration

29 How can we tell selection from drift/gene flow? a. By neutrality tests (Tajimas D, Fus F s, etc.) However: D<0: Excess of rare alleles: Selection against deleterious alleles or population expansion D>0: Excess of intermediate-frequency alleles: Balancing selection or population bottleneck

30 How can we tell selection from drift/gene flow? b. Gene flow, bottlenecks, founder effects, etc. affect all genes equally, whereas selection acts differently upon different genes Compare patterns of variation across some of the 30,000 human loci Difficult to infer migration from studies of single genes

31 Gene trees, population trees Gene trees are unknown, but we can reconstruct some of their features assuming mutations occurred at a constant rate (=no selection)

32 T2=2N T5=N/5 4N For nuclear genes, Exp time from k to (k-1) ancestors: T k = 4N/[k(k-1)] generations (large std. errors) Population-genetics theory describes the expected features of gene trees in terms of population parameters

33 present past If two populations are isolated, the final coalescence is 2N generations before the split Origin of the B population A B T2=2N T: gene divergence : population divergence Exp (T) = 4N Exp(T2) = 2N Exp = T/2

34 present past If there is initial polymorphism, the final coalescence may be much more than 2N generations before the split Origin of the B population A B T>> T2=2N

35 : population divergence E(T- ) = 2 N e generations T: gene divergence past present Gene divergence predates population divergence: T is equal to only if 2 N e =0

36 T 2N e very small present past Only if there is a population bottleneck or a founder effect does approximate T Phylogeographic analyses require the assumption of strong founder effects

37 Is it safe to assume that most human populations originated from a founder effect? Evidence for rapid expansion ( Kyrs ago) in farming populations Evidence for shrinking in hunting-gathering populations, possible caused by competition with early farmers (Excoffier & Schneider 1999) Necessary to test for founder effects reduced genetic diversity at several loci in a population

38 Simulation of two expanding populations: No founder effect N 0 = N 0 = 400 Founder effect N 0 = N 0 = 4

39 Ages of molecules are not ages of populations Initial polymorphism results in overestimation of the populations age Populations age Coalescence time From Krings et al. (1997)

40 Any conclusions? Robust inferences on past population processes are complicated No shortcuts: allele genealogies are not population genealogies Archaeologists need geneticists to tell demographic from cultural processes Geneticists need archeologists to identify good hypotheses to test

41 Sintesi 1 Il coalescente fornisce un modello di evoluzione basato sullindipendenza fra processo genealogico e processo mutazionale Tramite il coalescente si possono stimare parametri sulla base di assunzioni esplicite e simulare geenalogie di geni

42 Sintesi 2 Vantaggi del coalescente: Rende esplicite le assunzioni; fornisce misure di incertezza; non tratta (a differenza degli approcci filogeografici) i polimorfismi come mutazioni fissate.

43 Però: Se avessimo raccolto dati 10mila anni fa avremmo individuato un MRCA più antico Dati raccolti fra 10mila anni individueranno un MRCA più recente e quindi Il nostro MRCA può avere un valore speciale per noi, ma non ha alcun particolare significato evolutivo

44 Appendice: mismatch distribution in genealogie femminili e maschili

45 Expanding population Stationary population Maternal or paternal genealogies past present

46 Nucleotide substitutions in the chromosomes of different individuals Only a few are shared Many are shared

47 Unimodal Multimodal Peak age of expansion Many peaks Tajimas D < 0 Tajima D n.s. (= balancing selection) (= stabilizing selection) Distributions of pairwise sequence differences, or mismatch distributions

48

49

50 1. Rapid pop. growth inferred from mtDNA, Kyrs BP (Excoffier & Schneider 1999) 2. No evidence of growth in Y SNP mismatch distributions (Pereira et al. 2001; Dupanloup et al. 2003) Tajimas D < 0Tajimas D = 0

51 3. Evidence of growth for Y STRs, <20 Kyrs BP (Pritchard et al. 1999) 4. Ascertainment bias may render SNPs insensitive to recent population growth (Dupanloup et al. 2003) 5. Patrilocality? (Seielstad et al. 1998) Long-term high N e for females but not males: Extensive polygyny is a possibility


Scaricare ppt "Programma 1. Equilibrio e fattori di scostamento: linkage disequilibrium e mutazione 2. Equilibrio e fattori di scostamento: deriva, flusso genico e selezione."

Presentazioni simili


Annunci Google