Biotecnologie ambientali aa

Presentazione sul tema: "Biotecnologie ambientali aa"— Transcript della presentazione:

1 Biotecnologie ambientali aa 2012-2013

2 Programma di Biotecnologie ambientali Modulo II - 3 crediti (dr. P
Programma di Biotecnologie ambientali Modulo II - 3 crediti (dr. P. Morandini) Piante coltivate e piante selvatiche: la sindrome da domesticazione e i relativi caratteri principali (non-shattering e dormienza ridotta) e le implicazioni per l’invasività e la persistenza nell’ambiente. Rischi e benefici ambientali delle piante transgeniche in paragone a quelle convenzionali. Convenzione di Rio, Protocollo di Cartagena e normativa sulle piante create con tramite ingeneria genetica (scopi, effetti). Piante per una maggiore sostenibilità ambientale (plastiche biodegradabili), per il risanamento di siti contaminati (approcci, specie in uso, tipi di contaminanti rimossi). Interazione simbiotiche pianta-microrganismo: fissazione dell’azoto (batteri azoto fissatori e funghi vescicolo arbuscolari. Interazione pianta-microrganismo: le risposte di difesa delle piante e generazione di specie resistenti.

3 Che cosa è la domesticazione?
• Definizione di domesticazione: “Processo tramite il quale le piante o gli animali selvatici vengono adattati all’uomo e all’ambiente che egli fornisce” • Ben di più che il semplice allevare in cattività, domare o coltivare • Processo di selezione che porta a caratteristiche morfologiche, fisiologiche, genetiche e “comportamentali” ereditabili • In molti casi esistono progenitori selvatici (o loro discendenti) • I principali caratteri sotto selezione sono stati identificati (“sindrome da domesticazione) • Lasso di tempo richiesto: (1.000 – anni) Perché si parla di “sindrome”? Sindrome (gr. Syn = con + dromos = circuito, strada. Stessa radice del verbo gr. dramai, agire, manifestare, da cui anche dramma). Aggregazione di segni, sintomi e/o altre manifestazioni considerate parte di un'entità morbosa.

4 La sindrome da domesticazione
Accumulo di mutazioni dannose per la pianta, ma favorevoli all’uomo (oltre a quelle dannose tramite linkage)  Seme trattenuto a maturità della spiga (frutto)  Riduzione del contenuto di tossine (patogeni…)  Dimensioni, forma e colore del frutto/seme/parte commestibile  Aumento nel numero di semi/fertilità  Nanismo/accestimento (in generale “plant architecture”)  Dormienza del seme (infestanza, permanenza..)  Richieste nutrizionali (fertilizzanti…)  Adattamento della fioritura alle condizioni locali

5 Dimensioni del frutto/parte commestibile: due caratteri evidenti che distinguono una pianta domesticata dalla sua controparte selvatica

6 Pomodoro selvatico / cultivar moderna
Per migliaia di anni l’uomo ha selezionato tra le varianti offerte spontaneamente da madre natura Il risultato di questo lento processo (accumulo di “mutazioni”) è stata la creazione di piante coltivate a partire da quelle selvatiche Teosinte/corn photo compliments of J Doebley, Univ. Wisconsin Tomato photo by Bruce Thomas, UC Davis Pomodoro selvatico / cultivar moderna

7 Sindrome da domesticazione
Qu’est ce qu’une plante domestiquée? Sindrome da domesticazione Rendement prioritaire Banane, arancie, uvetta  scomparsa dei semi Clonalement : 2 ex ign ban Sterilità  propagazione vegetativa Diapositiva di Benoît Pujol 7

8 The domestication syndrome: the essentials
Fully domesticated plants are characterized by a similar set of traits that confer adaptation to the human environment The two most important traits of the syndrome are loss of seed dispersal and reduced seed dormancy The specific details for each trait and the affected genes depend on the crop Fully domesticated plants have most of the traits of the syndrome but generally not all of them; within a crop, differences in the degree of domestication can be observed Esempi di piante con sindrome “incompleta”: Girasole Colza ...

9 La selezione fatta dall’uomo che effetti ha sulla pianta?
Avena coltivata Avena selvatica

10 Un bel carattere Spighetta in una pianta matura:
i semi cadono a terra entro pochi giorni. Spighetta in una pianta matura: i semi rimangono per anni attaccati alla spighetta. Il loro distacco richiede un trattamento vigoroso (trebbiatura).

11 Orzo selvatico (murino) - coltivato

12 Teosinte – Mais Semi di teosinte Semi di mais
i semi si staccano facilmente Semi di mais Per staccare i semi occorre un’azione vigorosa

13 Ci permettono di scoprire geni importanti per i vari processi
I mutanti ci mettono in evidenza cambiamenti nel DNA che hanno un effetto sul fenotipo. Ci permettono di scoprire geni importanti per i vari processi Ci dicono che esistono dei geni ma non dove si trovino o quali siano.  Come possiamo identificarli?  Possiamo utilizzare queste conoscenze (quali siano i geni e dove siano) per sviluppare nuove varietà? Per entrambe le cose si sfruttano i marcatori molecolari - permettono di mappare / identificare i geni responsabili dei caratteri - sono usati per selezionare più velocemente le migliori piante nei programmi di miglioramento genetico: è il cosiddetto MAB (Marker Assisted Breeding) o MAS (Marker Assisted Selection), la selezione assistita da marcatori.

14 Utilità dei marcatori molecolari: identificare i geni
P1 x P2 Dormiente Non dormiente Marcatore molecolare polimorfico tra i due genitori F1 F2 Fenotipizzazione Grande popolazione con migliaia di piante genotipizzazione (determinare gli alleli del marcatore presenti nei diversi individui Diapositiva da Si combina l’informazione sul genotipo con quella sul fenotipo: la maggior parte degli individui con il carattere delle dormienza mostrano uno solo dei due alleli del marcatore  il marcatore è vicino al gene. Ci sono solo due individui che deviano, è avvenuto un crossing over tra il marcatore e l’allele della domienza

15 MIGLIORAMENTO GENETICO CONVENZIONALE
P1 P2 x Incrocio di genitori (P) che diferiscono per qualche carattere (es. dormienza del seme) Dormiente Non dormiente D F1 N I Grande popolazione F2 (es piante) F2 N N N N N N N N N N N N N N N N N N N D I D D ? D I D D I D I D D D D I D D Classificazione fenotipica Bert Collard & David Mackill from Plant Breeding, Genetics and Biotechnology (PBGB) Division, IRRI Phosphorus deficiency plot Salinity screening in phytotron Bacterial blight screening Prove in serra Prove di campo

16 Utilità dei marcatori molecolari: MAS
P1 x P2 Dormiente Non dormiente Marcatore molecolare polimorfico tra i due genitori F1 F2 Grande popolazione con migliaia di piante genotipizzazione Diapositiva da si sfrutta il linkage disequilibrium (associazione allelica) tra il gene desiderato ed un marcatore molecolare prossimo ad esso In questo modo è possibile prevedere quali individui possiedano alleli di interesse

17 I marcatori devono essere polimorfici nei genitori
RM296 RM84 P1 P2 P1 P2 Diapositiva da Polymorphic! Not polymorphic

18 L’allele X1 del gene X e gli alleli (A1 e B1) dei due marcatori molecolari (A e B) che derivano dallo stesso genitore (P1) tendono a segregare insieme alla meiosi. Analogamente per gli alleli dell’altro genitore (P2). Gene X Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forlì Prima Modial Gala Fuji Marcatore A (indel) Marcatore B (SNP) allele A1 (P1) allele B1 (P1) …TCGCCTGAGAGAGAGAGATCCC… …AAGATTGGATCCCCATATCCA… allele X1 (P1) P1 P2 allele X2 (P2) …TCGCCTGAGAGATCCCCGTCCA… …AAGATTAGATCCCCATATCCA… allele A2 (P2) allele B2 (P2) Marcatore molecolare del tipo SSR con amplificati variabili ( bp) tra diverse cultivar di melo. Immagine di L. Gianfranceschi.

19  La MAS permette di concentrare l’indagine su poche linee
Screening fenotipico P1 x P2 F1 F2 F3 MAS MAS per individuare i candidati da sottoporre ad analisi fenotipiche F4 Families grown in progeny rows for selection. Pedigree selection based on local needs F6 F7 F5 F8 – F12 Multi-location testing, licensing, seed increase and cultivar release Only desirable F3 lines planted in field P1 x P2 F1 Phenotypic screening F2 Plants space-planted in rows for individual plant selection F3 Families grown in progeny rows for selection. F4 F5 Preliminary yield trials. Select single plants. Diapositiva da F6 Further yield trials F7 Multi-location testing, licensing, seed increase and cultivar release F8 – F12  La MAS permette di concentrare l’indagine su poche linee

20 varietà Swarna SUB1 resistente alla sommersione
Un esempio di MAS Swarna: sensibile alla sommersione Swarna SUB-1 è come Swarna ma contiene il gene SUB1 che conferisce tolleranza alla sommersione. SUB1 deriva da un’altra varietà; la sua presenza nei vari stadi del backcross è stata rivelata tramite MAS Immagine dell’IRRI (Los Banos, Filippine)

21 The Sub1 region donor line IR49830 (an FR13A derivative) was introduced into the submergence-intolerant indica variety Swarna by backcrossing (BC) with MAS P1 P2 14-day-old seedlings were submerged for 14 days and photographed 14 d after de-submergence

22 Genotipo grafico di Swarna-Sub1
Diapositiva da Linea BC3F2: contiene circa 2,9 MB di DNA del donatore Una linea di questo tipo è detta NIL (nearly isogenic line) perchè contiene solo un frammento di ungenitore, il resto proviene dall’altro (introgressione)

23 Il gene qSH1 di riso Uno dei geni che conferiscono un fenotipo non-shattering Carattere quantitativo (diversi genei posson concorrere al fenotipo Presente in diverse (ma non tutte) le varietà. Mappato al fondo del cromosoma 1 di riso Clonato nel 2006

24 Konishi et al., (2006) Science 312:1392-1396
QTL (quantitative trait locus) analysis between a shattering-type indica cultivar, Kasalath, and a nonshattering type japonica cultivar, Nipponbare. Most rice cultivars have somehow lost the seed-shattering habit  use natural variations in seed shattering among cultivars. Generally, indica cultivars exhibit relatively strong seed shattering, whereas some japonica cultivars do not exhibit it at all. Chromosomal locations of QTLs for seed-shattering degree, based on an F2 population Five QTLs were detected on five chromosomes; all contributed to shattering reduction  loss of seed shattering occured independently in japonica and indica. Nipponbare Kasalath Konishi et al., (2006) Science 312:

25 Nipponbare alleles Kasalath alleles
marcatore Posizione (in cM) 0,6 7,0 12,2 19,9 25,4 43,2 52,1 58,1 64,9 74,1 103,1 103,7 116,5 118,9 123,5 124,8 127.3 129,3 134,2 140,5 142,4 157,6 167,2 169,5 176,3 181,8 C602 C1679 C30 C470 G359 G317 C1211 R1712 S1501 R596 G302 R2374 S2717 R1012 S1870 C137 R1416 C1282 R758 G370 R2125 R2414 R503 S10581 R117 C112 Centromero SP1 LOG Gn1a qSH1 qSD1 Mappa di associazione del cromosoma 1 di riso. In rosso sono evidenziati alcuni geni, tra cui qSH1. Kasalath alleles Nipponbare alleles

26 = Nipponbare, ma con un pezzo di cromosoma (che contiene qSH1)
Breaking tensile strength upon detachment of seeds from the pedicels by bending and pulling The QTL with the largest effect, termed QTL of seed shattering in chromosome 1 (qSH1), explained 68.6% of the total phenotypic variation in the population. We therefore made a near-isogenic line (NIL) that contained a short chromosomal segment from Kasalath at the qSH1 region in a Nipponbare genetic background. Increase in value = loss of shattering = non shattering = Nipponbare, ma con un pezzo di cromosoma (che contiene qSH1) che deriva da Kasalath

27 position of abscission layer formation
Nipponbare Kasalath NIL (qSH1) = Nipponbare ma shattering abscission layer position of abscission layer formation Scanning electron microscope (SEM) photos of pedicel junctions after detachment of seeds. The NIL exhibited the formation of a complete abscission layer between pedicel and spikelet at the base of the rice seed A seed-shattering phenotype stronger than either Kasalath or Nipponbare

28 C434 was the nearest marker to qSH1 upon the rough mapping. Markers
C283 and R3265 were used to select recombinants near the qSH1 locus. Hanno cercato eventi di ricombinazione tra i due marcatori in linee segreganti B and A are homozygous for Kasalath and Nipponbare, respectively

29 Ci sono alcune differenze nella zona trascritta
Il gene di riso è simile a geni caratterizzati in Arabidopsis

30 No distinct open reading frame (ORF) in the SNP region
No distinct open reading frame (ORF) in the SNP region. Located 12 kb away from the SNP, there is one ORF for a rice ortholog of the Arabidopsis REPLUMLESS (RPL) gene Come si può spiegare il dato? Il gene di Arabidopsis  a BEL1-type homeobox) and is involved in the formation of a dehiscence zone (or abscission layer) alongside the valve in the Arabidopsis fruit (silique).

31 In situ analysis of qSH1 expression.
qSH1 è espresso nella zona dove si formerà la zona di abscissione Complementation test for qSH1 gene. A 26-kb Kasalath fragment was transformed into Nipponbare. (Top) Nonshattering degrees of T0 plants were measured. (Bottom) Dots and crosses indicate DNA markers used to confirm the transformed and nontransformed parts.

32 Kasalath fragments used for transformation into Nipponbare for complementation. Numerators are numbers of transgenic T0 plants showing clear shattering phenotypes among independent transformed lines. Denominators are numbers of lines. The sub51 fragment, which exhibited partial complementation, contained around 3 kb upstream and all the ORF region of qSH1. On the TAC9 fragment, partly transformed lines such as 203 and 204 in Fig. 2 were excluded.

33 Complementazione di Nipponbare con un frammento genomico di Kasalath da 26 kbp (linee 1, 201, 203 e 204): la complementazione è evidente solo nella linea 1 e 201 (è come la NIL) nonshattering of T0 plants Only transgenic lines that contained the Kasalath fragment with both the ORF and the SNP exhibited complete seed shattering, Dall’analisi risulta che 1 e 201 contengono il DNA intatto, mentre 203 e 204 risultano troncati (dots and crosses indicate DNA markers used to confirm the transformed and nontransformed parts). these lines lost the ORF region upon transformation

34 V, vector control N, Nipponbare
Non-shattering degrees of T1 selfing progeny in Line 1 (see two slides above) which was complemented We examined the non-shattering degrees of T1 selfing progeny in Lines1 and 201, shown in Fig. 2C. Around 20 grains were measured to obtain values and deviations. (A) In Line 1, the strongest degree of shattering was observed in only one T1 plant, No. 2. In contrast, one plant, No. 3, was segregated out from the transgenes among the 20 T1 progeny plants tested. These results indicated some dose effects of the transgenes. The occurrence of the strongest shattering in T0 Line 1 plant (Fig. 2C) might be due to the additive effects of two transgenes. V, vector control; N, Nipponbare; NIL, NIL(qSH1). (B) Line 201 contained a functional transgene and segregated normally in the T1 population. N, Nipponbare; NIL, NIL(qSH1). transgene lost by segregation V, vector control N, Nipponbare

35 Non è però 100%  ci sono altri geni che influenzano il fenotipo
La presenza di “G” a qSH1 correla bene con un fenotipo shattering, mentre la presenza di “T” correla bene con non-shattering specialmente nelle cultivar di origine cinese. Non è però 100%  ci sono altri geni che influenzano il fenotipo Cultivars in temperate japonica Selection for the qSH1 allele was not as intense nor as expansive as selection for the sh4 allele, as qSH1 is not fixed, even within the temperate japonica subpopulation, let alone the whole of O. sativa All the rice accessions analyzed are shown, and haplotypes at qSH1 and their nonshattering degrees are presented. The category of indica, tropical japonica, or temperate japonica was assigned on the basis of genome-wide RFLP and SSR analyses, except in the case of the wild-rice accessions. Five wild rice accessions and three tropical japonica (T0) were selected on the basis of a SINE-retroelement-based tree. “ND” (not determined) indicates no amplification by PCR using the specific primers. Temperate japonica cultivars of Chinese origin Controls: Kasalath & Nipponbare

36 Statistical analysis of the association of seed shattering with genotype
the SNP was highly associated with the degree of seed shattering among temperate japonica rice cultivars (a subgroup of japonica) and implied that this SNP had been a target of artificial selection for non-shattering habit during rice domestication Andando ad esaminare polimorfismi fiancheggianti qSH1 si trova che uno è associato con lo shattering/non-shattering proprio perchè è associato a qSH1 Tutte le evidenze prese insieme permettono di concludere che: - this RPL ortholog is the qSH1 gene - the identified SNP affected only the spatial mRNA expression pattern of qSH1 at the abscission layer

37 Nipponbare: ...TCATGAAATGT...
Kasalath: TCATGCAATGT... Promotore Idealmente basta il cambiamento di una sola base sull’intero genoma (400 milioni di basi) per stravolgere totalmente la biologia riproduttiva di una specie Regione trascritta

38 Sulla base dei vari polimorfismi (tra cui qSH1) è possibile cercare di ricostruire la storia della domesticazone del riso

39 Nine mutations and two recombination events are enough to explain the natural variations at qSH1 in japonica The identified SNP was likely to be assigned as a mutation that occurred in early domesticates of japonica subspecies but not as a preexisting natural variation

40 Rice domestication by reducing shattering
Gene sh4 Li et al (2006) Genetic analysis of an F2 population derived between O. sativa ssp. indica and the wild annual species O. nivara identified three quantitative trait loci (QTL) -sh3, sh4, and sh8- responsible for the reduction of grain shattering in cultivated rice.

41 The remaining accessions of the wild species with confirmed shattering differed invariably from the cultivars by one mutation, d, which was a nucleotide substitution of G for T or an amino acid substitution of asparagine for lysine in O. sativa.

42 La proteina SH4 è una proteina nucleare
DAPI sh4-GFP Merge epidermal cells Subcellular localization of sh4. Rice roots transformed with Ubi::sh4-GFP La proteina SH4 è una proteina nucleare

43 Real-time RT-PCR estimate of relative expression of sh4
RNA from leaves (L) and the flower/grain and pedicel junction 3 days before flower opening (–3), the day of flower opening (1), and every 3 days thereafter during seed development. Expression of sh4 Force required to pull flowers or grains away from pedicels on: Days starting from flower opening  Force required to pull away grains of transformants

44 First, qSH1 was selected during the domestication of japonica rice, but was subsequently selected against and eliminated from most of the japonica cultivars after sh4 was introduced from cultivars of different origins, such as indica. The combination of qSH1 and sh4 could have made threshing too difficult and laborious at the time. Second, qSH1 was derived in the japonica cultivars that already had sh4 to further reduce shattering when the requirement for stronger threshing force was no longer a problem. The sh4 mutation preceded and spread more widely in landraces than the qsh1 mutation. Because the qsh1 mutation, but not the sh4 mutation, caused abscission-layer loss, it is very likely that the archeological data on the short rachillae indicate that the qsh1 mutation had already been selected by 7000 bc.

45 non-shattering genes may change from species to species
Silique di Arabidopsis wt (sopra) e del mutante seedstick (sotto). E’ evidente che la mutazione impedisce la dispersione del seme. Immagine cortesia di I. Roig Villanova, Università di Milano

46 La coltivazione del riso: il problema del crodo
Immagini D. Bassi (Univ. Milano) Il riso crodo è molto simile al riso coltivato (stessa specie). Difficile da distinguere quando è allo stadio di germinello. A maturità, il riso crodo è più alto. Infesta % dell’area coltivata a riso in Europa.

47 riso crodo (red rice)

48 Riso coltivato Riso crodo
§ if one would use a transgenic HT together with mitigating genes as described by Gressel, the gene excape to red rice would be prevented or heavily retarded * Un grosso problema nelle zone a semina diretta * Riso crodo e coltivato sensibili agli stessi erbicidi

49 Livello di infestazione con riso crodo:
Bassa Media Alta 1 2 3 Semi dispersi prima del raccolto Dormienti per 2-5 a. 11 piante m-2  40% perdita di resa Binasco (Mi) 1 Foto prese a Binasco (Ott. 2011) nei tre campi contrassegnati sulla mappa 3 2

50 Esempio di rischi: riso crodo e riso HT
Cecilia HT rice (transgenic or not) gives excellent control of red rice for 2-3 yrs, BUT then resistance gene is introgressed into weedy rice  technology is lost  In breve: i pericoli per l’ambiente sono essenzialmente di tipo agronomico (il danno avviene nei campi, non nelle zone selvatiche) FOOD SECURITY !!! Riso crodo Riso coltivato

51 Campo n.3 nel 2012 (ad alta infestazione di crodo nel 2011)
Neanche più una pianta di crodo… Motivo? varietà Clearfield! (tollerante agli imidazolinoni, che inibiscono l’acetolattato sintasi)

52 Un caso analogo al riso crodo
girasole selvatico Svetta sopra la coltura, ma è la stessa specie. Probabilmente è una forma de-domesticata che disperde i semi e cresce più alta Girasole coltivato Foto prese a sud di Siena (Aug. 2011)

53 Bibliografia Shattering
Konishi et al. (2006) An SNP Caused Loss of Seed Shattering During Rice Domestication. Science 312, Li et al (2006) Rice Domestication by Reducing Shattering. Science 311, Crodo Gressel e Valverde (2009) A strategy to provide long-term control of weedy rice while mitigating herbicide resistance transgene flow, and its potential use for other crops with related weeds. Pest Manag Sci 65:723–731