La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Biotecnologie ambientali aa 2012-2013. Programma di Biotecnologie ambientali Modulo II - 3 crediti (dr. P. Morandini) Piante coltivate e piante selvatiche:

Presentazioni simili


Presentazione sul tema: "Biotecnologie ambientali aa 2012-2013. Programma di Biotecnologie ambientali Modulo II - 3 crediti (dr. P. Morandini) Piante coltivate e piante selvatiche:"— Transcript della presentazione:

1 Biotecnologie ambientali aa

2 Programma di Biotecnologie ambientali Modulo II - 3 crediti (dr. P. Morandini) Piante coltivate e piante selvatiche: la sindrome da domesticazione e i relativi caratteri principali (non-shattering e dormienza ridotta) e le implicazioni per linvasività e la persistenza nellambiente. Rischi e benefici ambientali delle piante transgeniche in paragone a quelle convenzionali. Convenzione di Rio, Protocollo di Cartagena e normativa sulle piante create con tramite ingeneria genetica (scopi, effetti). Piante per una maggiore sostenibilità ambientale (plastiche biodegradabili), per il risanamento di siti contaminati (approcci, specie in uso, tipi di contaminanti rimossi). Interazione simbiotiche pianta-microrganismo: fissazione dellazoto (batteri azoto fissatori e funghi vescicolo arbuscolari. Interazione pianta-microrganismo: le risposte di difesa delle piante e generazione di specie resistenti.

3 Che cosa è la domesticazione? Definizione di domesticazione: Processo tramite il quale le piante o gli animali selvatici vengono adattati alluomo e allambiente che egli fornisce Ben di più che il semplice allevare in cattività, domare o coltivare Processo di selezione che porta a caratteristiche morfologiche, fisiologiche, genetiche e comportamentali ereditabili In molti casi esistono progenitori selvatici (o loro discendenti) I principali caratteri sotto selezione sono stati identificati (sindrome da domesticazione) Lasso di tempo richiesto: (1.000 – anni) Perché si parla di sindrome? Sindrome (gr. Syn = con + dromos = circuito, strada. Stessa radice del verbo gr. dramai, agire, manifestare, da cui anche dramma). Aggregazione di segni, sintomi e/o altre manifestazioni considerate parte di un'entità morbosa.

4 Accumulo di mutazioni dannose per la pianta, ma favorevoli alluomo (oltre a quelle dannose tramite linkage) Seme trattenuto a maturità della spiga (frutto) Riduzione del contenuto di tossine (patogeni…) Dimensioni, forma e colore del frutto/seme/parte commestibile Aumento nel numero di semi/fertilità Nanismo/accestimento (in generale plant architecture) Dormienza del seme (infestanza, permanenza..) Richieste nutrizionali (fertilizzanti…) Adattamento della fioritura alle condizioni locali La sindrome da domesticazione

5 Dimensioni del frutto/parte commestibile: due caratteri evidenti che distinguono una pianta domesticata dalla sua controparte selvatica

6 Pomodoro selvatico / cultivar moderna Per migliaia di anni luomo ha selezionato tra le varianti offerte spontaneamente da madre natura Il risultato di questo lento processo (accumulo di mutazioni) è stata la creazione di piante coltivate a partire da quelle selvatiche

7 Sindrome da domesticazione Quest ce quune plante domestiquée? Rendement prioritaire Banane, arancie, uvetta scomparsa dei semi Sterilità propagazione vegetativa Diapositiva di Benoît Pujol

8 Fully domesticated plants are characterized by a similar set of traits that confer adaptation to the human environment The two most important traits of the syndrome are loss of seed dispersal and reduced seed dormancy The specific details for each trait and the affected genes depend on the crop Fully domesticated plants have most of the traits of the syndrome but generally not all of them; within a crop, differences in the degree of domestication can be observed Esempi di piante con sindrome incompleta: Girasole Colza... The domestication syndrome: the essentials

9 La selezione fatta dalluomo che effetti ha sulla pianta? Avena selvatica Avena coltivata

10 Un bel carattere Spighetta in una pianta matura: i semi cadono a terra entro pochi giorni. Spighetta in una pianta matura: i semi rimangono per anni attaccati alla spighetta. Il loro distacco richiede un trattamento vigoroso (trebbiatura).

11 Orzo selvatico (murino) - coltivato

12 Teosinte – Mais Semi di teosinte Semi di mais i semi si staccano facilmente Per staccare i semi occorre unazione vigorosa

13 I mutanti ci mettono in evidenza cambiamenti nel DNA che hanno un effetto sul fenotipo. Ci permettono di scoprire geni importanti per i vari processi Ci dicono che esistono dei geni ma non dove si trovino o quali siano. Come possiamo identificarli? Possiamo utilizzare queste conoscenze (quali siano i geni e dove siano) per sviluppare nuove varietà? Per entrambe le cose si sfruttano i marcatori molecolari - permettono di mappare / identificare i geni responsabili dei caratteri - sono usati per selezionare più velocemente le migliori piante nei programmi di miglioramento genetico: è il cosiddetto MAB (Marker Assisted Breeding) o MAS (Marker Assisted Selection), la selezione assistita da marcatori.

14 F2F2 P2P2 F1F1 P1P1 x Grande popolazione con migliaia di piante Non dormiente Dormiente Utilità dei marcatori molecolari: identificare i geni genotipizzazione (determinare gli alleli del marcatore presenti nei diversi individui Marcatore molecolare polimorfico tra i due genitori Fenotipizzazione Si combina linformazione sul genotipo con quella sul fenotipo: la maggior parte degli individui con il carattere delle dormienza mostrano uno solo dei due alleli del marcatore il marcatore è vicino al gene. Ci sono solo due individui che deviano, è avvenuto un crossing over tra il marcatore e lallele della domienza

15 F2F2 P2P2 F1F1 P1P1 x Grande popolazione F2 (es piante) Classificazione fenotipica Prove di campo Prove in serra MIGLIORAMENTO GENETICO CONVENZIONALE Salinity screening in phytotronBacterial blight screening Phosphorus deficiency plot Non dormienteDormiente Incrocio di genitori (P) che diferiscono per qualche carattere (es. dormienza del seme) DN N N N N N N N N N N D I D D ? D I D D I D I D D D D I D D I

16 F2F2 P2P2 F1F1 P1P1 x Grande popolazione con migliaia di piante Non dormiente Dormiente si sfrutta il linkage disequilibrium (associazione allelica) tra il gene desiderato ed un marcatore molecolare prossimo ad esso Utilità dei marcatori molecolari: MAS In questo modo è possibile prevedere quali individui possiedano alleli di interesse genotipizzazione Marcatore molecolare polimorfico tra i due genitori

17 I marcatori devono essere polimorfici nei genitori RM296 P 1 P 2 Polymorphic! RM84 P 1 P 2 Not polymorphic

18 …TCGCCTGAGAGAGAGAGATCCC… …TCGCCTGAGAGATCCCCGTCCA… …AAGATTGGATCCCCATATCCA… …AAGATTAGATCCCCATATCCA… Marcatore A (indel)Marcatore B (SNP) Gene X P1 P2 allele X1 (P 1 ) allele X2 (P 2 ) allele A1 (P 1 ) allele A2 (P 2 ) allele B1 (P 1 ) allele B2 (P 2 ) Fiesta DiscoveryGala FlorinaNova EasygroTN10-8 Durello di Forlì Prima Modial Gala Fuji Lallele X1 del gene X e gli alleli (A1 e B1) dei due marcatori molecolari (A e B) che derivano dallo stesso genitore (P1) tendono a segregare insieme alla meiosi. Analogamente per gli alleli dellaltro genitore (P2). Marcatore molecolare del tipo SSR con amplificati variabili ( bp) tra diverse cultivar di melo. Immagine di L. Gianfranceschi.

19 P1 x P2 F1 Screening fenotipico F2 F3 F4 F5 F6 F7 F8 – F12 Phenotypic screening Plants space- planted in rows for individual plant selection Families grown in progeny rows for selection. Preliminary yield trials. Select single plants. Further yield trials Multi-location testing, licensing, seed increase and cultivar release P1 x P2 F1 F2 F3 MAS MAS per individuare i candidati da sottoporre ad analisi fenotipiche F4 Families grown in progeny rows for selection. Pedigree selection based on local needs F6 F7 F5 F8 – F12 Multi-location testing, licensing, seed increase and cultivar release Only desirable F3 lines planted in field La MAS permette di concentrare lindagine su poche linee

20 Immagine dellIRRI (Los Banos, Filippine) Swarna: sensibile alla sommersione varietà Swarna SUB1 resistente alla sommersione Swarna SUB-1 è come Swarna ma contiene il gene SUB1 che conferisce tolleranza alla sommersione. SUB1 deriva da unaltra varietà; la sua presenza nei vari stadi del backcross è stata rivelata tramite MAS Un esempio di MAS

21 14-day-old seedlings were submerged for 14 days and photographed 14 d after de-submergence The Sub1 region donor line IR49830 (an FR13A derivative) was introduced into the submergence-intolerant indica variety Swarna by backcrossing (BC) with MAS P2P2 P1P1

22 Genotipo grafico di Swarna-Sub1 Linea BC3F2: contiene circa 2,9 MB di DNA del donatore Una linea di questo tipo è detta NIL (nearly isogenic line) perchè contiene solo un frammento di ungenitore, il resto proviene dallaltro (introgressione)

23 Il gene qSH1 di riso Uno dei geni che conferiscono un fenotipo non-shattering Carattere quantitativo (diversi genei posson concorrere al fenotipo Presente in diverse (ma non tutte) le varietà. Mappato al fondo del cromosoma 1 di riso Clonato nel 2006

24 Konishi et al., (2006) Science 312: Chromosomal locations of QTLs for seed-shattering degree, based on an F2 population Nipponbare Kasalath QTL (quantitative trait locus) analysis between a shattering-type indica cultivar, Kasalath, and a nonshattering type japonica cultivar, Nipponbare. Five QTLs were detected on five chromosomes; all contributed to shattering reduction loss of seed shattering occured independently in japonica and indica. Most rice cultivars have somehow lost the seed- shattering habit use natural variations in seed shattering among cultivars. Generally, indica cultivars exhibit relatively strong seed shattering, whereas some japonica cultivars do not exhibit it at all.

25 marcatore Posizione (in cM) 0,6 7,0 12,2 19,9 25,4 43,2 52,1 58,1 64,9 74,1 103,1 103,7 116,5 118,9 123,5 124, ,3 134,2 140,5 142,4 157,6 167,2 169,5 176,3 181,8 C602 C1679 C30 C470 G359 G317 C1211 R1712 S1501 R596 G302 R2374 S2717 R1012 S1870 C137 R1416 C1282 R758 G370 R2125 R2414 R503 S10581 R117 C112 Centromero SP1 LOG Gn1a qSH1 qSD1 Mappa di associazione del cromosoma 1 di riso. In rosso sono evidenziati alcuni geni, tra cui qSH1. Nipponbare alleles Kasalath alleles

26 Increase in value = loss of shattering = non shattering = Nipponbare, ma con un pezzo di cromosoma (che contiene qSH1) che deriva da Kasalath Breaking tensile strength upon detachment of seeds from the pedicels by bending and pulling The QTL with the largest effect, termed QTL of seed shattering in chromosome 1 (qSH1), explained 68.6% of the total phenotypic variation in the population. We therefore made a near-isogenic line (NIL) that contained a short chromosomal segment from Kasalath at the qSH1 region in a Nipponbare genetic background.

27 position of abscission layer formation Scanning electron microscope (SEM) photos of pedicel junctions after detachment of seeds. Nipponbare Kasalath NIL (qSH1) = Nipponbare ma shattering abscission layer The NIL exhibited the formation of a complete abscission layer between pedicel and spikelet at the base of the rice seed A seed-shattering phenotype stronger than either Kasalath or Nipponbare

28 C434 was the nearest marker to qSH1 upon the rough mapping. Markers C283 and R3265 were used to select recombinants near the qSH1 locus. B and A are homozygous for Kasalath and Nipponbare, respectively Hanno cercato eventi di ricombinazione tra i due marcatori in linee segreganti

29 Ci sono alcune differenze nella zona trascritta Il gene di riso è simile a geni caratterizzati in Arabidopsis

30 No distinct open reading frame (ORF) in the SNP region. Located 12 kb away from the SNP, there is one ORF for a rice ortholog of the Arabidopsis REPLUMLESS (RPL) gene Come si può spiegare il dato? Il gene di Arabidopsis a BEL1-type homeobox) and is involved in the formation of a dehiscence zone (or abscission layer) alongside the valve in the Arabidopsis fruit (silique).

31 In situ analysis of qSH1 expression. qSH1 è espresso nella zona dove si formerà la zona di abscissione

32 Kasalath fragments used for transformation into Nipponbare for complementation. Numerators are numbers of transgenic T0 plants showing clear shattering phenotypes among independent transformed lines. Denominators are numbers of lines. The sub51 fragment, which exhibited partial complementation, contained around 3 kb upstream and all the ORF region of qSH1. On the TAC9 fragment, partly transformed lines such as 203 and 204 in Fig. 2 were excluded.

33 Complementazione di Nipponbare con un frammento genomico di Kasalath da 26 kbp (linee 1, 201, 203 e 204): la complementazione è evidente solo nella linea 1 e 201 (è come la NIL) Dallanalisi risulta che 1 e 201 contengono il DNA intatto, mentre 203 e 204 risultano troncati (dots and crosses indicate DNA markers used to confirm the transformed and nontransformed parts). these lines lost the ORF region upon transformation nonshattering of T0 plants Only transgenic lines that contained the Kasalath fragment with both the ORF and the SNP exhibited complete seed shattering,

34 Non-shattering degrees of T1 selfing progeny in Line 1 (see two slides above) which was complemented transgene lost by segregation V, vector control N, Nipponbare

35 Temperate japonica cultivars of Chinese origin Selection for the qSH1 allele was not as intense nor as expansive as selection for the sh4 allele, as qSH1 is not fixed, even within the temperate japonica subpopulation, let alone the whole of O. sativa Cultivars in temperate japonica Controls: Kasalath & Nipponbare La presenza di G a qSH1 correla bene con un fenotipo shattering, mentre la presenza di T correla bene con non-shattering specialmente nelle cultivar di origine cinese. Non è però 100% ci sono altri geni che influenzano il fenotipo

36 Statistical analysis of the association of seed shattering with genotype Andando ad esaminare polimorfismi fiancheggianti qSH1 si trova che uno è associato con lo shattering/non-shattering proprio perchè è associato a qSH1 Tutte le evidenze prese insieme permettono di concludere che: - this RPL ortholog is the qSH1 gene - the identified SNP affected only the spatial mRNA expression pattern of qSH1 at the abscission layer the SNP was highly associated with the degree of seed shattering among temperate japonica rice cultivars (a subgroup of japonica) and implied that this SNP had been a target of artificial selection for non-shattering habit during rice domestication

37 Nipponbare:...TCATGAAATGT... Kasalath:... TCATGCAATGT... Promotore Regione trascritta Idealmente basta il cambiamento di una sola base sullintero genoma (400 milioni di basi) per stravolgere totalmente la biologia riproduttiva di una specie

38 Sulla base dei vari polimorfismi (tra cui qSH1) è possibile cercare di ricostruire la storia della domesticazone del riso

39 The identified SNP was likely to be assigned as a mutation that occurred in early domesticates of japonica subspecies but not as a preexisting natural variation Nine mutations and two recombination events are enough to explain the natural variations at qSH1 in japonica

40 Rice domestication by reducing shattering Genetic analysis of an F2 population derived between O. sativa ssp. indica and the wild annual species O. nivara identified three quantitative trait loci (QTL) -sh3, sh4, and sh8- responsible for the reduction of grain shattering in cultivated rice. Gene sh4 Li et al (2006)

41 The remaining accessions of the wild species with confirmed shattering differed invariably from the cultivars by one mutation, d, which was a nucleotide substitution of G for T or an amino acid substitution of asparagine for lysine in O. sativa.

42 Subcellular localization of sh4. Rice roots transformed with Ubi::sh4-GFP epidermal cells DAPIsh4-GFP Merge La proteina SH4 è una proteina nucleare

43 Expression of sh4 RNA from leaves (L) and the flower/grain and pedicel junction 3 days before flower opening (–3), the day of flower opening (1), and every 3 days thereafter during seed development. Real-time RT-PCR estimate of relative expression of sh4 Force required to pull flowers or grains away from pedicels on: Days starting from flower opening Force required to pull away grains of transformants

44 First, qSH1 was selected during the domestication of japonica rice, but was subsequently selected against and eliminated from most of the japonica cultivars after sh4 was introduced from cultivars of different origins, such as indica. The combination of qSH1 and sh4 could have made threshing too difficult and laborious at the time. Second, qSH1 was derived in the japonica cultivars that already had sh4 to further reduce shattering when the requirement for stronger threshing force was no longer a problem. The sh4 mutation preceded and spread more widely in landraces than the qsh1 mutation. Because the qsh1 mutation, but not the sh4 mutation, caused abscission-layer loss, it is very likely that the archeological data on the short rachillae indicate that the qsh1 mutation had already been selected by 7000 bc.

45 Silique di Arabidopsis wt (sopra) e del mutante seedstick (sotto). E evidente che la mutazione impedisce la dispersione del seme. Immagine cortesia di I. Roig Villanova, Università di Milano non-shattering genes may change from species to species

46 La coltivazione del riso: il problema del crodo Il riso crodo è molto simile al riso coltivato (stessa specie). Difficile da distinguere quando è allo stadio di germinello. A maturità, il riso crodo è più alto. Infesta % dellarea coltivata a riso in Europa.

47 riso crodo (red rice)

48 Riso crodo Riso coltivato * Un grosso problema nelle zone a semina diretta * Riso crodo e coltivato sensibili agli stessi erbicidi

49 Semi dispersi prima del raccolto Dormienti per 2-5 a. 11 piante m -2 40% perdita di resa Binasco (Mi) Foto prese a Binasco (Ott. 2011) nei tre campi contrassegnati sulla mappa Livello di infestazione con riso crodo: Bassa Media Alta

50 Riso crodo Riso coltivato Esempio di rischi: riso crodo e riso HT Cecilia In breve: i pericoli per lambiente sono essenzialmente di tipo agronomico (il danno avviene nei campi, non nelle zone selvatiche) FOOD SECURITY !!! HT rice (transgenic or not) gives excellent control of red rice for 2-3 yrs, BUT then resistance gene is introgressed into weedy rice technology is lost

51 Campo n.3 nel 2012 (ad alta infestazione di crodo nel 2011) Neanche più una pianta di crodo… Motivo? varietà Clearfield! (tollerante agli imidazolinoni, che inibiscono lacetolattato sintasi)

52 Svetta sopra la coltura, ma è la stessa specie. Probabilmente è una forma de-domesticata che disperde i semi e cresce più alta Girasole coltivato girasole selvatico Un caso analogo al riso crodo Foto prese a sud di Siena (Aug. 2011)

53 Bibliografia Shattering Konishi et al. (2006) An SNP Caused Loss of Seed Shattering During Rice Domestication. Science 312, Li et al (2006) Rice Domestication by Reducing Shattering. Science 311, Crodo Gressel e Valverde (2009) A strategy to provide long-term control of weedy rice while mitigating herbicide resistance transgene flow, and its potential use for other crops with related weeds. Pest Manag Sci 65:723–731


Scaricare ppt "Biotecnologie ambientali aa 2012-2013. Programma di Biotecnologie ambientali Modulo II - 3 crediti (dr. P. Morandini) Piante coltivate e piante selvatiche:"

Presentazioni simili


Annunci Google