La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

RIPASSO “Biologia” Prof.ssa Flavia Frabetti PROPRIETA’ COMUNI degli ESSERI VIVENTI riproduzionecrescita e sviluppomorteprogramma interno ordine omeostasi.

Presentazioni simili


Presentazione sul tema: "RIPASSO “Biologia” Prof.ssa Flavia Frabetti PROPRIETA’ COMUNI degli ESSERI VIVENTI riproduzionecrescita e sviluppomorteprogramma interno ordine omeostasi."— Transcript della presentazione:

1

2 RIPASSO “Biologia” Prof.ssa Flavia Frabetti

3 PROPRIETA’ COMUNI degli ESSERI VIVENTI riproduzionecrescita e sviluppomorteprogramma interno ordine omeostasi reattività capacità di PRENDERE, TRASFORMARE USARE l’energia dell’ambiente esterno adattamento all’ambiente

4 TEMI TRASVERSALI FONDAMENTALI IN BIOLOGIA 1) gerarchia dell’organizzazione 2) correlazione tra struttura e funzione 3) unità nella diversità 4) interazione tra organismi ed ambiente 5) base cellulare della vita 6) ereditarietà della informazione genetica

5 3- Tessuto 6- Organismo 5- Sistema 4- Organo 1- Molecola 2- Cellula GERARCHIA DELL’ORGANIZZAZIONE BIOLOGICA

6 BASE CELLULARE DELLA VITA La cellula è l’unità strutturale e funzionale degli organismi viventi. Struttura minima in grado di compiere tutte le attività minime della vita. cellula PROCARIOTA cellula EUCARIOTA

7 Teoria cellulare (Schleiden e Schwann 1839 Virchow 1859): 1. tutti i viventi sono costituiti di cellule 2. le cellule sono unità in cui avvengono i processi vitali 3. “Omnis cellula e cellula”, ogni cellula deriva da un’altra cellula, capacità riproduttiva Weismann 1880 Importante corollario: tutte le cellule viventi hanno una origine in comune La cellula come UNITA’ CONCETTUALE dei viventi come l’atomo lo è della materia

8 ORDINE ED ORGANIZZAZIONE STRUTTURALE Strutture Funzioni INTEGRAZIONE FUNZIONALE TRA LE PARTI Unità Diversità Cellule diverse per: Posizione reciproca degli organuli Dimensioni e volume occupato Numerosità relativa degli stessi

9 Le forme cellulari sono le più varie :

10 Ciò ci fa ragionare su: 1) natura modulare degli organismi 2) presenza di una copia del patrimonio genetico in ogni cellula dell’organismo L’evoluzione ha portato ad organismi pluricellulari

11 Le cellule si sono originate grazie alla formazione di membrane

12 Membrane biologiche Definizione: “Pellicola oleosa sottilissima” Importanza biologica Membrana plasmatica Membrane interne Unità nella diversità

13 Struttura e funzione

14 Struttura: modello a mosaico fluido - Cosa significa? A) Fluidità delle membrane sistema dinamico B) Le membrane sono MOSAICI strutturali e funzionali Le proteine delle membrane sono di diversi tipi e quindi con funzioni diverse

15 Trasporto di membrana molecole piccole molecole grosse trasporto passivo trasporto attivo (con pompe o cotrasportatori) diffusione semplice diffusione facilitata (da canali o permeasi) endocitosi esocitosi Mantenere una permeabilit à altamente selettiva Trasporto regolato in modo attivo

16 Tutte le caratteristiche di una cellula dipendono dalle molecole che contiene

17 cellula organuli strutture sopra-molecolari macromolecole molecole organiche piccole

18 COSTITUENTI CHIMICI DELLA CELLULA LIPIDI ACQUA PROTEINE ACIDI NUCLEICI - DNA - RNA INORGANICI SALI MINERALI ORGANICI GLUCIDI

19 PROTEINE (15%) Cellula batterica

20 POLIMERI = grandi molecole costituite dall’unione di molte subunità identiche o simili nella cellula, tra cellule, tra individui, tra specie MONOMERI ENORME VARIABILITA’ pochi monomeri di base (40-50 tipi) varia la SEQUENZA per grandi lunghezze variabilità potenziale infinita logica: piccole molecole comuni a tutti gli organismi ordinate a formare macromolecole peculiari ?

21 Polimero NON INFORMATIVO POLIMERO INFORMATIVO PROTEINE ed ACIDI NUCLEICI POLISACCARIDE come il glicogeno GGGGGGGGGGGG ARPE RAPE PERA

22 PROTEINE dal greco “al 1° posto” La funzione di una proteina dipende dalla specifica CONFORMAZIONE NATIVA NH3 + COO - H R C gruppo aminico gruppo carbossilico catena laterale più del 50% del peso secco degli organismi viventi molecole informazionali, polimeri di aminoacidi molecole estremamente varie dal punto di vista funzionale

23 STRUTTURALI CONTRATTILI DI TRASPORTO DI DIFESA ENZIMATICHE ORMONALI RECETTORIALI FUNZIONI DELLE PROTEINE

24 ACIDI NUCLEICI DNA acido desossiribonucleico RNA acido ribonucleico DNA RNA = POLIMERI DI NUCLEOTIDI P ZUCCHERO PENTOSO BASE AZOTATA 1’ 2’ 3’ 4’ 5’

25 Le istruzioni biologiche (o progetto interno della cellula) sono contenute nel DNA. L’informazione biologica è contenuta in una sequenza di 4 nucleotidi entro la molecola di DNA AGCT In analogia all’alfabeto e ai messaggi verbali: ARPE RAPE PERA con 4 lettere ottengo, dalle diverse sequenze, diversi significati!

26 TTAGCACTACCGTATTTGCGCATTACCAGATTAGAGAA ATGCTAGTCGATCTATCGATCGGCTATTCGCAAAGCTG CGCGACTGCGATGCGCTAGCATGCGATTCGCGATCGCC GAGCGCTCGCGAGCGCGCTAGCGGAATACTATATAGC GCGGATCAGTCTAGATCTATGAGATCGATAGCGATCTA GAGATAGGATCGAGATCGAGGCGAGATCATATGAGCG CGGCTATTTAGGCTTAGAGGATTCGGAGATTCGGAGC TTAGGATTACAGAGAGCTTCTTAGGCGCTCCCGGTATC GCTCCCATCCCATATTAAAATCTATCGATCGAGCTCTC CAATGCGATCGATAGGACTAGTAGCTAGCTAGCTGAG CATGATAGGCTCGATGAGCATGAGATGCATGTACGAC TGCATAGGCATGACTGATCGACTGCATCATGACGCATG ACTGCATGCATGACTGCATATGACGGACTCGCATTAGC ACTACCGTATTTGCGCATTACCAGATTAGAGAAATGCT AGTCGATCTATCGATCGGCTATTCGCAAAGCTGCGCGA CTGCGATGCGCTAGCATGCGATTCGCGATCGCCGAGC GCTCGCGAGCGCGCTAGCGGAATACTATATAGCGCGG ATCAGTCTAGATCTATGAGATCGATAGCGATCTAGAGA TAGGATCGAGATCGAGGCGAGATCATATGAGCGCGGC TATTTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAG GATTACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTC CCATCCCATATTAAAATCTATCGATCGAGCTCTCCAAT GCGATCGATAGGACTAGTAGCTAGCTAGCTGAGCATG ATAGGCTCGATGAGCATGAGATGCATGTACGACTGCA TAGGCATGACTGATCGACTGCATCATGACGCATGACTG CATGCATGACTGCATATGACGGACTCGCATTAGCACTA CCGTATTTGCGCATTACCAGATTAGAGAAATGCTAGTC GATCTATCGATCGGCTATTCGCAAAGCTGCGCGACTGC GATGCGCTAGCATGCGATTCGCGATCGCCGAGCGCTC GCGAGCGCGCTAGCGGAATACTATATAGCGCGGATCA GTCTAGATCTATGAGATCGATAGCGATCTAGAGATAG GATCGAGATCGAGGCGAGATCATATGAGCGCGGCTAT TTAGGCTTAGAGGATTCGGAGATTCGGAGCTTAGGAT TACAGAGAGCTTCTTAGGCGCTCCCGGTATCGCTCCCA TCCCATATTAAAATCTATCGATCGAGCTCTCCAATGCG ATCGATAGGACTAGTAGCTAGCTAGCTGAGCATGATA GGCTCGATGAGCATGAGATGCATGTACGACTGCATAG GCATGACTGATCGACTGCATCATGACGCATGACTGCAT GCATGACTGCATATGACGGACTCGCA Nel “libro” DNA, le pagine sono scritte in codice GENE

27 L’informazione genetica? Trascrizione e Traduzione Codice genetico Meccanismi di CONTROLLO della espressione genica Dove è scritta l’informazione genica: DNA Cromatina / cromosomi Nucleo eucariotico Come è organizzata l’informazione genica: Genoma Geni - come concetto - “struttura del gene eucariota tipo” Come si esprime l’informazione genica:

28 filamento di DNA doppia elica di DNAdoppio filamento di DNA costruzione del nucleotide COMPLEMENTARIETA’ DELLE BASI Struttura e funzione nel DNA sono codificate le istruzioni che programmano tutte le attività cellulari

29 cromatina m. nucleare interna m. nucleare esterna reticolo endoplasmatico nucleolo cromatina Lamina nucleare NUCLEO

30 CROMATINA La cromatina è un complesso tra DNA eucariotico e proteine. Le proteine principali sono gli istoni Il grado di condensazione varia durante il ciclo vitale della cellula, nucleo interfasico: Eucromatina Eterocromatina

31 cromosoma in metafase breve regione di DNA fibre di cromatina di 30 nm: nucleosomi impaccati cromatina a “collana di perle” domini ad ansa legati ad un supporto proteico riavvolgimento ulteriore core = ottamero istonico nucleosoma scaffold proteico

32 Eucromatina attivamente espressa cioè trascrivibile Eterocromatina inattiva cioè non trascrivibile Può essere però di 2 tipi: costitutiva sequenze mai trascritte facoltativa sequenze non trascritte in alcune cellule, varia secondo l’attività trascrizionale del tipo cellulare.

33 Come è organizzata l’informazione? Una enorme quantità di informazione dentro ad ogni singola cellula: il GENOMA Aprendo ogni libro si trovano brani così scritti: …..ATCCGAGCTTTACGTACGGTTACCGGATCGAGCATACT……

34 il complesso dell'informazione genetica di una cellula la massa totale del DNA cellulare il patrimonio ereditario dell'organismo a cui appartiene Genoma

35 Organizzazione generale del genoma umano Il genoma umano è distribuito in cromosomi: 22 AUTOSOMI 1 ETEROCROMOSOMA (X o Y) Corredo aploide bp ovvero 3,2 Gbp Contenenti, si stima, circa geni

36 GENE IL GENE È UNA REGIONE DI DNA TRASCRITTA Gene - come concetto

37 TATA DNA PROMOTORE E 1E 2E 3 Trascritto Primario o pre-mRNA Esone 1Esone 2 Esone 3 AUGUGA ProteinaNH 2 COOH I 1 I 2 ESONI (in giallo), intervallate da lunghi INTRONI (in grigio) mRNA AUGUGA 5’ UTR3’ UTR Gene - struttura

38 Immagine mentale della attivazione dei geni lungo il DNA: I geni lungo il DNA sono come “luci di Natale” lungo la matassa dei fili: si accendono e si spengono ad intermittenza e con una intensità che va da MASSIMA luminosità a MINIMA luminosità e può essere modulata cioè regolata

39 IL DNA HA UN DUPLICE RUOLO: DNA informazioni trasmesse alla progenie espressione delle informazioni: DNA RNA PROTEINE DNA 1. Ereditarietà2. Controllo cellulare

40 I geni sono le unità responsabili delle caratteristiche ereditarie. Un carattere è in generale un aspetto dell'oggetto che osserviamo. Desamparados-“Abbandonati” Picasso, 1917

41 Che ruolo assolve l’RNA nel flusso di informazione genetica dal DNA alle proteine? Esemplificazione del flusso di informazione genetica: DNARNAproteine replicazione o duplicazione trascrizione della informazione traduzione della informazione

42 ESPRESSIONE DELLA INFORMAZIONE BIOLOGICA dal progetto alla costruzione proteina DNA

43 L’informazione genetica, contenuta nel DNA, ha lo scopo di: 1) mantenere lo stato vitale (strutture e funzioni) 2) realizzare l’adattamento (risposta ad un cambiamento) 3) determinare il differenziamento (specializzazione di strutture e funzioni) ESPRESSIONE della INFORMAZIONE GENETICA

44 1. Trascrizione Sintesi delle proteine 2. Traduzione tRNA rRNA mRNA

45 Promotore RNA polimerasi Direzione della trascrizione TRASCRIZIONE PROMOTORE

46 codice genetico anni ‘60 Codice genetico è un codice a triplette dette “codoni” 4 3 =64 codoni in totale

47 Inizio sintesi proteica Allungamento sintesi proteica Terminazione sintesi proteica Met 5’ 3’ mRNA AUG Met 3’ Ser 5’ mRNA Met - Ser Pro Met - Ser - Pro - Thr 5’ mRNA Met - Ser - Pro - Thr UGA STOP! 3’ NH 3 COO -

48 “Ciclo cellulare” o ciclo di divisione cellulare Negli organismi pluricellulari avviene per consentire: 1) sviluppo dalla prima cellula (zigote), 2) rinnovamento delle cellule che muoiono nell’adulto 3) riparazione a eventi accidentali di perdita cellulare ciclo riproduttivo della cellula cio è la sequenza ordinata di eventi per cui una cellula duplica il suo contenuto e si divide

49 Descrizione del ciclo di divisione cellulare 8-10 ore ore ore min Mitosi (M) è il processo di divisione nucleare che ultima con la citocinesi o citodieresi ovvero la divisione del citoplasma Interfase = G 1 +S+G 2

50 M FASE S Sintesi o duplicazione del DNA Replicazione del DNA o duplicazione del DNA, meccanismo atto a mantenere invariato il patrimonio informativo ed è indispensabile premessa di ogni processo di divisione cellulare.

51 ACCGTTACCTAACCGTTACCTA ACCGTTACCTAACCGTTACCTA ACCGTTACCTAACCGTTACCTA TGGCAATGGATTGGCAATGGAT TGGCAATGGATTGGCAATGGAT TGGCAATGGATTGGCAATGGAT Meccanismo molecolare SEMICONSERVATIVO DUPLICAZIONE DNA Avviene sulla base della complementarietà delle basi

52 Dimensioni medie: - 2nm diametro - 8 cm lunghezza Li vediamo solo quando: -1 µm di diametro - alcuni µm di lunghezza cromosomi Cosa sono i cromosomi? Molecole di DNA! DUPLICAZIONE DEL DNA cromosomi dicromatidici

53 Con eccezione delle cell. germinali, le cellule umane hanno due copie di ognuno dei cromosomi: uno di origine materna ed una di origine paterna 23 coppie di cromosomi 46 cromosomi Corredo cromosomico DIPLOIDE CORREDO CROMOSOMICO DIPLOIDE CON DUE SERIE DI CIASCUN CROMOSOMA 2n 23

54 MITOSI DIVISIONE CELLULARE CELLULE SOMATICHE 2n DA 1 CELLULA SI OTTENGONO 2 CELLULE GENETICAMENTE UGUALI TRA LORO E ALLA CELLULA MADRE 2n CORREDO CROMOSOMICO DIPLOIDE CORREDO CROMOSOMICO DIPLOIDE

55 2nnnnnnn MEIOSI I Profase Metafase Anafase Telofase citodieresi MEIOSI II Profase Metafase Anafase Telofase citodieresi RISULTATO DELLA MEIOSI: 4 CELLULE APLOIDI DIVERSE TRA LORO E ALLA CELL MADRE DIVISIONE RIDUZIONALE DIVISIONE EQUAZIONALE CELLULA DIPLOIDE MEIOSI

56 Significato della MEIOSI 1) Porta alla APLOIDIA, premessa indispensabile per la fecondazione (unione di 2 patrimoni ereditari diversi) 2) Il crossing over e l’assortimento indipendente dei cromosomi portano ad un rimescolamento del patrimonio ereditario di ogni singolo gamete rispetto a quello dell’organismo che lo produce

57 Adulti pluricellulari diploidi (2n = 46) GONADI MEIOSI Gameti aploidi (n = 23) FECONDAZIONE Zigote diploide (2n = 46) Mitosi e sviluppo

58 VARIABILITA’ GENETICA CROSSING OVER ASSORTIMENTO INDIPENDENTE (METAFASE I) FECONDAZIONE MEIOSI

59 Riproduzione sessuata o gamica quando RIPRODUZIONE, cioè la formazione di un nuovo organismo è accompagnata da SESSUALITA’, cioè l’organismo figlio ha una combinazione genica diversa da quella dagli organismi che lo hanno generato “Sessualità” indica un processo di ricombinazione genica.

60 FECONDAZIONE unione dei due gameti

61

62 EREDITARIETA’ DELLA INFORMAZIONE BIOLOGICA ORDINEINFORMAZIONE sono necessarie ISTRUZIONI che devono essere CONSERVATE e TRASMESSE

63

64 BIOLOGIA è la scienza della vita che indaga le caratteristiche dei sistemi viventi biologia animale biologia cellulare biologia molecolare

65 scienza: da scire = conoscere Max Perutz, Nobel, biochimico “fare una scoperta è come innamorarsi e, allo stesso tempo, raggiungere la vetta di un monte dopo una difficile scalata, è un’estasi provocata non da una droga, ma dalla rivelazione di un volto della natura che nessuno ha mai scorto prima”


Scaricare ppt "RIPASSO “Biologia” Prof.ssa Flavia Frabetti PROPRIETA’ COMUNI degli ESSERI VIVENTI riproduzionecrescita e sviluppomorteprogramma interno ordine omeostasi."

Presentazioni simili


Annunci Google