La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Dove Come Perchè. Cos’è la sintesi proteica La sintesi proteica è il processo che porta alla formazione delle proteine, a partire dall’unione degli AA,

Presentazioni simili


Presentazione sul tema: "Dove Come Perchè. Cos’è la sintesi proteica La sintesi proteica è il processo che porta alla formazione delle proteine, a partire dall’unione degli AA,"— Transcript della presentazione:

1 Dove Come Perchè

2 Cos’è la sintesi proteica La sintesi proteica è il processo che porta alla formazione delle proteine, a partire dall’unione degli AA, utilizzando le informazioni contenute nel DNA. Si tratta di un processo piuttosto complesso in cui intervengono vari “attori” Nelle sue linee fondamentali questo processo è identico in tutte le forme di vita, sia eucarioti che procarioti

3 Come vedremo, il processo comincia nel nucleo (negli eucarioti) e termina nel citoplasma o nel reticolo endoplasmatico rugoso, nei ribosomi Dove avviene

4 Gli “attori” – Il DNA Nel DNA sono contenute le “istruzioni” per sintetizzare le diverse proteine Ogni “porzione” di DNA che codifica per una specifica proteina è detta gene

5 Gli “attori” – Il DNA Ad esempio, questo potrebbe essere il gene per l’insulina… … e questo il gene per l’emoglobina

6 Gli “attori” – L’RNA Nella sintesi proteica interviene un altro acido nucleico, l’RNA, presente in 3 forme diverse (ma a filamento singolo): - l’RNA messaggero (mRNA) - l’RNA ribosomale (rRNA) - l’RNA transfer (tRNA)

7 L’RNA messaggero l’RNA messaggero (mRNA) è una singola catena lineare di RNA che fa da tramite tra il nucleo e il citoplasma, trasporta quindi le informazioni contenute nel DNA ai ribosomi

8 L’RNA ribosomiale L’RNA ribosomiale (rRNA) è il costituente principale (insieme ad alcune proteine) dei ribosomi, da cui il nome.

9 L’RNA transfer L’RNA transfer (tRNA) è una particolare catena di RNA che viene rappresentato come un trifoglio... Esistono molti tipi diversi di questo tRNA, almeno uno per ogni tipo di AA E’ costituito da due estremità, una superiore alla quale si aggancia l’Aa entrante ed una inferiore(anticodone)corrispondente alla tripletta del mRNA

10 Gli “attori” – Amminoacidi La sintesi proteica richiede anche gli amminoacidi, cioè i “mattoncini” che, assemblati in sequenza, costituiranno le proteine Ogni proteina si differenzia dalle altre per la sequenza, il numero ed il tipo di AA che la compongono

11 Gli “attori” – Amminoacidi Tutte le nostre proteine sono costituite da solo 20 tipi di amminoacidi, un po’ come tutte le parole del nostro vocabolario sono formate utilizzando 21 lettere dell’alfabeto

12 Gli “attori” – Amminoacidi Una sequenza di amminoacidi, come questa… Gly Ala Met ValTyr … è un polipeptide. Le proteine sono polipeptidi generalmente molto lunghi(più di 50 AA) e con un organizzazione anche molto complessa.

13 Gli “attori” – Ribosomi Le “fabbriche” cellulari di proteine sono i ribosomi, piccoli organuli costituiti da due subunità.Alla più piccola si lega mRNA,alla più grande tRNA. I ribosomi, come detto, sono costituiti da rRNA e proteine Due molecole di rRNA più 34 proteine diverse Una molecola di rRNA più 21 proteine diverse

14 Le fasi della sintesi proteica Le fasi della sintesi proteica sono 2: -La Trascrizione (che, negli eucarioti, avviene nel nucleo) -La Traduzione (che avviene sui ribosomi)e a sua volta si distingue in:inizio allungamento e terminazione

15 La trascrizione(dal DNA all’RNA) Le nuove molecole di RNA vengono copiate utilizzando come stampo il DNA Nella fase di trascrizione la doppia elica di una porzione di DNA viene dapprima svolta… … ad opera di un enzima detto RNA-Polimerasi

16 La trascrizione Lo stesso enzima apre la doppia elica… … e inizia, utilizzando uno dei due filamenti come stampo, a costruire una molecola complementare di mRNA, aggiungendo uno alla volta i nuovi nucleotidi.

17 La trascrizione Ecco un modello tridimensionale dell’RNA- Polimerasi N.B notare la complementarietà delle basi azotate

18 A G T T G G A C T A C G A A A C G T T C C T G C La trascrizione Ad esempio, prendiamo una porzione di DNA come quella mostrata a sinistra

19 La trascrizione Ad esempio, prendiamo una porzione di DNA come quella mostrata a sinistra A A A C G T T C C T G C A G T T G G A C T A C G

20 La trascrizione Ad esempio, prendiamo una porzione di DNA come quella mostrata a sinistra A A A C G T T C C T G C A G T T G G A C T A C G

21 La trascrizione Ad esempio, prendiamo una porzione di DNA come quella mostrata a sinistra A A A C G T T C C T G C A G T T G G A C T A C G

22 La trascrizione Dopo la separazione dei due filamenti, l’RNA polimerasi comincia ad assemblare la catena complementare di mRNA… A A A C G T T C C T G C A G T T G G A C T A C G

23 La trascrizione … utilizzando come stampo uno dei filamenti e secondo la complementarietà delle basi. GCUCAACCUGUA A G T T G G A C T A C G mRNA DNA

24 La trascrizione … La catena di RNA messaggero così formata... G C U C A A C C U G U A

25 La trascrizione … La catena di RNA messaggero così formata... G C U C A A C C U G U A

26 La trascrizione … sarà una sorta di impronta “in negativo” del gene da cui si è originato… … e migrerà verso i ribosomi liberi nel citoplasma o verso quelli attaccati al reticolo endoplasmatico rugoso, portando le istruzioni per la sintesi della proteina. RNA messaggero G C U C A A C C U G U A

27 Dalla trascrizione alla traduzione

28 Il codice genetico Ma come si fa a passare dal “linguaggio” degli acidi nucleici (che utilizza 4 “lettere”)… … al “linguaggio” delle proteine (che utilizza 20 “lettere”)? Con la TRADUZIONE

29 Il codice genetico  Certo non può esserci una corrispondenza 1:1  Ma non è neanche possibile associare un amminoacido ad una coppia di basi azotate  Infatti le possibili coppie di basi sono 4 2 = 16 (AA, UU, CC, GG, AU, AC, AG, UA, UC, UG, CA, CG, CU, GA, GU, GC) troppo poche per poter codificare i 20 amminoacidi

30 Il codice genetico Appare evidente, quindi, che il codice utilizzato si basa su triplette di basi… … infatti 4 3 = 64 combinazioni sono più che sufficienti per codificare i 20 amminoacidi

31 Il codice genetico Ed ecco quindi il codice genetico: Ovviamente è ridondante: ci sono cioè più triplette che codificano per lo stesso amminoacido Ci sono anche le triplette di inizio (AUG) e di stop (UAA, UAG e UGA) che determinano l’inizio e la fine di una sequenza polipeptidica

32 Il codice genetico Il codice genetico è universale: praticamente tutti gli organismi viventi utilizzano questo stesso codice per tradurre una sequenza di basi azotate (il DNA e poi l’RNA) in una sequenza di amminoacidi (la proteina) Ogni tripletta di basi sull’RNA è anche detta codone

33 La sintesi proteica Avviene nei ribosomi e si svolge in tre fasi: 1.Inizio 2.Allungamento 3.Terminazione Si svolge principalmente durante le fasi G1e G2 del ciclo cellulare

34 Fase d’inizio 1.Si forma un complesso costituito da un ribosoma e una molecola di mRNA 2. Dal citoplasma viene richiamato un tRNA con anticodone complementare al codone d’inizio AUG che porta l’AA corrispondente (metionina) GCUCAUGCUGUA CODONE D’ INIZIO GCUCAUGCUGUA A U C Me ANTICODONE

35 Fase d’inizio 3. Il tRNA porta l’AA iniziatore della catena metionina che successivamente sarà liberato. 4. Nel frattempo arriva un altro tRNA portante un altro anticodone (per es.GAC) GCUCAUGCUGUA A U C Me AU C GCUCAUGCUGUA AG C Le

36 Fase di allungamento Il secondo tRNA entra nel ribosoma, fra i due AA si realizza un legame PEPTIDICO ed il primo tRNA può lasciare il ribosoma, pronto per un nuovo viaggio AU C Me AG C Le GCUCAUGCUGUAGCUCAUGCUGUA AU C AG C Met

37 Fase di allungamento Il ribosoma scorre lungo la molecola di mRNA, si sposta verso destra e individua un altro codone(UAC).A questo codone corrisponde la tirosina Nel frattempo arriva il tRNA portante l’anticodone complementare AUG, e l’AA tirosina GCUCAUGCUGUA C AG C Le Met U A G Tir

38 La catena si allunga ancora La tirosina si unisce alla leucina, si forma un legame peptidco, il secondo tRNA può essere rilasciato e… così via…. GCUCAUGCUGUA C U A G Metionina-Leucina-Tirosina AG C

39 Fase di terminazione In questo modo si viene a costruire un polipeptide sempre più lungo finché non si arriva ad un codone di stop (UAA, UAG, UGA) e la sintesi si interrompe poiché questi non hanno anticodoni corrispondenti.Il polipeptide è pronto, si stacca dal tRNA ed entrambi si allontanano dal ribosoma. Alcuni polipepetidi perdono poi la metionina che aveva avviato il processo.

40 Immagini e dati utilizzati per la realizzazione di questa presentazione provengono da alcuni siti, fra i quali: Un interessante filmato che riassume la sintesi proteica è disponibile sul sito nella sezione Multimedia.www.molecularlab.it


Scaricare ppt "Dove Come Perchè. Cos’è la sintesi proteica La sintesi proteica è il processo che porta alla formazione delle proteine, a partire dall’unione degli AA,"

Presentazioni simili


Annunci Google