La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

A C G T A A T G G T T A AC T A G T T A G G A A T C G C G C A T T A T G T C C A C G T T A G G T T G A A C G G C A G G T T T A A A T C G A T T C C A C G.

Presentazioni simili


Presentazione sul tema: "A C G T A A T G G T T A AC T A G T T A G G A A T C G C G C A T T A T G T C C A C G T T A G G T T G A A C G G C A G G T T T A A A T C G A T T C C A C G."— Transcript della presentazione:

1

2 A C G T A A T G G T T A AC T A G T T A G G A A T C G C G C A T T A T G T C C A C G T T A G G T T G A A C G G C A G G T T T A A A T C G A T T C C A C G T T A T G A A A T T G G G G C A G G T T T A A C G C G C C C CAGATCAGAT

3 A U G G UU A A C U A G UU A G G A A U C G C G C A U U A U G U C C A C G U U A G G U U G A A C G G C A G G U U U A A A U C G A U U C C ACGGUAACGGUA CAGAUCAGAU A C G U U A UG A A A U U G G G G C A G G U U U A A C G C G C C C Metionina Valina Asparagina STOP Serina Treonina ProlinaLisina Leucina Glicina Glutamina MVNMS T V P MLKGQV M V NS T P L K G Q

4 ATTACGGCCATGCGGAGCCGGAAG CCATG presente in ? algoritmo che richiede un numero di confronti pari alla lunghezza di

5 confronto approssimato di stringhe ALLINEAMENTO T G - T A - C G G A - - A T C G G A T - C T - C C G - A C C A T C G G A T G T A C G G A A T C G G A T C T C C G A C C A T C G G A = 7 T G C TAC C G G A C C A T C G G A

6 T G T A C G G A A T C G G A TCTTCT CCGCCG ACCACC ATCATC GGAGGA TCTTCT CCGCCG ACCACC ATCATC GGAGGA

7 T C - T - C C - G A C C A T C G G A T - G T A C - G G A - - A T C G G A = 7 T G - T A - C G G A - - A T C G G A T - C T - C C G - A C C A T C G G A

8 cammino minimo quante operazioni ? N.B. : il numero di cammini è molto elevato impossibile la valutazione esplicita !

9 RICORSIONE ! = min +1

10 ogni arco viene considerato esattamente una volta numero operazioni = numero archi = due sequenze di 1000 basi richiedono un milione di operazioni

11 Diverso modello: sostituzioni ammesse T G T A C G G A A T C G G A T C T C C G A C C A T C G G A T G T A C G G A - - A T C G G A T C T C C G - A C C A T C G G A

12 T G T A C G G A A T C G G A TCTTCT CCGCCG ACCACC ATCATC GGAGGA 14 6

13 T G T A C G G A - A T C G G A T C T C C G A C C A T C G G A T G T A C G G A - - A T C G G A T C T C C G - A C C A T C G G A

14

15 T G T A C G G A A T C G G A T C T C C G A C C A T C G G A A C T C A G A C A A T G A T G T A C G - G A A T C G G A T C T C C G A C C A T C G G A A C T C A G A C A A T - - G A ALLINEAMENTO MULTIPLO

16

17 Numero confronti = prodotto lunghezze stringhe 3 stringhe lunghe 1000 un miliardo di operazioni !

18 TAGA CTGA CTAGA ATGA ATAGA TACATAGA AGGAATGA ? ? ? ? TAGA ATGA CTGA CTAGA A G - G A - T A C A - T A G A C T - G A A T - G A A G - G A - T A C A - T A G A C T - G A A T - G A

19 AUGCCGAUUCAACGGUCCUACUCGGACUUUACC M P I Q R S Y S D F T M R I S R S D S D Y T punteggio (M M, P R...) basato sulle probabilità di mutazione

20 RICOSTRUZIONE DEI FRAMMENTI

21 ACGTTACG TTACGGAT CGGATTCA CGGCGATT AACAAGCTT CGGAATCG TTACCGGAT CGGTTAGG CGAATTAG TGGCGAA GGCCTTAA ACGACGAT GCATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TGTCGCGA CGCGCGAT GTGTAGAG CTTGATCT CGGATATA CGCGATAT TGTGAATA ACGTTACG TTACGAAT CGGATTCA CGGCGATT AACCAGCTT CGGAATCG TTACCGGAT CGGTTAGG CGAATTAG TGGCGAA AGCCTTAA ACGACGAT GCATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TGTCGCGA CGCGCGAT GTGCAGAG CTTGATCT CGGATATA CGCGATAT TGTGAATA ACGTTACG TTACGGAT CGGATTTA CGGCGATT AACAAGCTT CGGAATCG TTACCGGAT CGGTTAGG AGAATTAG TGGCGAA GGCCTTAA ACGACGAT GCATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TCTCGCGA CGCGCGAT GTGTAGAG CTTGATCT CGGATATA CGCGCTAT TGTGAATA ACATTACG TTACGGAT CGGATTCA CGGCGACT AACAAGCTT CGGAATCG TTACCGGAT CGGTTAAG CGAATTAG TGGCGAA GGCCTTAA ACGACGTT GCATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TGTCGCGA CGCGCGAT TTGTAGAG CTTGATCT CGGATATA CGCAATAT TGTGAATA ACGTTACG TTACTGAT CGGATTCA CGGCGATT AACAAGCGT CGGAATCG TTACCGGAT CGGTTAGG AGAATTAG TGGCGAA GGCCTTAA ACGACGAT GCATTGGA ATATCGAT CGCGCGAA TGTGCATA AACGGAC TGTCGCGA CGCGCGAT GTGTAGAG CTTGTTCT CGGATATA CGCGATAT TGTGAATA ACGTTACG TTACGGAT CGGATTCA CGGCAATT AACAAGCTT CGGAATAG TTACCGGAT CGGTTAGG CGAATTAG TGGCGAA GGCCTTAA ACGACGAT GTATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TGTCGCGA CGCTCGAT GTGTAGAG CTTGATCT AGGATATA CGCGATAT TGTGAATA

22 ACGTTACG TTACGGAT CGGATTCA CGGCGATT AACAAGCTT CGGAATCG TTACCGGAT CGGTTAGG CGAATTAG TGGCGAA GGCCTTAA ACGACGAT GCATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TGTCGCGA CGCGCGAT GTGTAGAG CTTGATCT CGGATATA CGCGATAT TGTGAATA ACGTTACG TTACGAAT CGGATTCA CGGCGATT AACCAGCTT CGGAATCG TTACCGGAT CGGTTAGG CGAATTAG TGGCGAA AGCCTTAA ACGACGAT GCATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TGTCGCGA CGCGCGAT GTGCAGAG CTTGATCT CGGATATA CGCGATAT TGTGAATA ACGTTACG TTACGGAT CGGATTTA CGGCGATT AACAAGCTT CGGAATCG TTACCGGAT CGGTTAGG AGAATTAG TGGCGAA GGCCTTAA ACGACGAT GCATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TCTCGCGA CGCGCGAT GTGTAGAG CTTGATCT CGGATATA CGCGCTAT TGTGAATA ACATTACG TTACGGAT CGGATTCA CGGCGACT AACAAGCTT CGGAATCG TTACCGGAT CGGTTAAG CGAATTAG TGGCGAA GGCCTTAA ACGACGTT GCATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TGTCGCGA CGCGCGAT TTGTAGAG CTTGATCT CGGATATA CGCAATAT TGTGAATA ACGTTACG TTACTGAT CGGATTCA CGGCGATT AACAAGCGT CGGAATCG TTACCGGAT CGGTTAGG AGAATTAG TGGCGAA GGCCTTAA ACGACGAT GCATTGGA ATATCGAT CGCGCGAA TGTGCATA AACGGAC TGTCGCGA CGCGCGAT GTGTAGAG CTTGTTCT CGGATATA CGCGATAT TGTGAATA ACGTTACG TTACGGAT CGGATTCA CGGCAATT AACAAGCTT CGGAATAG TTACCGGAT CGGTTAGG CGAATTAG TGGCGAA GGCCTTAA ACGACGAT GTATTCGA ATATCGAT CGCGCGAA TGTGCATA ACCGGAC TGTCGCGA CGCTCGAT GTGTAGAG CTTGATCT AGGATATA CGCGATAT TGTGAATA

23 ACCGT CGTGC TTAC TACCGT - - ACCGT CGTGC TTAC TACCGT - - TTAC TACCGT ACCGT CGTGC = ___ 4 TTACCGTGC

24 TAGGAGGTCGTCGTCG TAGG AGGT 1 TAGG AGGT 3 TAGG AGGT CGTC GTCG

25 TAGG AGGT CGTC GTCG CGTC - GTCG TAGG - AGGT CGTCGTAGGT lunghezza 10

26 TAGG AGGT CGTC GTCG TAGG - AGGT - - GTCG - - CGTC TAGGTCGTC lunghezza 9 CGTCGTAGGT

27 ALBERI FILOGENETICI ABCDEF

28 A B C D E F abcde

29

30

31

32

33 A B C D E F abcde esiste un albero filogenetico perfetto con A,B,C,D,E,F nodi?

34 2 foglie 3 foglie 4 foglie AB A AB BCC AB C 5 foglie

35 abcde A B C D E F caratteri ordinati: solo 0 --> 1 ammesso problema facile

36 A B C D E F abcde

37 A B C D E F abcde abcde E C B F D A a cb d e CF BE A D

38 A B C D E F abcde f g A B C D E F abcde f g caratteri non ordinati (filogenia perfetta)

39 D F A C E B


Scaricare ppt "A C G T A A T G G T T A AC T A G T T A G G A A T C G C G C A T T A T G T C C A C G T T A G G T T G A A C G G C A G G T T T A A A T C G A T T C C A C G."

Presentazioni simili


Annunci Google