La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

Le mutazioni riguardano tutti i sistemi biologici; la variabilità genetica è alla base dellevoluzione Universita di Bari by GP&NA.

Presentazioni simili


Presentazione sul tema: "Le mutazioni riguardano tutti i sistemi biologici; la variabilità genetica è alla base dellevoluzione Universita di Bari by GP&NA."— Transcript della presentazione:

1 Le mutazioni riguardano tutti i sistemi biologici; la variabilità genetica è alla base dellevoluzione Universita di Bari by GP&NA

2 Tasso di mutazione FREQUENZA DI MUTAZIONE= numero di eventi di un tipo di mutazione(frazione di cellule o individui di una popolazione) Universita di Bari by GP&NA Probabilita di un particolare tipo di mutazione in funzione del tempo (n o di mutazioni per coppia di nucleotidi per generazione). Esso e influenzato dalla costituzione genetica dellorganismo (Maschi e femmine dello tesso ceppo di Drosophila hanno lo stesso TM,mentre ceppi diversi no).

3 Tassi di mutazione spontanea organismogenetasso Zea maysSh>sh1x10 -6 per generazione Su>su2x10 -6 per generazione D. melanogastery + > y 1x10 -4 per cellula germinale bw + >bw3x10 -5 per cellula germinale Mus musculusD > d3x10 -5 per cellula germinale Homo sapiensemofilia A3x10 -5 per cellula germinale distrofia Duchenne3x10 -4 per cellula germinale acondroplasia7x10 -5 per cellula germinale corea di Huntinghton1x10 -6 per cellula germinale retinoblastoma2x10 -5 per cellula germinale neurofibromatosi9x10 -5 per cellula germinale Universita di Bari by GP&NA

4 Cause delle mutazioni spontanee 1. errori nella replicazione 2. tautomeria: modificazioni spontanee ed occasionali delle basi del DNA 3. errori del crossing over durante la meiosi 4. radiazioni 5. destabilizzazione indotta dagli elementi trasponibili Universita di Bari by GP&NA

5 Errori nella replicazione Genoma umano2,75 x 10 9 basi DNA polimerasi III (5 3) compie errori con frequenza di 1/10 4 basi. Sistema di controllo (3 5) riduce gli errori 1/10 6 Ad ogni ciclo replicativo5,5 x 10 3 mutazioni ogni secondo si replicano 10 9 cellule Universita di Bari by GP&NA

6 Tautomeria le basi possono passare dallo stato chetonico normale a quello enolico raro; dalla forma iminica normale a quella aminica rara. Universita di Bari by GP&NA

7 Tautomeria e conseguenze Nella sua forma rara una base puo formare legami diversi rispetto a quelli normali e causare appaiamenti errati. Universita di Bari by GP&NA

8 Transizione A C G T C T G C A G A C T G G*T C T A G G T C C A G 5 3 A C G T C T G T A G A C G T C T G C A G A C G T C T G C A G 5 3 A C A T C T G T A G A C G T C T G C A G 5 3 A C G T C T G C A G 5 3 Universita di Bari by GP&NA Se la transizione avviene durante la duplicazione del cromosoma causa sostituzione di basi.

9 Lo spettro elettromagnetico Universita di Bari by GP&NA 380nm blu verde giallo rosso 750nm LUCE VISIBILE Onde radio Microonde UVRaggi X Raggi gamma Raggi cosmici Infrarossi nm nm 1nm 10 3 nm 10 6 nm10 9 nm10 3 m lunghezza donda radiazione ionizzante Livello energetico piu alto piu basso

10 Radiazioni ionizzanti e conseguenze Le radiazioni ionizzanti possono provocare rotture cromosomiche e quindi sia riarrangiamenti cromosomici che mutazioni puntiformi. Le radiazioni ionizzanti penetrano nei tessuti in notevole profondità. Nel loro percorso collidono con gli atomi che incontrano e determinano il rilascio di elettroni e la formazione di ioni carichi positivamente. Questi collidono con altre molecole e quindi si liberano ulteriori elettroni e così via. Si forma quindi un cono di ioni lungo il percorso di ogni raggio ad alta energia attraverso i tessuti viventi. Universita di Bari by GP&NA

11 Radiazioni non ionizzanti e riparazione I raggi UV inducono la formazione di dimeri di timina adiacenti nel DNA; questo modifica la conformazione della doppia elica. La distorsione può essere riparata mediante fotoreattivazione e per escissione (a sinistra) TGCTCATATGGACA T T AGTCGGTTCATGGT ACGAGTATACCTGT A A TCAGCCAAGTACCA TGCTCATATGGACA T T AGTCGGTTCATGGT ACGAGTATACCTGT A A TCAGCCAAGTACCA TGCTCATATGG CGGTTCATGGTTGGT ACGAGTATACCTGT A A TCAGCCAAGTACCA TGCTCATATGGACATAGCGGTTCATGGT ACGAGTATACCTGTATCAGCCAAGTACCA TGCTCATATGGACATAGCGGTTCATGGT ACGAGTATACCTGTATCAGCCAAGTACCA Universita di Bari by GP&NA UVformazione di dimeri Endonucleasi Esonucleasi DNA polimerasi I Ligasi

12 Riparazione del DNA nelluomo Xeroderma pigmentosum: malattia autosomica recessiva, estrema sensibilità della pelle ai raggi UV ed elevata incidenza di carcinomi della pelle e melanomi. Causa: incapacità di riparare i danni al DNA provocati dai raggi UV per linabilità ad operare il taglio iniziale che porta alla eliminazione del dimero di timina ed alla sua riparazione. Universita di Bari by GP&NA

13 Origine delle mutazioni spontanee Non esiste una quantità adeguata di radiazioni di fondo (raggi cosmici, materiali radioattivi terrestri) sufficiente per spiegare i tassi di mutazione osservati nella maggior parte degli organismi. Ad esempio, in Drosophila, il tasso di mutazione spontanea è circa 1300 volte quello atteso considerando lintensità delle radiazioni naturali e quindi hanno piccola responsabilità nella determinazione delle mutazioni spontanee. Universita di Bari by GP&NA

14 Carico da radiazione naturale nelluomo sorgente di radiazione dose in mSv/anno radiazioni naturali0,82 radiazione cosmica0,28 radioisotopi nel corpo 0,28 altre radiazioni 0,26 radiazioni dovute alla civilizzazione 0,35 esami radioscopici0,20 radiofarmaci0,02-,04 irradiazione da raggi X dovuti a 0,04-,05 televisione, radiazione da edifici 0,04-,05 inquadramento da test armi nucleari 0,04-,05 centrali nucleari0,01 aereo0,004-,008 TOTALEca. 1,17 Universita di Bari by GP&NA

15 Cause delle mutazioni spontanee La natura del processo di mutazione spontanea va cercata allinterno della cellula e dellorganismo. TEMPERATURA ETA GENI MUTATORI ELEMENTI TRASPONIBILI In Drosophila maschi e femmine dello stesso ceppo hanno = tasso di mutazione, mentre individui di ceppi diversi hanno TM differenti Universita di Bari by GP&NA

16 Elementi trasponibili (ET) Le mutazioni da ET sono molto elevate; per esempio nel granturco i mutanti waxy naturali da ET sono circa 80% Elementi genetici che si spostano nel genoma. Se si inseriscono in/o nelle vicinanze di un gene lo inattivano Universita di Bari by GP&NA ET elemento genetico trasponibile Gene mRNA polipeptide attivo Segmento genico separato da un ET mRNA polipeptide tronco inattivo

17 Possiamo incrementare la frequenza di mutazione? genetici i mutageni fisici chimici Universita di Bari by GP&NA

18 Mutageni chimici e loro azione Nome comune azione, proprietà particolari A. AGENTI ALCHILANTI: donano gruppi alchilici ad altre molecole Gas di mostarda (iprite)transizioni EMS etilazione; transizioni G:C-A:T EESetilazione; bifunzionale lega i due filamenti del DNA provocando rotture ed aberrazioni. NTGdeaminazione B. ANALOGHI DI BASE: incorporati durante la replicazione 5-BUanalogo della timina; transizioni per tautomeria 5-BrDUanalogo della adenina;transizioni per tautomeria 2-APtransizioni per tautomeria C. COLORANTI ACRIDINICI: intercalanti, distorcono la struttura del DNA; alla replicazione si ha linserzione o la delezione di una o più basi Proflavinasfasamento del modulo di lettura Arancio di acridinasfasamento del modulo di lettura Universita di Bari by GP&NA

19 ClB: test per la selezione di mutazioni X-linked indotte in D.melanogaster ClB ? ClB ClB ? Letale P F1 Reincrocio ClB ? Letale ? X X Universita di Bari by GP&NA ? ClB

20 Azione mutagena dei raggi X *il numero delle mutazioni legate al sesso aumenta linearmente con la dose somministrata *il numero di mutazioni è cumulativo Universita di Bari by GP&NA

21 Universita di Bari by GP&NA Incrocio disgenico promuove la mobilizzazione dellelemento trasponibile P conseguenze: - sterilità - alta frequenza di mutazioni - alterazioni cromosomiche - non disgiunzione


Scaricare ppt "Le mutazioni riguardano tutti i sistemi biologici; la variabilità genetica è alla base dellevoluzione Universita di Bari by GP&NA."

Presentazioni simili


Annunci Google