La presentazione è in caricamento. Aspetta per favore

La presentazione è in caricamento. Aspetta per favore

DUPLICAZIONE del DNA DUPLICAZIONE del DNA. Modello di Watson-Crick 1. molecola composta da due catene di nucleotidi 2. le due catene si avvolgono a spirale.

Presentazioni simili


Presentazione sul tema: "DUPLICAZIONE del DNA DUPLICAZIONE del DNA. Modello di Watson-Crick 1. molecola composta da due catene di nucleotidi 2. le due catene si avvolgono a spirale."— Transcript della presentazione:

1 DUPLICAZIONE del DNA DUPLICAZIONE del DNA

2 Modello di Watson-Crick 1. molecola composta da due catene di nucleotidi 2. le due catene si avvolgono a spirale intorno ad un asse centrale formando una doppia elica destrorsa (senso orario discendente) 3. lo scheletro Zucchero-fosfato-zucchero e situato allesterno della molecola con le basi rivolte verso lesterno 4. Le basi sono quasi perpendicolari allasse della molecola, impilate una sullaltra 5. le due catene sono tenute insieme da legami idrogeno

3 Modello di Watson-Crick 6.La pirimidina di una catena è sempre accoppiata alla purina di unaltra catena (C=G ; A=T) 7.Le due catene formate dalla doppia elica corrono in direzioni opposte (antiparallele) 8.Lavvolgimento del DNA genera 2 solchi di grandezza differente (solco maggiore e solco minore). 9.La doppia elica forma un giro completo ogni 10 basi (3,4 nm) 10.Le due catene sono fra loro complementari

4 Modello di Watson-Crick Importanza del modello di Watson-Crick 1.DEPOSITO DELLINFORMAZIONE GENETICA 2.AUTOREPLICAZIONE ED EREDITARIETA 3.ESPRESSIONE DEL MESSAGGIO GENETICO °°°°°°°°°°°°°°°°°° 1.e 2. si basano sulla stabilità del DNA e sulla capacità di una catena di servire da stampo per la costruzione di una nuova catena di DNA 3.Si basa sullorganizzazione del DNA in GENI in regioni di controllo; trascritte/tradotte; terminazione

5 DUPLICAZIONE del DNA La duplicazione del DNA avviene nella fase S del ciclo cellulare G1………S………G2………M………G1………S………G2………M……… 4n 2n 1n MITOSI G1 G0 S G2 M

6 DUPLICAZIONE del DNA La duplicazione del DNA avviene nella fase S del ciclo cellulare G1………S………G2………M1..…M2………XX………S………M………S.. 4n 2n 1n MEIOSI e FECONDAZIONE FECONDAZIONE G1 G0 S G2 M1/M2

7 REPLICAZIONE SEMICONSERVATIVA I due filamenti parentali si separano e ciascuno serve da stampo per la sintesi di un nuovo filamento figlio mediante accoppiamento di basi

8 X no!

9

10

11 ORIGINE DI REPLICAZIONE porzione di circa 250 bp con sito di attacco per le proteine necessarie ad iniziare la replicazione e consentono laccesso allelicasi Si attivano una sola volta ad ogni ciclo cellulare (fase S) Si attivano in successione in regioni variabili del genoma

12

13 Le topoisomerasi sono enzimi che catalizzano la rottura e la riunione reversibile dei filamenti di DNA parentale Tipo I taglia un solo filamento Tipo II taglia entrambi i filamenti

14 DNA POLIMERASI 1.Sintetizzano il DNA solo in direzione 5--> 3 aggiungendo dNTP al gruppo idrossile in 3 di una catena in crescita 2.Funzionano solo su uno stampo di DNA 3.Aggiungono un nuovo dNTP soltanto ad un filamento PRIMER preformato che forma legami idrogeno con lo stampo

15 DNA POLIMERASI Le DNA polimerasi non possono iniziare la sintesi di DNA partendo da dNTP liberi PRIMER Il primer viene sintetizzato da una RNA polimerasi che non necessita di primers

16 DNA POLIMERASI BATTERI : TIPO I TIPO II TIPO III EUCARIOTI :α β γ --> Mitocondriale δ ε

17 DNA POLIMERASI DNA polimerasi α, δ, ε attive in cellule in divisione/replicazione °°°°°°°°°°°°°° DNA polimerasi β sempre attiva sia in cellule quiescenti che in divisione ha un ruolo nella riparazione dei danni al DNA

18 DNA POLIMERASI ATTIVITA di PROOFREADING delle DNA polimerasi durante lallungamento la DNA polimerasi si destabilizza con una mutazione TAGCGTG ……ATCGCGCTGATAGATGCTGGTGATGATGGGGATTTTATATATAATATA TAAGGA… La DNA polimerasi torna indietro (3-->5) con ATTIVITA ESONUCLEASICA rimuove le basi errate sostituendole con le basi corrette (perdita del 3xfosfato in 5)

19 DNA POLIMERASI FEDELTA della REPLICAZIONE - le DNA polimerasi possono riparare errori o danni al DNA. Durante la sintesi le DNA pol α, ε (pol III nei batteri) vedono le mutazioni e le riparano TAGCG GACTATC ……ATCGCGCTGATAGATGCTGGTGATGATGGGGATTTTATATATAATATA TAAGGA… Il loop viene riconosciuto e rimosso dalla DNA pol ε T

20 DNA doppia catena antiparallela X la DNA polimerasi non puo sintetizzare il secondo filamento che corre in direzione opposta perche non puo andare in 3-->5 X

21 Generazione del: FILAMENTO LEADER sintetizzato in modo continuo dalla DNA pol in direzione 5-->3 FILAMENTO RITARDATO sintetizzato tramite i FRAMMENTI DI OKASAKI in modo discontinuo e successivamente uniti tra loro

22 La Primasi (batteri) o la DNA pol α/primasi (eucarioti), enzima che sintetizza brevi frammenti di RNA complementari allo stampo del filamento ritardato sulla forcella di replicazione Fornisce il primer di innesco per la DNA pol δ che forma il frammento di Okasaki il primer deve essere rimosso e sostituito

23 La rimozione e sostituzione del primer e operata: - nei batteri --> dalla RNAsi H - negli eucarioti --> dalla azione RNAsica delle DNA polimerasi Attivita 5-3 ESONUCLEASICA Il primer viene eliminato e la parte di RNA rimossa viene riempita dallazione riparatrice della DNA pol δ (DNA pol III nei batteri)

24 Al termine i frammenti di Okasaki contigui formatesi sul filamento ritardato Vengono legati utilizzando ATP dalla DNA LIGASI

25 TELOMERASI Aggiungono i telomeri alle estremita dei cromosomi Agiscono senza stampo di DNA La Telomerasi e una Trascrittasi inversa Sintetizza DNA da uno stampo di RNA contenuto nellenzima (coenzima) complementare ai telomeri

26 Filmati sulla replicazione del DNA(ed altro) alla pagina:


Scaricare ppt "DUPLICAZIONE del DNA DUPLICAZIONE del DNA. Modello di Watson-Crick 1. molecola composta da due catene di nucleotidi 2. le due catene si avvolgono a spirale."

Presentazioni simili


Annunci Google